Application of peach MIR6288b in regulating the number of plant branches

Abstract

The present invention discloses the application of peach MIR6288b in regulating the number of plant branches, wherein the precursor sequence of the MIR6288b gene is shown in SEQ ID NO.1, the mature sequence miR6288b-5p is shown in SEQ ID NO.2, and the mature sequence miR6288b-3p is shown in SEQ ID NO.3. The present invention constructs an overexpression vector by cloning peach MIR6288b, and uses Agrobacterium-mediated genetic transformation to transfer into Arabidopsis to verify the function of MIR6288b. Compared with wild-type plants, the number of branches of transgenic plants is significantly increased, which is conducive to clarifying the molecular mechanism of peach tree branching at the molecular level, thereby assisting in breeding new peach varieties with a small number of branches suitable for labor-saving cultivation, and can also be applied to research on genetic improvement of plant branching number.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to peach MIR6288b and application in regulating the number of plant branches. Background Art

[0002] The main variety of peach production is the common type, which has an open tree shape, many branches, and large branch angles. As the fruiting years extend, the vegetative growth is vigorous, the tree is luxuriant, and the canopy is eventually shaded, which not only affects the light transmittance and fruit quality, but also increases the incidence of pests and diseases, and greatly increases the labor costs of summer and winter pruning. The statistical results of the Cultivation Research Laboratory of the National Peach Industry Technology System show that labor costs account for more than half of the cost of peach production, and manual pruning is the most important part of the labor input. Therefore, in order to achieve labor-saving peach cultivation, it is urgent to analyze the regulation mechanism of peach tree shape.

[0003] Plant microRNA is a type of collar structure encoded by endogenous MIR genes. It is a small single-stranded non-coding RNA with a length of about 19 to 24 nucleotides formed by the cleavage of DICER-LIKE1 (DCL1) enzyme. It can recognize target gene mRNA through base complementary pairing and regulate gene expression at the transcriptional or post-transcriptional level. miRNA plays an important regulatory role in the branching formation of plants. miR319 targets and degrades AtTCP4 to ensure the normal growth of Arabidopsis roots; cotton miR164 regulates endogenous ABA content and cotton branch formation by targeting the gene GhCUC2; rice miR167a regulates auxin redistribution and rice tillering angle by targeting the auxin response factor OsARF12 / 17 / 25. However, there are few reports on miRNAs that regulate the number of branches. Summary of the invention

[0004] The invention aims to provide peach (Prunus persica L.) MIR6288b and application thereof in regulating the number of plant branches.

[0005] In order to achieve the above object, the technical solution of the present invention is summarized as follows:

[0006] The precursor sequence of peach MIR6288b is shown in SEQ ID NO.1, the mature sequence miR6288b-5p is shown in SEQ ID NO.2, and the mature sequence miR6288b-3p is shown in SEQ ID NO.3.

[0007] The main purpose of the present invention is to provide the application of the peach MIR6288b or biomaterials related to MIR6288b. Specifically, the peach MIR6288b can increase the number of plant branches. Therefore, by inhibiting the expression of MIR6288b in the target plant, it can assist in the breeding of new peach varieties with fewer branches and suitable for labor-saving cultivation, which plays an important role in the genetic improvement of the number of plant branches.

[0008] The method of "inhibiting the expression of MIR6288b in the target plant" can be achieved by knocking out MIR6288b. Specifically, a mutant plant lacking MIR6288b can be obtained by gene editing. A mutant plant lacking MIR6288b can be obtained by regenerating the plant cell into a plant. The recombinant plasmid can be transferred into the plant by Agrobacterium transformation.

[0009] The biological material in the present invention can be an expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, tissue or organ containing the MIR6288b, or a recombinant vector, recombinant microorganism, transgenic plant cell line, tissue or organ containing the expression cassette.

[0010] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants or forestry plants, etc. The plants may be, for example (but not limited to): dicotyledonous plants, monocotyledonous plants, woody plants, Rosales plants, Rosaceae plants, Prunus, peach, Cruciferae plants, Arabidopsis plants, Arabidopsis thaliana, etc.

[0011] The "plant" mentioned in the present invention includes the whole plant, its parent and progeny plants and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues and organs, and our target gene or nucleic acid is present in these different parts. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen and microspores, and similarly, each of the aforementioned objects contains the target gene / nucleic acid.

[0012] The present invention includes any plant cell, or any plant obtained or obtainable by the method therein, and all plant parts and propagules thereof. This patent also includes transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and the progeny obtained using the method of this patent have the same characteristics.

[0013] The invention also extends to the harvestable parts of the plants as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also further relates to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starch or proteins. The invention also relates to foods or food additives obtained from the relevant plants.

[0014] The present invention also discloses a method for changing the number of plant branches, by controlling the expression of MIR6288b by plants through transgenic, gene knockout, hybridization, backcrossing, selfing or asexual reproduction, wherein the precursor sequence of MIR6288b is shown in sEQID NO.1.

[0015] Herein, controlling the expression of MIR6288b in plants refers to overexpressing or reducing the expression of the MIR6288b gene in plants.

[0016] The transgenic method comprises introducing a recombinant expression vector containing the MIR6288b sequence into plants by using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated methods to obtain transgenic plant strains.

[0017] The gene knockout includes knocking out the MIR6288b using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 technology to obtain a transgenic plant strain.

[0018] Advantages of the present invention:

[0019] The present invention clones peach MIR6288b to construct an overexpression vector, and uses Agrobacterium-mediated genetic transformation to transfer it into Arabidopsis to verify the function of MIR6288b. Compared with wild-type plants, the number of branches of transgenic plants is significantly increased, which is beneficial to clarify the molecular mechanism of peach tree branching at the molecular level, thereby assisting in breeding new peach varieties with fewer branches and suitable for labor-saving cultivation, and can also be applied to research on genetic improvement of plant branch number. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The number of branches of the common peach Okubo is significantly higher than that of the columnar peach Teruteko.

[0021] Figure 2 This is the electrophoresis diagram of peach MIR6288b amplification;

[0022] Figure 3 The expression level of MIR6288b in the columnar peach Terutehong and the common peach Okubo;

[0023] Figure 4 It is the identification of peach MIR6288b transgenic Arabidopsis positive plants;

[0024] Figure 5 It is the relative expression analysis of peach MIR6288b transgenic Arabidopsis;

[0025] Figure 6 Phenotypic analysis of peach MIR6288b transgenic Arabidopsis thaliana. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0027] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0028] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0029] The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences of non-coding regions, but are not limited to these. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include a coding sequence in a cDNA, and / or include a cDNA and its regulatory sequences. In specific embodiments, such as with respect to an isolated nucleic acid sequence, it is preferably assumed to be cDNA.

[0030] The test materials Zhaoshouhong and Dajiubao used in the present invention were planted in Maozhuang Science and Education Park of Henan Agricultural University.

[0031] 1. Isolation of MIR6288b

[0032] Through observation, the number of branches of the common peach Okubo (O) is significantly higher than that of the columnar peach Teruteko (Z) ( Figure 1The RNA of Okubo and Terute red peach leaf buds was extracted using a plant total RNA extraction kit (Beijing Huayueyang Biotechnology Co., Ltd.) and reverse transcription kit (Prime Script TM RT Reagent Kit with gDNA Eraser, Perfect Real Time) to obtain single-stranded cDNA, and use it as a template and the following sequences as primers for amplification to obtain the MIR6288b precursor sequence (such as Figure 2 ). The precursor sequence of gene MIR6288b is shown as SEQ ID NO.1, totaling 92 nt, its mature sequence miR6288b-5p is shown as SEQ ID NO.2, and its mature sequence miR6288b-3p is shown as SEQ ID NO.3, totaling 21 m.

[0033] The primer sequences are:

[0034] Forward MIR6288b-F: ATTCTGGCTTAGGAGATCGAGTAG,

[0035] Reverse MIR6288b-R: GATGCTCTTAGAAGGAACCTATTTG;

[0036] PCR amplification conditions were as follows: 98°C for 30 s, 1 cycle; 98°C for 10 s, 1 cycle; 58°C for 5 s, 34 cycles; 72°C for 5 s, 1 cycle; and 72°C for 60 s, 1 cycle.

[0037] 2. Expression analysis of peach MIR6288b

[0038] Fluorescence quantitative PCR experimental steps: The total RNA of Okubo and Terute red leaf buds was extracted using a plant total RNA extraction kit, and the reverse transcription kit (Prime Script TMSingle-stranded cDNA was obtained by RT Reagent Kit with gDNA Eraser, Perfect RealTime. RT-qPCR reaction was performed according to the kit SYBR Select Master Mix (Applied Biosystems, Mardrid, CA, USA), using ABI PRISM 7500 FAST instrument detection system (Applied Biosystems, Mardrrid, CA, USA); SYBR green fluorescent dye method was used to detect and analyze the expression of genes, peach GAPDH gene was used as the internal reference gene, and each sample was biologically replicated three times. The fluorescence quantitative PCR reaction system was 20 μL, including 200 ng cDNA (1 uL), SYBR Select Master Mix (10 uL), 0.5 umol·L -1 Upstream and downstream primers (1uL) and RNase-free water (7uL).

[0039] Reaction program: 95℃ pre-denaturation, 2min: 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, 42 cycles in total. Each sample was repeated 3 times. Quantitative primers were designed using Primer Premier 5.0 software.

[0040] Primer sequences:

[0041] MIR6288b-F: GTCGGGACTTTGCAATTCTGG,

[0042] MIR6288b-R: ATGACGTTTTGGCGATTGCG;

[0043] Depend on Figure 3 It can be seen that the expression level of gene MIR6288b in common peach Okubo is significantly higher than that in columnar peach Terutehong, indicating that MIR6288b may be involved in regulating peach branch formation.

[0044] 3. Functional identification of MIR6288b

[0045] The effect of MIR6288b on branch formation was identified by transgenic Arabidopsis.

[0046] 3.1 Construction of recombinant vector

[0047] Using MIR6288b amplified from Zhaoshouhong as a template, the overexpression vector pSAK-277 was connected using a one-step cloning kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd.). The primer sequences are as follows:

[0048] Forward MIR6288b-F:

[0049]

[0050] Reverse MIR6288b-R:

[0051]

[0052] After positive clones were identified, they were sent to Shanghai Biotechnology for sequencing.

[0053] 3.2 Identification of positive Arabidopsis plants

[0054] Since a stable and efficient genetic transformation system has not yet been established for peach, Arabidopsis thaliana was used as the material to verify the function of MIR6288b. The overexpression recombinant vector pSAK-277-MIR6288b was transformed into Agrobacterium GV3101. After expansion culture, the bacterial solution concentration was adjusted to OD 600 =0.8, wild-type Arabidopsis was infected by the floral dipping method, and Arabidopsis was harvested after maturity. 0 The seeds were then grown and positive plants were initially screened on kanamycin-resistant MS medium. When the Arabidopsis seedlings grew to 4-6 leaves, leaf DNA was extracted and the transgenic Arabidopsis strains were further identified by PCR ( Figure 4 ), and harvest T 1 thaliana seeds. 1 The Arabidopsis T2 seedlings were used for phenotypic observation and identification. 2 The homozygous strains of the first and subsequent generations.

[0055] PCR primers for identifying positive seedlings of Arabidopsis:

[0056] MIR6288b-F: CATCGAAAGGACAGTAGAAAAGG,

[0057] MIR6288b-R:

[0058]

[0059] 3.3 Quantitative analysis of wild-type and transgenic Arabidopsis

[0060] Fluorescence quantitative PCR experimental steps: The RNA of transgenic Arabidopsis leaves was extracted using the kit of Beijing Huayueyang Biotechnology Co., Ltd. and reverse transcription kit (Prime Scripff MThe single-stranded cDNA was obtained by reverse transcription using R Treagent Kit with DNA Eraser, Perfect Real Time. The expression of the gene was detected and analyzed using SYBR green fluorescent dye method, with Arabidopsis thaliana AtACT2 gene as the internal reference gene, and 3 biological replicates for each sample. Fluorescence quantitative experiments were performed using ABI PRISM7500FAST Sequence Detection System (Applied Biosystems, Mardrid, CA, USA).

[0061] Fluorescence quantitative PCR reaction system: Green PCR Master Mix 5.0μL; Forward Primer 0.3μL; Reverse Primer 0.3μL; cDNA template 1.OμL; RNase Free H 2 O3.4μL; Total 10μL.

[0062] Reaction program: The qRT-PCR reaction program was: 50°C for 20 s, 1 cycle; 95°C for 20 s, 1 cycle; 95°C for 30 s, 60°C for 30 s, 42 cycles.

[0063] Quantitation primers:

[0064] MIR6288b-F: GTCGGGACTTTGCAATTCTGG,

[0065] MIR6288b-R: ATGACGTTTTGGCGATTGCG;

[0066] like Figure 5 As shown, compared with wild-type Arabidopsis, the expression level of MIR6288b in the six MIR6288b overexpressing transgenic lines was significantly increased, among which the expression levels of lines #1, #3, and #5 were 33717, 23360, and 20174 times that of the wild-type Arabidopsis, respectively.

[0067] 3.4 Phenotypic analysis of MIR6288b transgenic Arabidopsis

[0068] Wild-type (WT) and transgenic Arabidopsis thaliana were sown synchronously on MS medium and transplanted into culture pots (10×10 cm) when they grew two leaves. The phenotypes of wild-type and transgenic Arabidopsis thaliana were observed 3 weeks after bolting. Figure 6As shown in the figure, compared with the wild type, the number of branches in the MIR6288b overexpressing strain of Arabidopsis thaliana increased significantly. The average number of bolts in the wild type Arabidopsis thaliana was 3.7, while the average number of bolts in the transgenic strains was 8.9, 9.6 and 9.1, respectively. It can be seen that MIR6288b plays an important role in regulating the number of plant branches.

[0069] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. Peach MIR6288b Use of genes in increasing the number of plant branches, the MIR6288b The precursor sequence of the gene is shown in SEQ ID NO.1, and the plants are peach and Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: Said MIR6288b The mature sequence of the gene miR6288b-5p is shown as SEQ ID NO.2, and the mature sequence miR6288b-3p is shown as SEQ ID NO.

3.

3. A method for increasing the number of plant branches, characterized in that: Through genetic modification, plants are controlled MIR6288b Gene expression, the MIR6288b The precursor sequence of the gene is shown in SEQ ID NO.1, the plant is peach and Arabidopsis thaliana, and the control plant is MIR6288b Gene expression refers to the MIR6288b Gene overexpression in plants.

4. The method according to claim 3, characterized in that The transgenic method comprises using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated method to transform the gene containing MIR6288b The recombinant expression vector of the gene sequence is introduced into plants to obtain transgenic plant strains.

Images