Coronary heart disease related long-chain non-coding RNA TPRG1-AS1 and application of binding protein MYH9 thereof

Abstract

The application provides application of a long-chain non-coding RNA TPRG1-AS1 and a binding protein MYH9 related to coronary heart disease. Specifically, the application provides application of the long-chain non-coding RNA TPRG1-AS1 in preparation of a reagent for regulating migration of smooth muscle cells, and application of the long-chain non-coding RNA TPRG1-AS1 in preparation of a preparation for inhibiting neointimal formation. The application also provides application of the long-chain non-coding RNA TPRG1-AS1 in preparation of a preparation for interacting with the MYH9 protein, and application of the MYH9 gene and / or protein in preparation of a reagent for regulating migration of smooth muscle cells.

Description

Technical Field

[0001] This invention relates to the application of a coronary heart disease-related long non-coding RNA TPRG1-AS1 and its binding protein MYH9, specifically, to the application of TPRG1-AS1 in the preparation of reagents for inhibiting HASMC migration, inhibiting neointimal formation, and / or inhibiting atherosclerotic lesions. Background Technology

[0002] The most prominent feature of atherosclerotic cardiovascular diseases (ASCVDs) is the formation of atherosclerotic plaques. Most cells in atherosclerotic plaques originate from vascular smooth muscle cells (VSMCs) that migrate from the tunica media. The abnormal proliferation of VSMCs during their migration from the tunica media to the intima causes intimal thickening, leading to vascular remodeling.

[0003] Long non-coding RNAs (lncRNAs), widely expressed in mammals, are a class of RNA molecules exceeding 200 nucleotides (nt) in length and encoding almost no proteins. lncRNAs play a wide range of roles in various biological activities, including chromatin remodeling, alternative splicing, genomic imprinting, and cell cycle regulation, by regulating gene expression at the transcriptional, post-transcriptional, and epigenetic levels. It has been reported that lncRNAs play a crucial role in regulating VSMC phenotypic transitions through protein interactions. For example, lncRNA AK098656 induces VSMC phenotypic transitions by promoting the degradation of MYH11 / FN1 protein. Antisense non-coding RNA (ANRIL) at the INK4 locus acts as a scaffold for the WDR5 and HDAC3 complex and promotes phenotypic transitions in human aortic smooth muscle cells (HASMCs). Cardiac mesodermal enhancer-associated non-coding RNA (CARMN) promotes a contractile phenotype in human coronary artery smooth muscle cells (HCASMCs) by directly binding to MYOCD.

[0004] However, the regulatory roles and mechanisms of most lncRNAs in human aortic smooth muscle cell phenotypic transformation and vascular remodeling have not been fully elucidated. Summary of the Invention

[0005] One object of the present invention is to provide an application of the long non-coding RNA TPRG1-AS1.

[0006] One object of the present invention is to provide an application of MYH9, a binding protein of the long non-coding RNA TPRG1-AS1.

[0007] The inventors' research group previously conducted lncRNA / mRNA microarray analysis on peripheral blood mononuclear cells from 93 cases of coronary artery disease (CAD) and 48 controls, obtaining a complete transcriptome-level lncRNA / mRNA expression profile (GSE113079) for CAD. Using qRT-PCR technology, they replicated and validated this finding in a large sample of 412 CAD cases and 295 controls, confirming TPRG1-AS1 as a novel diagnostic biomarker for CAD. The loss of TPRG1-AS1 in macrophages affects the expression of inflammation-related genes and nearby genes. Furthermore, in tumor-related studies, TPRG1-AS1 has been found to inhibit tumor progression by inducing RBM24 expression and activating caspase 3 / 7-mediated apoptosis. The study of this invention found that TPRG1-AS1 is a true long non-coding RNA without protein coding ability. TPRG1-AS1 plays an important regulatory role in aortic smooth muscle cell phenotypic transformation and vascular remodeling, thus providing the application of TPRG1-AS1 in the preparation of agents for inhibiting HASMC migration, neointima formation and / or atherosclerotic lesions. Furthermore, the related application of the binding protein MYH9 of TPRG1-AS1 is also provided.

[0008] Specifically, on the one hand, the present invention provides the application of long non-coding RNA TPRG1-AS1 in the preparation of reagents that regulate smooth muscle cell migration.

[0009] According to a specific embodiment of the present invention, the full-length sequence of TPRG1-AS1 is 1279 nt, and the specific sequence is shown in SEQ ID NO:1.

[0010] On the other hand, the present invention also provides the application of long non-coding RNA TPRG1-AS1 in the preparation of formulations that inhibit the formation of neointima in blood vessels.

[0011] According to a specific embodiment of the present invention, TPRG1-AS1 inhibits atherosclerotic lesions by inhibiting the formation of new intima in smooth muscle cells.

[0012] According to a specific embodiment of the present invention, in this application, the smooth muscle cells are vascular smooth muscle cells. In some more specific embodiments, the smooth muscle cells are arterial smooth muscle cells.

[0013] On the other hand, the present invention also provides the use of long non-coding RNA TPRG1-AS1 in the preparation of formulations that interact with MYH9 protein.

[0014] According to a specific embodiment of the present invention, TPRG1-AS1 interacts with the MYH9 protein to promote MYH9 protein degradation and / or inhibit F-actin stress fiber formation.

[0015] According to a specific embodiment of the present invention, TPRG1-AS1 interacts with MYH9 protein to regulate smooth muscle cell migration.

[0016] According to a specific embodiment of the present invention, VSMC-specific TPRG1-AS1 overexpression reduces the MYH9 protein level in atherosclerotic plaques and alleviates atherosclerotic lesions.

[0017] On the other hand, the present invention also provides the application of the MYH9 gene and / or protein in the preparation of reagents that regulate smooth muscle cell migration.

[0018] In some specific embodiments of this invention, the expression of TPRG1-AS1 was analyzed using the genotype-tissue expression (GTEx) database, atherosclerosis-related GEO datasets, and a platelet-derived growth factor BB (PDGFBB)-induced HASMC cell model. TPRG1-AS1, which was significantly upregulated in atherosclerotic plaques, was identified as a true lncRNA, and the full-length and subcellular localization of its transcript in HASMCs were described. Functionally, TPRG1-AS1 regulates HASMC migration rather than proliferation. Mechanistically, in HASMCs, TPRG1-AS1 promotes MYH9 protein degradation and inhibits F-actin stress fiber formation through direct interaction with MYH9 protein. Smooth muscle cell-specific TPRG1-AS1 transgenes significantly reduced neointima formation and significantly alleviated the severity of atherosclerotic lesions in Apoe- / - mice.

[0019] Overall, this invention demonstrates through specific experiments the application of long non-coding RNA TPRG1-AS1 in inhibiting HASMC migration, neointimal formation, and / or atherosclerotic lesions. Attached Figure Description

[0020] Figures 1A to 1E This shows the expression of TPRG1-AS1 in the genotype-tissue expression (GTEx) database, the atherosclerosis-associated GEO dataset, and the PDGFBB-induced HASMCs cell model. Figure 1A Expression levels of TPRG1-AS1 in different human tissues in the GTEx database. Figure 1B Expression of TPRG1-AS1 in human carotid atherosclerotic plaques and internal mammary artery (IMA) (n=9). Figure 1C Expression level of TPRG1-AS1 in the microarray dataset (GSE97210). Figure 1DExpression levels of TPRG1-AS1 in the RNA-seq dataset (GSE120521). Figure 1E Downregulation of TPRG1-AS1 expression levels in HASMCs induced by PDGF-BB (n=6).

[0021] Figure 2 This demonstrates a rapid cloning strategy for the unknown 5' and 3' ends of the full-length TPRG1-AS1 transcript.

[0022] Figure 3A The results of 1.0% agarose gel electrophoresis for detecting 5'-RACE PCR products are shown. Lane 1 is the DL2500 marker, and lane 2 is the product amplified by RACE PCR using TPRG101-R108. The clearly labeled band is F493. Figure 3B The results of 3'-RACE PCR product detection by 1.0% agarose gel electrophoresis are shown. Lane 1 is the DL2500 marker, and lane 2 is the nested PCR amplification product of TPRG101-F344 and TPRG101-F493. The clearly labeled band is 2F493.

[0023] Figure 4 Northern blot experiments were used to verify the transcript size and expression abundance of TPRG1-AS1 in HUVEC and VSMC, with U6 as an internal control.

[0024] Figure 5 RNA FISH was used to detect the subcellular localization of TPRG1-AS1 in HASMCs. TPRG1-AS1 was stained red by a specific TPRG1-AS1 fluorescent probe, and the nucleus was stained blue by DAPI fluorescent dye.

[0025] Figure 6 This demonstrates an in vitro transcription-translation experiment of TPRG1-AS1.

[0026] Figure 7 The image shows the effect of TPRG1-AS1 on HASMC proliferation. Image A: CCK8 assay showing the effect of TPRG1-AS1 knockdown on HASMC cell proliferation. Image B: CCK8 assay showing the effect of TPRG1-AS1 overexpression on HASMC cell proliferation.

[0027] Figure 8The image shows the effect of TPRG1-AS1 on HASMC migration. Image A: Transwell assay to detect the effect of TPRG1-AS1 overexpression on cell migration in HASMCs. Image B: Transwell assay to detect the effect of TPRG1-AS1 knockdown on cell migration in HASMCs. Image C: Effect of TPRG1-AS1 overexpression on cell migration in HASMCs in the presence of PDGFBB stimulating factor.

[0028] Figure 9 The RNA pull-down assay identifies the protein that binds to TPRG1-AS1. Input: Whole cell protein extract; sense: Pull-down results of the sense strand of TPRG1-AS1; anti-sense: Pull-down results of the antisense strand of lncRNA TPRG1-AS1; beads: Pull-down results of empty magnetic beads.

[0029] Figure 10 The CHIRP assay confirms the interaction between TPRG1-AS1 and MYH9 protein within HASMCs. Image A shows qRT-PCR detection of the target RNA enriched by the TPRG1-AS1 probe, with GAPDH and LacZ probes used as negative controls. Image B shows Western blotting detection of MYH9 protein bound to TPRG1-AS1 and the control probes.

[0030] Figure 11 The RIP experiment confirms the interaction between TPRG1-AS1 and MYH9 protein within HASMCs. Image A shows Western blotting detection of proteins bound to MYH9-specific antibodies and IgG during the RIP assay. Image B shows qPCR detection of TPRG1-AS1 and GAPDH expression levels in RNA bound to MYH9-specific antibodies and IgG. GAPDH was used as a negative control.

[0031] Figure 12 The results show that TPRG1-AS1 does not affect MYH9 mRNA levels. Image A: qRT-PCR detection of the effect of TPRG1-AS1 overexpression on MYH9 mRNA levels in HASMCs. Image B: qRT-PCR detection of MYH9 mRNA levels in HASMCs after TPRG1-AS1 knockdown.

[0032] Figure 13The interaction between TPRG1-AS1 and MYH9 protein is shown to affect MYH9 protein levels. Image A: Western blot analysis of the effect of TPRG1-AS1 overexpression on MYH9 protein levels in HASMCs. Image B: Western blot analysis of the effect of knockdown of endogenous TPRG1-AS1 gene expression levels on MYH9 protein levels in HASMCs. Image C: Treatment of HASMCs with the protein synthesis inhibitor actinomycin (CHX) to determine the half-life of MYH9 protein. Image D: Treatment of HASMCs with the protease inhibitor MG132 to determine the degradation pathway of MYH9 protein.

[0033] Figure 14 The image shows the regulation of HASMC migration by the MYH9 gene. Image A: Effect of MYH9 knockdown on cell migration in HASMCs. Image B: Effect of MYH9 overexpression on cell migration in HASMCs. Image C: Effect of TPRG1-AS1 and MYH9 knockdown on cell migration in HASMCs.

[0034] Figure 15 The interaction between TPRG1-AS1 and MYH9 proteins affects the formation of F-actin stress fibers in cells. Image A shows the effect of MYH9 overexpression or knockdown in HASMCs on F-actin stress fiber formation. Image B shows the effect of TPRG1-AS1 overexpression in HASMCs on PDGFBB-induced F-actin stress fiber formation. Image C shows the effect of endogenous MYH9 gene knockdown in HASMCs on F-actin stress fiber formation induced by endogenous TPRG1-AS1 knockdown. The nucleus was specifically stained blue with DAPI, and F-actin was specifically stained red with Phalloidin-iFluor647 reagent.

[0035] Figure 16 This image shows that TPRG1-AS1 overexpression inhibits neointimal formation induced by balloon injury in the rat carotid artery. Image A: Carotid arteries of rats infected with Ad-TPRG1-AS1- and Ad-GFP 14 days after balloon injury. Image B: Intima-media area of ​​carotid arteries of rats infected with Ad-TPRG1-AS1- and Ad-GFP. Image C: Intima / media ratio of carotid arteries of rats infected with Ad-TPRG1-AS1- and Ad-GFP.

[0036] Figure 17The images show a reduction in neointimal tissue specific to VSMCs using the TPRG1-AS1 transgenic mouse model. Image A: qPCR detection of TPRG1-AS1 expression in MASMCs isolated from TPRG1-AS1 transgenic mice. Images B and C: Western blot detection of MYH9 protein expression levels in MASMCs. Image D: Effect of TPRG1-AS1 overexpression on stress fiber formation in MASMCs. Images E and F: Effect of TPRG1-AS1 overexpression on MASMC migration. Image G: TPRG1-AS1 expression 14 days after guidewire injury. SMCKI Carotid arteries of mice and control mice. Image H: TPRG1-AS1 SMCKI Carotid intima-media area of ​​mice and control mice. Image I: TPRG1-AS1 SMCKI Carotid intima / media ratio in mice and control mice.

[0037] Figure 18 The image shows that VSMC-specific TPRG1-AS1 overexpression attenuates atherosclerosis. Image A and Image B show TPRG1-AS1 stained with Oil Red O staining after 20 weeks of high-fat induction. SMCKI Apoe - / - Aorta of control mice and control mice. Images C and D: HE-stained TPRG1-AS1 SMCKI Apoe - / - Aortic root of mice and control mice. Image E: MYH9 (green) immunofluorescence staining of TPRG1-AS1. SMCKI Apoe - / - Aortic root of mice and control mice. Image F: Percentage of MYH9 positive areas (green) in atherosclerotic plaques at the aortic root. Detailed Implementation

[0038] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the technical solution of this invention will now be described in detail with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of this invention. In the embodiments, all original reagent materials are commercially available, and experimental methods not specifically specified are conventional methods and conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0039] Unless otherwise specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art in the relevant field.

[0040] Some of the reagents and instruments used in the experiment are shown in Table 1.

[0041] Table 1

[0042]

[0043]

[0044] The main experimental methods include:

[0045] 1. RNA fluorescence in situ hybridization (RNA-FISH) assay to determine the co-localization of TPRG1-AS1 and MYH9 proteins in HASMCs.

[0046] A. HASMC separation and slide preparation: HASMCs in T75 cell culture flasks were cultured to the logarithmic growth phase and in good condition with approximately 80% cell confluence. The cells were then digested. Circular coverslips were placed at the bottom of 24-well plates beforehand, and the cells were washed three times with PBS and air-dried in a biosafety cabinet. The cells were then uniformly diluted to 2 × 10⁻⁶. 4 Add 500 μL of cell suspension to a 24-well cell culture plate pre-placed with a round glass slide, and continue culturing for 24 hours in an incubator containing 5% CO2 at 37°C.

[0047] B. RNA FISH: Prepare fluorescently labeled TPRG1-AS1 probes with the following sequence (183 bp, SEQ ID NO:2): GTACTCTGTCTCTGTCCTGGGTGTTCGGGATCAAGGCCTTTTGAACCAATTCCGGAATCCGCCACCGGGCGGTGGTAGGAGAGAGCCAGAGGATTCGTCAGTAAGTGTGCGTGCGTGACAGAGGGCTTTTAAATAGATCGCTTTGTATCTAGCACGGTAGCACCTGCTTCTAAGCTTCCAACG; Hybridize according to the instructions of the hybridization kit.

[0048] 2. RACE assay

[0049] The full-length transcript of TPRG1-AS1 was confirmed using the SMARTer RACE 5' / 3' kit (Clontech Laboratories, Mountain View, CA, USA) according to the rapid amplification of cDNA ends (RACE) assay. Manufacturer's instructions were followed. For nested PCR, at least two sets of primers were designed and synthesized. PCR products were separated on a 1.0% agarose gel. Electrophoresis results confirmed the amplified bands, which were then sequenced by cloning into pEASY-Blunt Simple bacteria and subsequently transformed into trans-T1 bacteria. Single colonies were selected for sequencing, and the sequencing results were compared and analyzed. Cycling parameters were: 25 × 10⁻⁵ (94℃ 30s, 68℃ 30s, 72℃ 3min). The sequences of the oligonucleotide primers and probes used for reverse transcription RACE PCR are shown in Table 2.

[0050] Table 2

[0051]

[0052] 3. Northern blot

[0053] Total RNA was extracted from HASMCs using Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). 20 μg of total RNA was subjected to 7.5 M urea-12% formaldehyde (PAA) denaturing gel electrophoresis and transferred to a Hybond N+ nylon membrane (Amersham, Freiburg, Germany). The membrane was cross-linked by UV irradiation for 2 minutes. The antisense DNA probe TPRG1-AS1 was used for hybridization. The membrane was washed twice for 20 minutes each time at 42°C with 2×SSC + 0.1% SDS solution (Invitrogen Life Technologies, Carlsbad, CA, USA). The U6 probe was used as a positive control. Primer sequences are shown in Table 3.

[0054] Table 3

[0055]

[0056] 4. Detect the roles of TPRG1-AS1 and MYH9 genes in HASMC phenotypic transformation.

[0057] Cell proliferation was detected using the CCK8 assay kit: Cells were routinely digested, and single-cell suspensions were prepared in groups and seeded in parallel in 96-well plates at two gradients (2 × 10⁻⁶). 3 and 4×10 3Cells were seeded per well (100 μL of culture medium per well, with 3 parallel wells). At 24, 48, and 72 hours post-transfection or infection, a group of cells was harvested, and 10 μL of 5 mg / ml CCK8 solution was added to each well. The cells were cultured for another 4 hours, and the culture medium was carefully aspirated from the wells. The OD value of each well was measured using a microplate reader (wavelength 490 nm), and a cell growth curve was plotted.

[0058] Cell migration was detected using Transwell chambers: 24 hours after transfection or infection, cells were digested and incubated in 100 μL (2.5 × 10⁻⁶) mL of water. 5 Add 100 μL of SMCM medium containing 10% FBS to the upper chamber and 5% CO2 to the lower chamber. Incubate for 24 hours at 37°C. Remove the upper chamber and carefully remove the cells from the upper surface of the chamber membrane with a cell wipe or cotton swab. After staining the lower surface cells with crystal violet, analyze the number of migrating cells using ImageJ software.

[0059] 5. RNA pulldown, silver staining, and mass spectrometry analysis

[0060] Biotinylated RNA probes were incubated with streptavidin magnetic beads (Invitrogen, catalog number 15942-050). Total cellular proteins were extracted using RIPA lysis buffer containing a complete protease inhibitor (Roche, Germany). A total of 1 mg of total cellular protein was added to the RNA-bound streptavidin magnetic beads, and the complex was incubated at room temperature for 1 hour. The complex was then centrifuged at 1000 rpm for 10 minutes and washed three times with wash buffer. RNA-bound proteins were eluted in 50 μl of 5x SDS sample buffer, denatured at 95 °C for 10 minutes, and then separated by SDS-PAGE on an 8% acrylamide gel (Bio-Rad, Hercules, CA). RNA-bound proteins were visualized by silver staining (Beyotime, China, Cat. #P0017S), and the protein bands of interest were excised and sequenced by mass spectrometry (MS) at Shanghai LuMing Biological Technology Co., Ltd. (Shanghai, China).

[0061] 6. RIP experiments confirmed the interaction between TPRG1-AS1 and MYH9 proteins in vivo.

[0062] Experimental procedures were performed according to the kit (EZ-Magna RIP RNA-Binding Protein Immunoprecipitation Kit, Millipore-17-701). Cell lysis buffer was prepared with pre-chilled PBS, and a magnetic bead-MYH9 protein antibody (ab238131) complex was added to purify RNA. qRT-PCR was used to detect the TPRG1-AS1 enrichment level. Rabbit IgG (ab172730) was used as a negative control.

[0063] The primers used are as follows:

[0064] TPRG1-AS1-F:TCAAAAGGCCTTGATCCCGA(SEQ ID NO:21)

[0065] TPRG1-AS1-R:AAGGACTCTGCTTCATGGGTG (SEQ ID NO:22)

[0066] GAPDH-F: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 23)

[0067] GAPDH-R:ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 24).

[0068] 7. ChIRP Experiment

[0069] A 20-mer antisense DNA probe targeting TPRG1-AS1 RNA and a negative control lacZ RNA were designed, ensuring that one probe covers every 100 bp of RNA with a target GC% of 45%. All probes were biotinylated at the 3' end. First, cultured cells (>2.0 × 10⁻⁶) were... 6Cells were cross-linked to 960 mJ using 240 mJ UV light, and 1 mL of pre-chilled PBS containing 10 μL of stop mixture was added. Cells were scraped off. Cells containing protease inhibitors were added to the UV-cross-linked cells in 1 mL of lysis buffer suspension. If a sticky substance was produced, the genome could be disrupted by sonication. TPRG1-AS1 and its interacting proteins were precipitated using streptavidin magnetic beads (Invitrogen, Ca, USA). RNA was eluted with RNA pK buffer and proteinase K, followed by separation using Trizol reagent. Proteins were eluted with a mixture of RNase a (Sigma-Aldrich), RNase H (Epicenter), and DNase I (Invitrogen). The separated TPRG1-AS1 was verified by qRT-PCR analysis, and the proteins were identified by Western blot. Primers and probes used are shown in Table 4.

[0070] Table 4

[0071]

[0072] 8. Detection of the effect of TPRG1-AS1 on MYH9 protein

[0073] HASMCs were infected with AdGFP and AdTPRG1-AS1, or transfected with siNC and siTPRG1-AS1, respectively. Cell proteins were extracted 48 hours later, and Western blot was used to detect changes in MYH9 protein.

[0074] 9. Detection of the half-life of MHY9 protein

[0075] HASMCs were transfected with siNC and siTPRG1-AS1, respectively. After 24 hours, the cells were treated with the protein synthesis inhibitor actinomycin (500 μM). Cell proteins were extracted at 0, 8 and 16 hours after treatment, and Western blot was used to detect changes in MYH9 protein.

[0076] 10. Detection of MYH9 protein stability

[0077] HASMCs were transfected with siNC and siTPRG1-AS1, respectively. After 24 hours, the cells were treated with MG132 (40 μM) with DMSO as a control. After 24 hours, cell proteins were extracted and Western blot was used to detect changes in MYH9 protein.

[0078] 11. The effect of the interaction between TPRG1-AS1 and MYH9 proteins on the formation of the F-actin backbone in HASMCs.

[0079] 24 hours after HASMC infection or transfection, F-actin staining was used to detect the formation of the F-actin cytoskeleton in HASMCs. The following steps were performed: One day before treatment, HASMCs in good condition and at logarithmic growth phase were digested with trypsin and seeded into 12-well cell culture plates. Small discs (cell spreaders) were placed at the bottom of the 12-well plates. The plates were incubated at 37°C with 5% CO2 for 24 hours. The next day, the original culture medium was discarded, and fresh complete culture medium and treatment reagents were added. The plates were incubated at 37°C with 5% CO2 for another 24 hours. The treated cells were then removed and gently washed twice with 1 mL of PBS each time. 500 μL of 4% paraformaldehyde solution was added to each well, and the cells were fixed at room temperature for 30 minutes. The cells were then gently washed twice with 1 mL of PBS each time. 500 μL of 0.1% Triton X-100 was added to each well for 5 minutes to permeate the cells. The cells were then gently washed twice with 1 mL of PBS each time. 500 μL of Triton X-100 solution was added to each well. F-actin fluorescently labeled antibody (1:1000, Red Fluorescence-Cytopainter, ab112127) was used for staining at room temperature for 90 min; the cells were gently rinsed twice with PBS, 1 mL each time; 500 μL of DAPI staining solution (1:1000, ab104139) was added to each well and stained at room temperature for 10 min; the cells were rinsed twice with PBS, 1 mL each time; glycerol was dropped onto a glass slide, and a small round disc was placed upside down on the slide. The cells were then photographed and observed under a confocal fluorescence microscope in the dark.

[0080] 12. Application of F-actin formation reversion assay

[0081] Knockdown of TPRG1-AS1 also knocked down the MYH9 gene. F-actin staining was used to detect the formation of the F-actin backbone in HASMCs, clarifying the effect of the interaction between TPRG1-AS1 and MYH9 proteins on the formation of the F-actin backbone in HASMCs.

[0082] 13. Application of cell migration and cytoskeleton formation recovery experiments

[0083] While knocking down TPRG1-AS1, cells were treated with the F-actin polymerization inhibitor cytochalasin D (10⁻⁷ μM) for 24 hours using DMSO as a control. Transwell migration assays were performed, and F-actin staining was performed in parallel to detect the formation of the F-actin cytoskeleton in HASMCs, confirming that the formation of the cytoskeleton F-actin is essential for the migration of HASMCs induced by knockdown of TPRG1-AS1.

[0084] 14. Study on the role of TPRG1-AS1 in neovascularization and intimal formation using a rat carotid balloon injury model.

[0085] Balloon dilation of the left carotid artery in rats was performed, with the right carotid artery without balloon injury serving as a control. Male Sprague-Dawley rats weighing 350-400g were anesthetized with sodium pentobarbital (30 mg / kg body weight) to expose the left carotid artery. A 2.0 mm diameter balloon catheter was inserted into the left common carotid artery via the external carotid artery. The balloon was inflated and removed from the left common carotid artery, repeated three times. After balloon injury, 100 μL of Ad-TPRG1-AS1 (1.5 × 10⁸ pfu / mL) or Ad-GFP (1.5 × 10⁸ pfu / mL) solution was injected into the ligated segment of the left common carotid artery and maintained for 30 minutes. Animals were sacrificed 14 days after balloon injury, and the artery was isolated, harvested, fixed in 10% paraformaldehyde for 24 hours, and embedded in paraffin. Each sample was uniformly sectioned into 5-8 sections at the injury site. Hematoxylin / eosin staining was used to quantify the degree of neointimal formation. The intima-media (I / M) area ratio was measured using ImageJ software.

[0086] 15. Study on vascular remodeling in smooth muscle cell-specific TPRG1-AS1 transgenic mice

[0087] A. Primary culture of mouse aortic smooth muscle cells: isolated experimental group mice (TPRG1-AS1) SMCKI ) and control group mice (TPRG1-AS1) WT To establish a primary culture system for aortic smooth muscle cells: Mice (over 8 weeks old) were routinely anesthetized and immersed in 75% ethanol for 5 minutes. The thoracic and abdominal cavities were opened to expose the heart. An incision was made in the right atrium using ophthalmic scissors, and the left ventricle was punctured with a 5 mL syringe. The aorta was rinsed with PBS buffer. The aorta was completely separated and placed in a 35 mm sterile petri dish. 1 mg / mL collagen I was prepared with serum-free DMEM and filtered into a new centrifuge tube. The extravascular connective tissue was thoroughly dissected under a microscope and digested with collagen I for 30 minutes to 1 hour. The adventitia of the blood vessels was dissected under a microscope, and the intima was gently scraped off with sterile forceps. The three blood vessels were placed in a 5 mL centrifuge tube and minced (1 mm × 1 mm × 1 mm). The tissue was transferred to a primary cell culture flask and digested at 37°C for 2 hours. The cells were centrifuged at 1000 RPM for 5 minutes, and the supernatant was carefully discarded. The pellet was resuspended in 20% FBS and added to the culture flask. The cells were incubated statically for 3 days. After 3 days, the cells were basically confluent. The culture medium was replaced with fresh medium. When the cells reached 80% confluence, they were transferred to a 6 cm culture dish.

[0088] B. Effect of TPRG1-AS1 overexpression on MYH9 protein levels: Smooth muscle cell proteins from two genotypes were extracted, and Western blot was used to detect changes in MYH9 protein expression to study the effect of TPRG1-AS1 overexpression on MYH9 protein levels in mouse arterial smooth muscle cells.

[0089] The effect of C.TPRG1-AS1 overexpression on cell migration: Transwell migration assay was used to detect cell migration in two groups and to study the effect of TPRG1-AS1 overexpression on the migration of mouse arterial smooth muscle cells.

[0090] D. Effect of TPRG1-AS1 overexpression on F-actin formation in the cytoskeleton: The formation of F-actin in two groups of cells was detected by fluorescently labeled phalloidin to study the effect of TPRG1-AS1 overexpression on F-actin formation in mouse aortic smooth muscle cells.

[0091] E. Carotid artery guidewire injury model: Mice weighing 25-35 grams (8-12 weeks old) were intraperitoneally injected with 3% chloral hydrate at a dose of 0.2 ml / 25 g body weight. Mice were fixed in a supine position, their hair was removed, and the instruments were disinfected three times with sterile cotton swabs. Carotid artery surgery was performed under a dissecting microscope, with a midline incision on the ventral side of the neck to expose and separate the left carotid artery. The proximal end of the left common carotid artery was ligated first. A ligation suture was placed at the carotid bifurcation and on the internal carotid artery, and then ligated. The internal carotid artery was used as a guide wire. Two ligatures (surgical wire, size 6-0) were placed distally at the carotid bifurcation and on the external carotid artery. An incision was made between the two ligatures, and a curved flexible guide wire (0.35 mm in diameter) was inserted 1 cm into the common carotid artery through the incision, rotating three times along the vessel before being removed. The proximal end of the external carotid artery incision was ligated. The ligatures of the internal and common carotid arteries were released to restore blood flow. The skin incision was closed with two suture clips (7.5 × 1.75 mm). Fourteen days later, the mice were sacrificed, and the carotid artery was harvested, fixed overnight in 4% paraformaldehyde, embedded in paraffin, and stained with hematoxylin and eosin (HE) to examine the intimal thickening of the femoral artery.

[0092] 16. TPRG1-AS1 SMCKI Apoe - / - Study on mouse model of atherosclerosis

[0093] TPRG1-AS1 SMCKI Mice and Apoe - / - Mouse hybridization, propagation, and identification were conducted to ultimately obtain a sufficient number of TPRG1-AS1 mice. SMCKI Apoe - / - Male mouse.

[0094] A. High-fat diet induction: Experimental group (TPRG1-AS1) SMCKI Apoe - / - Mice, control group (TPRG1-AS1) SMCKI Mice, all male and 8 weeks old, were fed a high-fat diet (Huafukang H10141) for 20 weeks (TPRG1-AS1). SMCKI Apoe - / - Group, TPRG1-AS1 SMCKI 40 mice were housed in groups of 10 each, kept in individual cages at a room temperature of 18-25℃ and a relative humidity of 50%-80%, with 12 hours of light per day and free access to food and water.

[0095] B. Physiological index measurement: The vitality and survival of mice in each group were observed and recorded, and their body weight was measured. The real-time physiological indicators of mice, such as blood pressure, body temperature, electrocardiogram, respiration, and activity level, were recorded within one week using a DSI implantable physiological signal telemetry system.

[0096] C. Blood collection and determination of blood lipid concentrations (TC, TG, HDL-c and LDL-c): Mice were anesthetized intraperitoneally with 3% chloral hydrate at a dose of 0.2 ml / 25 g body weight. Blood samples were obtained from the retro-orbital venous plexus and collected in 1.5 ml microcentrifuge tubes. After coagulation at room temperature, the samples were centrifuged at 3000 rpm for 10 minutes. The supernatant was collected in a new centrifuge tube, and the volume was recorded. The samples were diluted with physiological saline to a total volume of 500 μl. Total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-c) and low-density lipoprotein cholesterol (LDL-c) were detected by a fully automated biochemical analyzer.

[0097] D. Abdominal aorta sampling, morphological observation by Oil Red O staining and analysis of the degree of arterial lesions: After the aorta was fixed by retrograde perfusion from the left ventricle with physiological saline and 4% paraformaldehyde, the entire aorta was severed from the root of the aorta to the end of the abdominal aorta.

[0098] Gross vascular sampling: Dissect the mouse, expose the thoracic and abdominal aorta, peel off the adventitia, separate the tissue, and preserve the aortic root (including the three bifurcations of the aortic arch) to the iliac artery bifurcation; fix it in 4% paraformaldehyde. Under stereoscopic guidance, fix both ends with needles, and carefully dissect the peripheral fat until no obvious residue remains. Under stereoscopic guidance, carefully cut the aorta longitudinally with microscopic scissors, and similarly cut the three bifurcations of the aortic arch and the iliac artery bifurcation. Spread the cut aorta onto a water-containing black plastic sheet, lumen side up, and fix it with fine needles from top to bottom, keeping the needles facing outwards, to expose the blood vessel for photography.

[0099] E. Oil Red O Staining: The Oil Red O working solution is prepared by mixing Oil Red O stock solution and distilled water in a 3:2 ratio, filtered through a 0.22 μm filter, and set aside for use. Discard the water in the black gel plate, and soak the aorta with 60% isopropanol for 10 minutes; discard the excess isopropanol, add Oil Red O working solution, and stain for 30 minutes to 1 hour; rinse three times with distilled water to remove excess stain; add clean distilled water to cover the blood vessel, and wait for photography.

[0100] The stained aorta was placed on a rubber surface and photographed with a digital camera at macro. The images were then analyzed using Image Pro Plus software to detect the total lipid area stained with Oil Red O and the total epidermal area of ​​the aorta: the plaque formation index = (total Oil Red O positive staining area / total epidermal area of ​​the aorta) × 100%.

[0101] F. HE staining: 4μm thick paraffin sections were stained with HE using an automated HE staining device according to standard procedures.

[0102] G. Immunofluorescence staining: Paraffin sections were blocked in goat serum blocking buffer for 1 hour, then dewaxed and antigen-retrieved, and incubated overnight at 4°C with MYH9 (ab75590, 1:200). After warming at 37°C for 1 hour, the sections were washed with PBS and incubated at 37°C for 1 hour with fluorescently labeled secondary antibody (Alexa Fluor 488 goat anti-rabbit IgG (h+L), Invitrogen, A11008, 1:500). Cell nuclei were stained with DAPI and photographed using a confocal laser scanning microscope.

[0103] Example 1: Expression of TPRG1-AS1 in the Genotype-Tissue Expression (GTEx) database, the atherosclerosis-associated GEO dataset, and the PDGFBB-induced HASMCs cell model.

[0104] The expression of TPRG1-AS1 was analyzed using the genotype-tissue expression (GTEx) database, the atherosclerosis-related GEO dataset, and a platelet-derived growth factor BB (PDGFBB)-induced HASMC cell model.

[0105] Please see the results. Figures 1A to 1E As shown. GTEx data demonstrate that TPRG1-AS1 is expressed in human arterial tissue, including the aorta and coronary arteries. Figure 1A qRT-PCR was used to detect the expression of TPRG1-AS1 in atherosclerotic plaques and internal mammary artery (IMA) specimens obtained during carotid endarterectomy (CEA) in coronary artery bypass surgery. The expression level of TPRG1-AS1 was significantly increased in carotid atherosclerotic plaques. Figure 1B The lncRNA / mRNA expression profiles (GSE97210) of normal human arterial intima and late-stage unstable atherosclerotic plaques showed a significant increase in TPRG1-AS1 expression in atherosclerotic plaques. Figure 1C RNA sequencing data from stable and unstable sections of human atherosclerotic plaques (GSE120521) demonstrated that the expression level of TPRG1-AS1 was significantly increased in unstable plaque regions. Figure 1D Treatment of HASMCs with PDGF-BB significantly decreased the expression level of TPRG1-AS1. Figure 1E ).

[0106] Example 2: Full-length and subcellular localization of TPRG1-AS1 transcripts in HASMCs

[0107] The full-length transcript sequence of TPRG1-AS1 was obtained using 3' and 5'-RACE (rapid amplification of cDNA ends) experiments and Sanger sequencing. The size of the TPRG1-AS1 transcript was verified by Northern blot experiments. Subcellular localization of TPRG1-AS1 HASMCs was determined using RNA FISH (fluorescence in situ hybridization). The conservation of TPRG1-AS1 was analyzed using PhyloCSF software. The protein coding capacity of TPRG1-AS1 was predicted using BLAST software, and its protein coding capacity was verified by in vitro transcription-translation experiments.

[0108] 3' and 5'-RACE experiments and Sanger sequencing determined that the full-length TPRG1-AS1 sequence was 1279 nt. Figure 2 , Figure 3A and Figure 3B (SEQ ID NO:1); Northern blot results showed that the transcript length of TPRG1-AS1 in HASMCs and human umbilical vein endothelial cells (HUVECs) was approximately 1200 nt, which was basically consistent with the full-length sequence obtained by RACE. The expression level of TPRG1-AS1 in HASMCs was higher than that in HUVECs. Figure 4 RNA FISH results showed that TPRG1-AS1 was localized in the cytoplasm and nucleus of HASMCs. Figure 5 ).

[0109] UCSC online software was used to analyze the species conservation of TPRG1-AS1. PhyloCSF software was used to score the predicted protein-coding capacity of TPRG1-AS1. The analysis showed that TPRG1-AS1 has low conservation among more than 100 vertebrate species and does not have protein-coding capacity. ORF finder analysis was used to analyze the open reading frames (ORFs) of TPRG1-AS1. SMARTBLAST was used to align ORFs marked with "+", using the longest ORF14 as an example. The alignment results showed that no homologous polypeptides existed for TPRG1-AS1, indicating that it does not have amino acid-coding capacity.

[0110] In vitro transcription-translation experiments showed that the product of TPRG1-AS1 translation in vitro did not contain a protein-coding product. Figure 6 The above results indicate that TPRG1-AS1 does not have protein coding ability and is a true long non-coding RNA.

[0111] Example 3: TPRG1-AS1 regulates HASMC migration

[0112] In HASMCs, gain-of-function and loss-of-function strategies were used to conduct cell proliferation assays (CCK-8) and Transwell assays to detect the regulatory effects of TPRG1-AS1 on the proliferation and migration phenotypes of HASMCs.

[0113] CCK-8 proliferation assay results showed that overexpression and knockdown of the TPRG1-AS1 gene in HASMCs did not affect cell proliferation. Figure 7 Transwell assays showed that overexpression of TPRG1-AS1 in HASMCs significantly inhibited cell migration, while TPRG1-AS1 knockdown significantly promoted cell migration. Overexpression of TPRG1-AS1 significantly inhibited PDGFBB-induced HASMC migration, indicating that TPRG1-AS1 is involved in PDGFBB-induced HASMC migration. Figure 8 ).

[0114] Example 4: Interaction between TPRG1-AS1 and MYH9 protein

[0115] RNA pulldown and mass spectrometry were used to screen for binding proteins that interact with TPRG1-AS1, and Western blot was used to verify them. RNA binding protein immunoprecipitation and CHIRP (Chromatin Isolation by RNA Purification) experiments were used to verify the intracellular interaction between TPRG1-AS1 and its binding proteins. Immunofluorescence was used to determine the subcellular co-localization of TPRG1-AS1 and its binding proteins in HASMCs.

[0116] RNA pull down ( Figure 9 Mass spectrometry analysis (Tables 5 and 6) and ChIRP experimental results ( Figure 10 This indicates that TPRG1-AS1 binds to the MYH9 protein.

[0117] Table 5: Mass spectrometry analysis of protein band 1 after RNA pull-down

[0118]

[0119] Table 6: Mass spectrometry analysis of the RNA-pull-down protein band #2

[0120]

[0121] RNA RIP experiments further confirmed the interaction between intracellular TPRG1-AS1 and MYH9 protein. Figure 11 ).

[0122] These results all indicate that TPRG1-AS1 can interact with the MYH9 protein.

[0123] Example 5: The interaction between TPRG1-AS1 and MYH9 protein affects MYH9 protein levels, HASMC migration, and F-actin stress fiber formation.

[0124] Western blot and Transwell assays, along with F-actin fluorescence staining, were used to detect the effects of the interaction between TPRG1-AS1 and MYH9 protein on MHY9 protein levels, HASMC migration, and HASMC F-actin stress fiber formation.

[0125] Overexpression or knockdown of TPRG1-AS1 in HASMCs does not affect the mRNA expression level of the MYH9 gene. Figure 12Overexpression of TPRG1-AS1 in HASMCs significantly reduced MYH9 protein levels, while knockdown of TPRG1-AS1 significantly upregulated MYH9 protein levels, indicating that TPRG1-AS1 affects MYH9 protein levels through interaction with the protein. Treatment of HASMCs with the protein synthesis inhibitor actinomycin (CHX) showed that knockdown of TPRG1-AS1 in HASMCs prolonged the half-life of MYH9 protein. Treatment of HASMCs with the proteasome inhibitor MG132 showed that MYH9 protein can also be degraded via the proteasome pathway in HASMCs, and knockdown of endogenous TPRG1-AS1 prevented MYH9 protein degradation via the proteasome pathway. Figure 13 ).

[0126] Overexpression of the MYH9 gene in HASMCs significantly promoted cell migration, while knockdown of endogenous MYH9 gene expression significantly inhibited cell migration. Cell migration recovery assays showed that knockdown of the MYH9 gene significantly inhibited HASMC migration induced by knockdown of endogenous TPRG1-AS1 expression. Figure 14 This indicates that the interaction between TPRG1-AS1 and MYH9 protein affects the migration of HASMCs.

[0127] Consistent with the migration phenotype, overexpression of MYH9 significantly enhanced F-actin stress fiber formation in HASMCs, while knockdown had the opposite effect; conversely, overexpression of TPRG1-AS1 significantly inhibited PDGFBB-induced F-actin stress fiber formation. Reversal experiments showed that knockdown of MYH9 significantly suppressed the increase in F-actin stress fiber bundles induced by knockdown of TPRG1-AS1 in HASMCs. Figure 15 This indicates that the interaction between TPRG1-AS1 and MYH9 protein affects the formation of F-actin stress fibers.

[0128] Example 6: Smooth muscle cell-specific TPRG1-AS1 transgene significantly reduced neointimal formation and significantly alleviated Apoe - / - The degree of atherosclerotic lesions in mice

[0129] The effect of TPRG1-AS1 on neovascularization and intimal formation was detected by overexpressing TPRG1-AS1 in a rat balloon injury model. Smooth muscle cell-specific TPRG1-AS1 transgenic mice, TPRG1-AS1 transgenic mice, and Apoe transgenic mice were constructed using CRISPR / Cas9 technology. - / -Mice; using a smooth muscle cell-specific TPRG1-AS1 transgenic mouse carotid guidewire injury model, the effect of TPRG1-AS1 overexpression on vascular remodeling was examined; using smooth muscle cell-specific TPRG1-AS1 transgenic and Apoe - / - In mice, the effect of TPRG1-AS1 overexpression on the severity of atherosclerotic lesions was investigated.

[0130] The effect of TPRG1-AS1 on neointimal formation in rats was evaluated using a rat carotid balloon injury model. The results showed that, compared with Ad-GFP, overexpression of AdTPRG1-AS1 significantly inhibited neointimal formation, reduced intimal area, and decreased the intimal / media ratio. Figure 16 This indicates that overexpression of TPRG1-AS1 inhibits neointimal formation induced by balloon injury in the rat carotid artery.

[0131] TPRG1-AS1 transgenic mice were constructed using CRISPR / Cas9 technology. TPRG1-AS1 transgenic mice were then isolated separately. SMCKI Primary aortic smooth muscle cells (MASMCs) from transgenic mice and control mice. High expression of TPRG1-AS1 was detected in the MASMCs of transgenic mice. Compared with control mice, TPRG1-AS1 expression was significantly higher. SMCKI The level of MYH9 protein in the MASMCs of mice was significantly reduced. Compared with control mice, TPRG1-AS1 SMCKI In mice, MASMCs and F-actin stress fiber bundles were reduced, and their migration ability was significantly decreased. The effect of TPRG1-AS1 on neointimal formation in rats was evaluated using a mouse carotid guidewire injury model. Results showed that, compared with control mice, TPRG1-AS1... SMCKI In mice, neointimal formation was significantly inhibited, intima area decreased, and the intima / media ratio decreased. Figure 17 This indicates that the vascular smooth muscle-specific TPRG1-AS1 transgene inhibits neointimal formation induced by guidewire injury in the mouse carotid artery.

[0132] Smooth muscle-specific TPRG1-AS1 transgenic mice and Apoe - / - Mice were mated to establish smooth muscle-specific TPRG1-AS1 transgenic Apoe - / - Mice. At 8 weeks of age, TPRG1-AS1 SMCKI Apoe - / - A high-fat diet was induced in mice and control mice for 20 weeks to establish an atherosclerosis model. Oil Red O staining showed that, compared with control mice, TPRG1-AS1... SMCKI Apoe - / -Gross Oil Red staining of mice showed a significant reduction in plaque area. H&E staining of the aortic root showed that, compared with control mice, TPRG1-AS1... SMCKI Apoe - / - The plaque area in the aortic root of mice was significantly reduced. Immunofluorescence staining of the aortic root showed that, compared with control mice, TPRG1-AS1... SMCKI Apoe - / - The percentage of plaque area with MYH9-positive cells was significantly reduced in mice. These results indicate that VSMC-specific TPRG1-AS1 overexpression reduces MYH9 protein levels in atherosclerotic plaques and alleviates atherosclerotic lesions. Figure 18 This indicates that the vascular smooth muscle-specific TPRG1-AS1 transgene inhibits atherosclerosis in mice.

Claims

1. Use of long non-coding RNA TPRG1-AS1 in the preparation of a reagent for inhibiting atherosclerotic lesions by modulating smooth muscle cell migration or by inhibiting neointima formation of smooth muscle cells, wherein the sequence of long non-coding RNA TPRG1-AS1 is shown as SEQ ID NO: 1.

Images