Application of oxidoreductase and its mutants in the biosynthesis of cinnamone

Abstract

The present invention discloses the use of an oxidoreductase and its mutants in the biosynthesis of naringol, belonging to the field of bioengineering technology. The present invention, for the first time, obtains an oxidoreductase with high conversion capacity for naringol from the marine killer yeast (Wickerhamomyces anomalus M15), and obtains an oxidoreductase mutant with even higher capacity through site-directed mutagenesis. Compared with existing oxidoreductases capable of catalyzing the conversion of naringol, the oxidoreductase and its mutants have good substrate tolerance, high conversion rate, and high salt tolerance. The oxidoreductase and its mutants provided by the present invention provide conditions for the in vitro enzymatic synthesis of naringol, achieving an environmentally friendly and efficient catalytic conversion of naringol to the naringol product. The present invention will provide an important tool enzyme for the synthesis of naringol and bring significant economic benefits to the naringol synthesis industry.

Description

[0001] This application is a divisional application of the Chinese invention patent application with application number "2021115175009", application date "December 13, 2021", and invention name "Application of oxidoreductase and its mutants in the biosynthesis of citronellol". Technical Field

[0002] The invention belongs to the technical field of bioengineering, and particularly relates to application of an oxidoreductase and a mutant thereof in biosynthesis of grapefruit ketone. Background Art

[0003] Nootkatone (also known as nootkatone) is a sesquiterpenoid with a grapefruit aroma and a slightly bitter taste. It was first extracted from Alaskan cedar and is also found in plants such as grapefruit and oranges. Pure nootkatone is a white to slightly yellowish crystal and is approved by the FDA and EPA for use in flavoring foods such as grapefruit, oranges, and tropical fruits, as well as tobacco flavorings. Nootkatone, in spray form, is an effective insecticide against lone star ticks and deer ticks, and is also effective against mosquitoes, bedbugs, and lice. Because nootkatone is highly volatile and non-toxic to humans, it is considered an environmentally friendly insecticide. In 2014, the CDC officially approved two companies to produce nootkatone-based insecticides. Furthermore, recent studies have shown that nootkatone inhibits cancer cell proliferation and has potential therapeutic effects on neuroinflammation and Alzheimer's disease. Its research and development has attracted significant interest in the pharmaceutical industry, and its application prospects are enormous.

[0004] As a sesquiterpenoid compound, oleanone has a complex chemical structure, which hinders its large-scale industrial production. Currently, there are three main methods for producing oleanone: physical extraction, chemical synthesis, and biocatalytic conversion. Leanone isolated from grapefruit through processes such as distillation and extraction suffers from low effective concentrations, complex separation and purification procedures, and susceptibility to seasonal and climatic changes, making it unable to meet industrial demand. Currently, the most commonly used industrial method is the chemical synthesis of oleanone from the relatively inexpensive precursor valencene. However, the catalysts used in the oxidation reaction, such as chromium trioxide, cobalt acetylacetonate, or other heavy metal salts, produce a large amount of toxic waste, which is contrary to the concept of green development. To meet the growing market demand for oleanone, the use of biocatalytic conversion methods is not limited by raw materials and can avoid the high energy consumption, low yield, and environmental pollution problems caused by plant extraction processes, which has great advantages.

[0005] In recent years, significant progress has been made in microbial metabolic engineering. The construction of efficient microbial cell factories and the improvement of their physiological performance promise to efficiently convert relatively inexpensive raw materials into high-value-added target products, significantly reducing the production costs of microbial fermentation. Heterologous expression of related enzymes in microorganisms such as yeast and Escherichia coli for the production of sesquiterpene has attracted considerable attention. Researchers have isolated the valencene synthase gene from C. sinensis, which can be effectively expressed in E. coli and subsequently used for the production of sesquiterpene (Chappell J. et al. Novel sesquiterpene synthase gene and protein: US, US20120196340 A1[P]. 2006.). It was further discovered that valencene dioxygenase (ValOx) from P. sapidus was expressed in the cytoplasm of E. coli and converted valencene to naringenol and naringenone via the intermediate hydrogen peroxide (Zelena K. et al. Functional expression of avalencene dioxygenase from Pleurotus sapidus in E. coli [J]. Bio Tec, 2012, 108: 231-239.). Model organism yeast is one of the most commonly used gene expression hosts. Its culture conditions are simple, its genetic background is clear, and it is easy to carry out genetic modification. Among them, marine yeast is significantly more tolerant to the presence of inhibitory compounds such as acetic acid, formic acid, furfural, vanillin and salt than terrestrial yeast. Among them, the most tolerant marine killer yeast is Wickerhamomyces anomalus M15, whose salt tolerance is 1.6 times that of Saccharomyces cerevisiae NCYC2592 (Greetham D. et al. Exploring the tolerance of marine yeast to inhibitory compounds for improving bioethanol production [J]. Sustainable Energy & Fuels, 2019, 3 (3).). Therefore, using genetic engineering methods to further obtain grapefruit alcohol dehydrogenase with high efficiency and environmental tolerance remains a top priority in this field of technology.

[0006] NCBI has catalogued a hypothetical protein from the marine yeast Wickerhamomyces anomalus NRRL Y-366-8, originally named WICANDRAFT_92107 (NCBI accession number XP_019039214.1). It contains 264 amino acids; the nucleotide sequence of the encoding gene (NCBI accession number XM_019186339.1) comprises 795 nucleotides. To date, no literature has reported any actual function or application of this protein. Summary of the Invention

[0007] In order to overcome the shortcomings and deficiencies of the prior art, the present invention aims to provide an oxidoreductase and a mutant thereof for use in the biosynthesis of oleanone, aiming to solve the problems of low substrate concentration, low conversion rate, poor salt tolerance, and unsatisfactory industrial production of the existing alcohol dehydrogenases in the biosynthesis of oleanone.

[0008] The present invention obtains an oxidoreductase with a high conversion ability to naringenol from marine killer yeast (Wickerhamomyces anomalus M15) for the first time, and obtains an oxidoreductase mutant with a higher ability through site-directed mutagenesis.

[0009] The purpose of the present invention is achieved through the following technical solutions:

[0010] The present invention provides an application of an oxidoreductase and / or a mutant thereof in the biosynthesis of grapefruit ketone.

[0011] In the present invention, the oxidoreductase is derived from the NRRL of Wickerhamomyces anomalus M15, and its amino acid sequence is shown in SEQ ID No. 2, which contains 264 amino acids in total.

[0012] In the present invention, the nucleotide sequence of the oxidoreductase NRRL encoding gene is shown in SEQ ID No. 1, which contains 795 nucleotides in total.

[0013] Furthermore, the nucleotide sequence of the oxidoreductase NRRL encoding gene after codon optimization is shown in SEQ ID No. 3.

[0014] The present invention also relates to an oxidoreductase mutant, the amino acid sequence of which is obtained by mutation of one or both of amino acids at positions 69 and 136 of SEQ ID No. 2; further, the amino acid at position 69 is mutated from lysine K to threonine T, and the amino acid at position 136 is mutated from glycine G to arginine R or alanine A;

[0015] Furthermore, the oxidoreductase mutant has an amino acid sequence of SEQ ID No. 2, wherein the 69th amino acid is mutated from lysine K to threonine T, and the 136th amino acid is mutated from glycine G to arginine R. The specific amino acid sequence is shown in SEQ ID No. 4.

[0016] Preferably, in the oxidoreductase mutant, the gene sequence encoding the amino acid sequence shown in SEQ ID No. 2 is shown in SEQ ID No. 3.

[0017] In another aspect of the present invention, the amino acid sequence SEQ ID No. 2 is modified, deleted or added with one or more amino acids to obtain an amino acid sequence, and the sequence maintaining only 90% homology is also within the protection scope of the present invention.

[0018] The present invention provides a recombinant expression vector containing the gene encoding the oxidoreductase and its mutants; preferably, the recombinant vector is a recombinant expression vector obtained by recombining the oxidoreductase and its mutants with the 2μ type high copy plasmid YEp352.

[0019] The present invention provides a recombinant expression cell comprising a recombinant expression vector encoding a gene encoding the oxidoreductase and its mutants described herein; preferably, the recombinant expression cell is a recombinant expression cell obtained by transforming the recombinant expression vector containing the oxidoreductase and its mutants with a vector into a host cell. The host cell is preferably Saccharomyces cerevisiae, more preferably Saccharomyces cerevisiae CEN.PK2-1 Ca strain.

[0020] The present invention also relates to a method for preparing grapefruit ketone.

[0021] The present invention provides two recombinant expression cells that utilize the recombinant expression vector containing the gene encoding the oxidoreductase and its mutants of the present invention to achieve the biosynthesis of naringenone.

[0022] One is a whole-cell in vitro catalytic method, which involves exogenously adding a precursor substance, naringenol, and utilizing the recombinant expression cells of the present invention to perform in vitro conversion to obtain naringenone. The reaction substrate is naringenol.

[0023] The conversion efficiency described in the present invention is expressed as the ratio of the precursor substance grapefruit alcohol to the target product grapefruit ketone within a certain period of time.

[0024] In another method, naringenone is produced by biofermentation (ie, by culturing recombinant expression cells expressing the relevant enzyme in a reactor containing culture medium).

[0025] In a preferred embodiment, the host cell is a eukaryotic cell, specifically selected from the Saccharomyces cerevisiae CEN.PK2-1 Ca strain. This host cell has been genomically engineered using the technology described in Patent Application No. 201910271558.6, including knocking out the restriction factor rox1 in the mevalonate pathway and downregulating the expression of erg9, an enzyme involved in the downstream branch pathway of the sesquiterpenoid precursor FPP, to increase the supply of the precursor FPP. Furthermore, the valenicene synthase ValC from Chamaecyparis nootkatensis, described in International Patent Application No. PCT / NL2010 / 050848, is used to convert FPP into the valenicene precursor valenicene. Valenciane is then further oxidized to naringenol using the cytochrome P450 monooxygenase (CYP450) HPO from pure Hyoscyamus muticus described in WO 2006 / 079020 and the cytochrome reductase AtCPR from Arabidopsis thaliana described in a 1997 article by Urban, P. et al. (Cloning, yeast expression, and characterization of the coupling of two distantly related Arabidopsis thaliana NADPH-cytochrome P450 reductases with P450 CYP73A5. J. Biol. Chem. 1997, 272, 19176–19186). Natylosenol is then converted to the desired final product, naringenone, using the oxidoreductase or a mutant thereof described in the present invention.

[0026] The present invention also protects the use of the oxidoreductase and its mutants as grapefruit alcohol dehydrogenase with high salt tolerance in the biosynthesis of grapefruit ketone.

[0027] The present invention has the following advantages and effects compared to the prior art:

[0028] (1) The present invention provides an oxidoreductase NRRL derived from the marine killer yeast (Wickerhamomyces anomalus M15). This enzyme is the first discovered oxidoreductase derived from marine killer yeast that uses naringenol as a substrate. The present invention also discloses for the first time in China and abroad the use of an oxidoreductase NRRL and its mutants in catalyzing the synthesis of naringenol into naringenone.

[0029] (2) The present invention provides conditions for synthesizing grapefruit ketone via in vitro enzymatic catalysis, achieving a green and efficient method for catalyzing grapefruit alcohol into the corresponding grapefruit ketone. This overcomes the drawbacks of obtaining grapefruit ketone via physical extraction or chemical synthesis methods, such as low yield, low efficiency, cumbersome operation, severe environmental pollution, and high cost.

[0030] (3) Compared with existing oxidoreductases capable of catalyzing the conversion of citronellal, NRRL and its mutants have good substrate tolerance, high conversion rate and high salt tolerance. Compared with the citrus ABA2 (NCBI accession number HM036684.1) citronellal dehydrogenase, the effect is significantly better. The results show that under the same conditions, the substrate target conversion rate obtained by the oxidoreductase of the present invention is higher, which is nearly 3.8 times that of citrus ABA2. In addition, some of the citronellal dehydrogenase mutants provided by the present invention can convert citronellal to nearly 2.4 times the oxidoreductase shown in the sequence table SEQ ID No. 2 under the same conditions, have better substrate tolerance, and have improved tolerance in different concentrations of NaCl (6%, 9%, 12%, 15%, 18% (W / V)).

[0031] (4) The present invention will provide an important tool enzyme for the synthesis of oleic acid ketone, and will bring huge economic benefits to the synthesis industry of oleic acid ketone. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of plasmid construction and reaction.

[0033] Figure 2 This is a graph showing the gas phase detection results of whole-cell catalysis of related alcohol dehydrogenase.

[0034] Figure 3 This is the GC-MS mass spectrum of naringenone.

[0035] Figure 4 This is a comparison of the catalytic performance of the expression strains before and after codon optimization of the NRRL gene sequence.

[0036] Figure 5 is the substrate conversion efficiency of the oxidoreductase mutant.

[0037] Figure 6 The effect of different concentrations of NaCl (W / V) on the conversion rate of oxidoreductase or oxidoreductase mutants. DETAILED DESCRIPTION

[0038] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0039] The following examples are intended only to illustrate the present invention and are not intended to limit its scope. It should be noted that those skilled in the art would be able to make various modifications and improvements without departing from the scope of the present invention, such as changing the type of expression vector, modifying the method for constructing the expression vector, or changing the type of host cell. Such modifications and improvements are all within the scope of the present invention.

[0040] The S.cerevisiae CEN.PK2-1 Ca and ScPK2-M used in the examples are disclosed in “CN201910271558-Saccharomyces cerevisiae engineered bacteria for producing valenciaene and its construction method and application”.

[0041] The marine killer yeast Wickerhamomyces anomalus M15 in the embodiment is disclosed in the document “Greetham D. et al. Exploring the tolerance of marine yeast to inhibitory compounds for improving bioethanol production [J]. Sustainable Energy & Fuels, 2019, 3 (3).”

[0042] Example 1: Cloning of NRRL oxidoreductase and construction of expression vector

[0043] Wickerhamomyces anomalus M15 was inoculated into 5 mL of YPD (20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone) liquid medium and cultured at 30°C until the logarithmic growth phase. Total genomic DNA was extracted from Wickerhamomyces anomalus M15 using a Yeast DNA Kit (purchased from Omega).

[0044] A pair of specific primers were designed for the coding gene sequence of a hypothetical protein from Wickerhamomyces anomalus NRRL Y-366-8 [named WICANDRAFT_92107 (NCBI accession number XP_019039214.1), containing a total of 264 amino acids; the nucleotide sequence of its coding gene (NCBI accession number XM_019186339.1) contains a total of 795 nucleotides]. At the same time, each primer introduced a base sequence homologous to the vector at the 5′ end for homologous recombination cloning to construct the YEp352 expression vector. 0.5 μL (about 10 ng) of the above total DNA solution was taken as a template, and the PCR enzyme used was KOD FX (purchased from TOYOBO, Japan) to amplify the target gene fragment, i.e., the oxidoreductase NRRL gene fragment. After sequencing, its nucleotide sequence is shown in SEQ ID No. 1, and its amino acid sequence is shown in SEQ ID As shown in No. 2; the sequence was aligned in NCBI, and it was found that it had 100% homology with the above-mentioned hypothetical protein derived from marine killer yeast (Wickerhamomyces anomalus NRRL Y-366-8).

[0045] The specific amplification primers are as follows (the underlined sequences are bases homologous to the vector sequence):

[0046] NRRL-F:5′- AGTTTCGAATAAACACACATAAACAAACAAA ATGACTTTAAACACCCAAA-3′;

[0047] NRRL-R:5′- GACCAAACCTCTGGCGAAGAAGTCCAAAGCT TTAATGATACATTATTCCA-3′;

[0048] Table 1. KOD-FX PCR system and conditions

[0049]

[0050]

[0051] After the PCR reaction, the gene fragment size was checked by agarose gel electrophoresis to determine whether it was correct, and the amplified fragment was purified using an oligonucleotide purification kit (purchased from Omega). The concentration of the gene fragment was detected using a microspectrophotometer to amplify the target gene fragment, namely the oxidoreductase NRRL gene fragment.

[0052] The genome of S. cerevisiae CEN.PK2-1 Ca was extracted using a Yeast DNA Kit. Using the genome as a template, the TDH3-F / TDH3-R primer pair was used to amplify the TDH3 promoter fragment, and the ADH1-F / ADH1-R primer pair was used to amplify the ADH1 terminator fragment.

[0053] The primer sequences used are as follows (the underlined sequences are homologous bases):

[0054] TDH3-F:5′- TGACCATGATTACGAATTCTTTACCGTCGAC ACAGTTTATTCCTGGCATC-3′;

[0055] TDH3-R:5′- GACCAAACCTCTGGCGAAGAAGTCCAAAGCT TTTGTTTGTTTATGTGTGT-3′;

[0056] ADH1-F:5′- GAATAAACACACATAAACAAACAAA AGCTTTGGACTTCTTCGCCAGAG-3′;

[0057] ADH1-R:5′- TTGCATGCCTGCAGGTCGACTCTAGAGGATC CATAGGGTAGGGGAATTTC-3′;

[0058] The YEp352 plasmid vector fragment purchased from Invitrogen was amplified using the YEp352-F1 / YEp352-R1 primer pair.

[0059] YEp352-F1: 5′-GATCCTCTAGAGTCGACCTGCAGG-3′;

[0060] YEp352-R1: 5′-GTCGACGTAAAGAATTCGTAATCAT-3′;

[0061] The obtained TDH3 promoter fragment, ADH1 terminator fragment and YEp352 plasmid vector fragment were ligated by multi-fragment homologous recombination using ClonExpress II recombination cloning kit (purchased from Nanjing Novozymes Co., Ltd.) to obtain vector YEp352-TDH3. promoter -ADH1 terminator , abbreviated as YEp352-TDH3 p -ADH1 t .

[0062] YEp352-TDH3 was amplified using YEp352-F2 (5′-AGCTTTGGACTTCTTCGCC-3′) and YEp352-R2 (5′-TTTGTTTGTTTATGTGTGTT-3′).p -ADH1 t Then, the vector fragment amplified from YEp352-F2 / R2 and the target gene obtained above were homologously recombined and connected using the ClonExpress II recombination cloning kit (purchased from Nanjing Novozymes).

[0063] Then, 10 μL of the ligation product was chemically transformed into E. coli DH5α competent cells and coated on LB / Amp (10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, 15 g / L agar, autoclaved at 121°C for 20 min; ampicilin was added to a final concentration of 1000 mg / mL before use). After incubation at 37°C for 12 to 16 hours, the recombinant E. coli (YEp352-TDH3 p -NRRL-ADH1 t ), construct the map see Figure 1 . The recombinant bacteria were picked and inoculated into 5 mL of LB liquid culture medium containing 100 μg / mL ampicillin (10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, autoclaved at 121°C for 20 min; add a final concentration of Ampicillin 1000 mg / mL before use), cultured at 37°C and 220 rpm for 12 hours, and then the plasmid was extracted using a rapid plasmid extraction kit (purchased from Tiangen (Beijing) Co., Ltd.) and sent to Sangon Biotech (Shanghai) Co., Ltd. for gene sequencing. The sequencing results were analyzed using Snapgene software to obtain the recombinant plasmid YEp352-TDH3 containing the oxidoreductase gene. p -NRRL-ADH1 t .

[0064] Example 2: Construction of recombinant expression cells

[0065] The recombinant expression plasmid YEp352-TDH3 constructed in Example 1 was transformed into p -NRRL-ADH1 t The cells were transformed into Saccharomyces cerevisiae CEN.PK2-1 Ca competent cells.

[0066] 1) Add 500 ng of recombinant plasmid and 250 μL of Solution III (Transformation solution) per 25 μL of competent cells;

[0067] 2) Vortex the mixture and place it in a 30°C incubator for 15 minutes.

[0068] 3) Remove the tube and shake it again to mix thoroughly. Place it at 30°C for 15 minutes, and repeat this process twice.

[0069] 4) Then, 200 μL of the recombinant yeast cells were evenly spread on nutrient-deficient plates (SD / ΔUra) (6.7 g / L YNB, 2 g / L amino acid mixture, 20 g / L glucose, 20 mg / L leucine, and 20 mg / L tryptophan) and cultured at 30°C for 2–4 days.

[0070] Until a single colony grows on the plate, the recombinant expression cell ScCEN.PK2-1 Ca(YEp352-TDH3 p -NRRL-ADH1 t ).

[0071] Example 3: Preparation of grapefruit ketone by whole cell catalysis in vitro

[0072] The recombinant expression cells ScCEN.PK2-1 Ca(YEp352-TDH3 obtained in Example 2 were picked up. p -NRRL-ADH1 t ) into a test tube containing 5 mL of SD / ΔUra liquid medium and cultured at 30°C and 220 rpm for 24 hours. 600 = 0.05 was transferred to a 250 mL shake flask containing 50 mL SD / ΔUra liquid medium and cultured at 30°C and 220 rpm for 24 hours. The total OD 600 The bacterial suspension was centrifuged at 3000 rpm and 4°C for 5 min, and the supernatant was discarded. The recombinant expression cells were then resuspended in potassium phosphate buffer (50 mM, pH 7.4) to a volume of 1 mL to obtain 50 OD 600 20 μL of 100 mM grapefruit alcohol solution (containing 1% (v / v) Triton-100, dissolved in dimethyl sulfoxide) was added to make the final substrate concentration 2 mM, and the reaction was catalyzed at 25° C. and 220 rpm for 24 hours.

[0073] The product detection method is as follows (the product detection method in subsequent examples is the same as that in Example 3):

[0074] After the reaction, the reaction mixture was transferred to a 2 mL centrifuge tube and extracted with 1 mL of ethyl acetate by shaking for 10 minutes. The mixture was then centrifuged at maximum speed for 5 minutes. After separation of the organic and aqueous layers, 500 μL of the upper ethyl acetate layer was transferred to a 1.5 mL centrifuge tube and an additional 500 μL of ethyl acetate was added. Finally, the mixture was filtered through a 0.22 μm organic filter membrane into a chromatographic vial for gas chromatography analysis. The gas chromatograph used was a Hewlett-Packard 5890II gas chromatograph with a 5% Ph-Me siloxane column, 30 m × 0.10 mm × 0.10 μm. The detector was a hydrogen flame detector (FID). The carrier gas was nitrogen.

[0075] The detection method is as follows: 1 μL sample was split injected with a split ratio of 15:1; the injection port temperature was 250°C; the detector temperature was 350°C; the column temperature was maintained at 100°C for 5 minutes, then increased to 200°C at a rate of 20°C / min, and maintained at 200°C for 5 minutes, for a total time of 15 minutes.

[0076] The gas chromatograph used was a Hewlett-Packard 5890II gas chromatograph, with a quartz capillary column measuring 30 m × 0.25 mm × 0.25 μm and a mass selective detector (MSD). The procedure was the same as above. The mass scan mode was selected ion scanning. Mass spectrometry conditions were electron impact (EI) ionization source, electron energy 70 eV.

[0077] The standard was detected by GC-FID, and the retention time of naringenone was 19.540min. The gas phase detection results of some candidate alcohol dehydrogenase whole cell catalysis were as follows Figure 2 The structure of the substance was further qualitatively analyzed by GC-MS. The results are shown in Figure 3 The chromatograms and mass spectra of the samples were compared with those of the standards and were consistent with those of the standards. Therefore, the constructed recombinant yeast strains were able to successfully convert valenciane to naringenol and naringenone.

[0078] Finally, the recombinant expression cell line ScCEN.PK2-1 Ca(YEp352-TDH3 p -NRRL-ADH1 t ) The conversion rate of naringenol was 100%.

[0079] Similarly, according to the methods described in Examples 1 to 3, the present invention also constructed a recombinant expression cell line ScCEN.PK2-1 Ca(YEp352-TDH3 p -ABA2-ADH1 t ) and tested their catalytic abilities under the same conditions as above. Figure 2 The results are shown in Table 2, which are 26% of the conversion effect described in Example 3. The recombinant expression cell ScCEN.PK2-1 Ca(YEp352-TDH3 p -NRRL-ADH1 t ) under the same conditions, the catalytic efficiency was 3.8 times that of the corresponding recombinant expression cells of ABA2, indicating that the oxidoreductase of the present invention has a good ability to convert grapefruit alcohol.

[0080] Example 4: Oxidoreductase NRRL codon optimization

[0081] The screened oxidoreductase NRRL sequences that can catalyze the conversion of naringenol to naringenone were evaluated based on the codon adaptability index (CAI) of Saccharomyces cerevisiae and analyzed using Detai Biotechnology (http: / / www.detaibio.com / ) software. The oxidoreductase NRRL sequences with higher catalytic performance and lower CAI were commissioned to Sangon Biotechnology Co., Ltd. (Shanghai) for codon optimization and sequence synthesis. The codon-optimized NRRL (cp) sequences were constructed into YEp352-TDH3 according to the methods described in Examples 1 and 2. p -ADH1 t The expression cassette was used to obtain YEp352-TDH3 p -NRRL(cp)-ADH1 t Plasmid, further obtained recombinant expression cells ScCEN.PK2-1 Ca (YEp352-TDH3 p -NRRL(cp)-ADH1 t ). The nucleotide sequence of NRRL (cp) is shown in SEQ ID No.3.

[0082] According to the method described in Example 3, whole-cell catalytic experiments were carried out on the strain with the original sequence to evaluate the difference in catalytic performance before and after optimization. The results are as follows Figure 4 As shown, as substrate concentration increased, the substrate conversion rate of all strains decreased; however, the codon-optimized NRRL(cp) strain showed a smaller decrease. When the substrate concentration was 4 and 6 mM, the conversion rate increased by 1.26 times compared to the original strain. This indicates that codon optimization can improve the expression level of NRRL(cp) in the host bacteria to a certain extent, thereby further enhancing its catalytic performance.

[0083] Example 5: Preparation of oxidoreductase NRRL mutants

[0084] By simulating and analyzing the protein spatial structure of the oxidoreductase NRRL, it was determined that the mutation sites were lysine K at position 69 mutated to threonine T and glycine G at position 136 mutated to arginine R or alanine A.

[0085] According to the NRRL optimized sequence SEQ ID NO.3 (NRRL (cp)), the site-directed mutagenesis primers were designed, and the oxidoreductase NRRL gene was mutated by site-directed mutagenesis to obtain a new oxidoreductase gene. p -NRRL(cp)-ADH1 t As a template, rapid PCR technology was used, and the universal primers for the recombinant plasmid were:

[0086] YEp352-F3: 5′-GTGACCGTCTCCGGGAGCTGCATGTG-3′;

[0087] YEp352-R3: 5′-CCGGAGACGGTCACAGCTTGTCTGTA-3′;

[0088] To introduce a single mutation at position 69, the primers are (the underlined sequence is the mutated base):

[0089] NRRL(cp): K69T-F: 5′-CTTCTA C GAAGCAAGAAATTTTCGAT-3′;

[0090] NRRL(cp): K69T-R: 5′-CTTGCTTC G TAGAAGAATCACATGGA-3′;

[0091] NRRL(cp):G136R-F:5′-AATTG C GTAACCAACCAGGTAAAATT-3′;

[0092] NRRL(cp):G136R-R:5′-TGGTTAC G CAATTCTTCGAACTTCT-3′;

[0093] NRRL(cp):G136A-F:5′-AATTGG C TAACCAACCAGGTAAAATT-3′;

[0094] NRRL(cp):G136A-R:5′-TGGTTA G CCAATTCTTCGAACTTCT-3′;

[0095] The above primers were used for amplification with universal primers YEp352-F3 / YEp352-R3, respectively. The amplification system and conditions are shown in Table 2:

[0096] Table 2. PCR amplification system and conditions

[0097]

[0098] After the PCR reaction, the correct size of the gene fragment was detected by agarose gel electrophoresis, and the amplified fragment was purified using an oligonucleotide purification kit. The concentration of the gene fragment was detected using a microspectrophotometer to obtain NRRL (cp): K69T-F / R, NRRL (cp): G136R-F / R and NRRL (cp): G136A-F / R DNA fragments.

[0099] Using the method of Example 1, three recombinant plasmids containing the oxidoreductase single point mutation gene were obtained, namely: YEp352-TDH3 p -NRRL(cp)-K69T / G136R / G136A-ADH1 t ;

[0100] Example 6: Preparation of NRRL double-site mutants of oxidoreductase

[0101] The recombinant plasmid YEp352-TDH3 constructed in Example 5 was used. p -NRRL(cp)-K69T-ADH1 t Using 136 as a template, a single mutation was introduced at position 136 to construct a double-site mutant. The primers are shown as NRRL (cp): G136R-F / R and NRRL (cp): G136A-F / R.

[0102] Using the methods of Example 1 and Example 5, two recombinant plasmids containing the double-point mutation of the oxidoreductase were obtained, namely: YEp352-TDH3 p -NRRL(cp)-K69T-G136R / K69T-G136A-ADH1 t ;

[0103] Example 7: Catalytic efficiency and substrate tolerance of oxidoreductase mutants

[0104] The five recombinant expression vectors constructed using the method for constructing recombinant expression cells in Example 2 were transformed into Saccharomyces cerevisiae ScCEN.PK2-1 Ca competent cells to obtain five recombinant expression cells. The whole-cell in vitro catalytic method of Example 3 was then used to test the conversion efficiency of the corresponding oxidoreductase mutants.

[0105] The results are as follows Figure 5 As shown, compared to the native oxidoreductase NRRL(cp), the oxidoreductase mutants achieved significantly improved in vitro naringenol conversion efficiency and substrate tolerance. The beneficial mutations were: NRRL(cp):K69T, NRRL(cp):G136R, NRRL(cp):G136A, NRRL(cp):K69T-G136R, and NRRL(cp):K69T-G136A. The oxidoreductase conversion efficiencies of these beneficial mutants ranged from 107% (e.g., NRRL(cp):G136R) to 247% (e.g., NRRL(cp):K69T-G136R) relative to the native oxidoreductase NRRL(cp) in the same assay system. For many of the tested oxidoreductase mutants, this increase in conversion efficiency was often accompanied by an increase in substrate tolerance, as shown in Table 3. This indicates that the increased conversion efficiency was not primarily due to increased expression of these mutants in Saccharomyces cerevisiae.

[0106] Table 3: Summary of substrate tolerance and conversion efficiency of modified oxidoreductases compared to SEQ ID NO. 2

[0107]

[0108] a : Position of the modified oxidoreductase amino acid residue; the residue encoding starts from the N-terminal threonine residue (=Met-1) in SEQ ID NO. 2.

[0109] b The test method is similar to that of Example 3, except that the concentration of the grapefruit alcohol substrate used is different.

[0110] c : Conversion efficiency of the modified oxidoreductase (=sample) relative to the conversion efficiency obtained with the wild-type oxidoreductase (=control), i.e. {(Nootkatone[sample] / substrate concentration[sample]) / (Nootkatone[control] / substrate concentration[control])×100%.

[0111] d : The enzyme can still maintain a tolerance concentration of more than 60% conversion rate under the test conditions.

[0112] e : Oxidoreductase wild type (SEQ ID NO. 2).

[0113] f : () The brackets indicate the codons used when the mutation is to the corresponding amino acid.

[0114] Example 8: Salt tolerance of oxidoreductase mutants

[0115] According to the whole-cell in vitro catalytic method of Example 3, 3%, 6%, 9%, 12%, 15%, and 18% NaCl (W / V, g / 100 mL) were added to the reaction system, and the reaction was catalyzed at 25°C and 220 rpm for 24 hours to study its effect on the substrate conversion rate of the oxidoreductase mutant.

[0116] The results are as follows Figure 6 As shown, the substrate conversion rate of WT (unmutated NRRL) was not affected when it was catalyzed in a 3% NaCl (W / V) reaction system for 24 hours; after treatment in 6%, 9%, 12%, 15%, and 18% NaCl (W / V) for 24 hours, the five mutants with higher substrate catalytic efficiency and tolerance: NRRL (cp): K69T, NRRL (cp): G136R, NRRL (cp): G136A, NRRL (cp): K69T-G136R, and NRRL (cp): K69T-G136A, showed a downward trend in substrate conversion rate as the NaCl (W / V) concentration increased, but the substrate conversion rates of the mutants were higher than that of WT, indicating that the salt tolerance of the mutants was improved compared with that of WT.

[0117] Based on the above results, the optimal mutant NRRL (cp): K69T-G136R, the oxidoreductase mutant described in the present invention, has obtained higher conversion efficiency, substrate tolerance and salt tolerance than the wild-type oxidoreductase through single-point or double-point mutations, and has good industrial application prospects.

[0118] Example 9: Preparation of grapefruit ketone using a simple carbon source by biological fermentation

[0119] Using the technology described in patent application number 201910271558.6, the host cell ScCEN.PK2-1 Ca was genomic modified, that is, the limiting factor rox1 of the mevalonate pathway was knocked out, and the expression intensity of the downstream branch pathway-related enzyme erg9 of the sesquiterpenoid precursor FPP was downregulated to increase the supply of the precursor substance FPP, and finally the ScPK2-M strain was obtained. The valencine synthase ValC gene (NCBI accession number JX040471) from Chamaecyparis nootkatensis described in International Patent Application No. PCT / NL2010 / 050848 (the promoter in the expression cassette of the gene is PDC1 and the terminator is SAG1) and the endogenous HMG-CoA reductase tHMG1 (the rate-limiting enzyme in the mevalonate pathway) gene of Saccharomyces cerevisiae with its N-terminal regulatory region truncated (NCBI accession number NM_001182434) (the promoter in the expression cassette of the gene is TEF1 and the terminator is CYC1) were introduced into the recombinant expression vector YEp352-TDH3 obtained in Example 4. p -NRRL(cp)-ADH1 tThe recombinant expression vector YEp352-ValC-tHMG1-NRRL (cp) was obtained. In addition, the TEF1p-Cas9-CYC1t in the p414-TEF1p-Cas9-CYC1t vector (a commercial plasmid from Addgene) was replaced with the cytochrome P450 monooxygenase HPO gene (NCBI accession number EF569601) from pure Hyoscyamus muticus described in patent WO2006 / 079020 (the promoter in the expression cassette of this gene is HXT7 and the terminator is TPI1) and the cytochrome reductase AtCPR gene (NCBI accession number NM_118585) from Arabidopsis thaliana described in the 1997 article by Urban, P., et al. Cloning, yeast expression, and characterization of the coupling of two distantly related Arabidopsis thaliana NADPH-cytochrome P450reductases with P450 CYP73A5. J. Biol. Chem. 1997, 272, 19176–19186.) to obtain the recombinant expression vector p414-HPO-AtCPR. The recombinant expression vector YEp352-ValC-tHMG1-NRRL(cp) and p414-HPO-AtCPR were transformed into the previously constructed high-yield FPP engineering strain ScPK2-M to obtain the recombinant expression cell ScPK2-M (YEp352-ValC-tHMG1-NRRL(cp) and p414-HPO-AtCPR), referred to as "PK2-VHN(cp)-HA."

[0120] The PK2-VHN(cp)-HA strain was inoculated into a test tube containing 5 mL of SD / ΔTrp-Ura medium (6.7 g / L YNB, 2 g / L amino acid mixture, 20 g / L glucose, 20 mg / L leucine) and cultured at 30°C and 220 rpm for about 20 hours. 600 When the cell count reached 1-3, the mixture was transferred to a 50 mL conical flask containing 10 mL SD / ΔTrp-Ura medium, and covered with 20% n-dodecane (2 mL) organic phase, and fermented at 25°C and 220 rpm in a shaking incubator for 96 h.

[0121] After the fermentation was completed, 500 μL of the upper n-dodecane organic phase was collected and mixed with an equal volume of ethyl acetate, and the product was detected according to the gas phase detection method described in Example 4.

[0122] The final fermentation results showed a 24 mg / L naringenone yield, accounting for 20% of the total terpene yield (valenciane, naringenol, and naringenone combined). However, when the oxidoreductase used was replaced with ABA2 derived from citrus, the resulting naringenone yield was only 2.5 mg / L, accounting for 2.6% of the total terpene yield. This demonstrates that the use of the oxidoreductase of the present invention can increase the fermentation yield of naringenone by 9.6 times and the purity by 12 times. Further use of an oxidoreductase mutant, such as NRRL(cp):K69T-G136R, increased the naringenone yield to 42 mg / L, 1.75 times that of the wild-type oxidoreductase. This demonstrates that the oxidoreductase of the present invention exhibits superior catalytic performance and can tolerate higher substrate concentrations than previously reported isozymes. Using the oxidoreductase and its mutants, higher fermentation yields of naringenone and a higher purity product can be achieved.

[0123] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Application of an oxidoreductase and / or its mutant in the biosynthesis of grapefruit ketone, characterized in that: The oxidoreductase is named NRRL, and its amino acid sequence is shown in SEQ ID No. 2; The oxidoreductase mutant has an amino acid sequence of SEQ ID No. 2 obtained by any one of the following mutations: (1) The amino acid at position 136 mutated from glycine G to arginine R; (2) The amino acid at position 136 mutated from glycine G to alanine A.

2. The use according to claim 1, characterized in that: The oxidoreductase mutant improves substrate tolerance and / or conversion rate, and the substrate is naringenol.

3. The use according to claim 1, characterized in that: The oxidoreductase mutant has improved salt tolerance.

4. The use according to any one of claims 1 to 3, characterized in that: The nucleotide sequence of the gene encoding the oxidoreductase NRRL is shown in SEQ ID No.

3.

5. The use according to any one of claims 1 to 3, characterized in that: The nucleotide sequence of the gene encoding the oxidoreductase NRRL is shown in SEQ ID No.

1.

6. The oxidoreductase mutant according to any one of claims 1 to 5.

7. A gene encoding the oxidoreductase mutant according to claim 6.

8. A recombinant expression vector or recombinant expression cell containing the gene according to claim 7.

9. Use of the recombinant expression vector or recombinant expression cell according to claim 8 in the biosynthesis of grapefruit ketone.

Images