A molecular marker linked to QTL of kiwifruit trunk diameter and its application

Abstract

The present invention discloses a molecular marker linked to a QTL for the trunk diameter of kiwifruit and its application, and relates to the technical fields of molecular biology and genetic breeding. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; there is a SNP site at 199bp of the molecular marker, which is A or G. The present invention locates the QTL linked to the trunk diameter of kiwifruit in kiwifruit, and provides a molecular marker tightly linked to the QTL for the trunk diameter of kiwifruit. In conventional breeding methods, the growth traits of kiwifruit trees are difficult to judge at the seedling stage, and the accuracy and breeding efficiency are low. By detecting the molecular marker linked to the QTL for the trunk diameter of kiwifruit, the trunk diameter traits of kiwifruit plants can be predicted, and then early screening can be performed, which not only saves production costs but also greatly improves selection efficiency.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology and genetic breeding, and in particular to a molecular marker linked to a QTL of a kiwifruit trunk diameter and its application. Background Art

[0002] Kiwifruit (Actinidia) is a dioecious perennial vine plant of the genus Actinidia Lindl. of the family Actinidiaceae. There are 54 species and 21 varieties. It is one of the four most successful wild fruit trees in artificial domestication and cultivation in the 20th century. Varieties are the "chips" of industrial development. The trunk diameter of kiwifruit trees is closely related to the strength of the tree. It is the basis for breeding excellent varieties and a crucial factor affecting the growth and development of fruits. In addition, plants with strong tree vigor have stronger comprehensive resistance and are easier to manage in the later stage, thus greatly reducing planting risks and investment costs.

[0003] The kiwifruit breeding method has gradually shifted from traditional wild direct seed selection to hybrid breeding. In the hybrid breeding process, selecting excellent recombinant genotypes from hybrid segregation offspring is a key step. The traditional breeding method based on phenotypic selection is time-consuming, labor-intensive and difficult. It takes 10 to 15 years to cultivate a new variety. In addition, most phenotypic traits are quantitative traits that are easily affected by the environment and are unstable, which reduces the accuracy of breeding. With the development of PCR technology and modern sequencing technology, molecular marker-assisted selection (MAS) breeding technology has emerged. Since this method selects the traits of breeding targets based on genotype rather than phenotype, it is favored by breeders and geneticists. In breeding work, a method combining directional hybrid breeding and molecular-assisted breeding is used to conduct association analysis between molecular markers and traits, so as to quickly screen out varieties with specific excellent traits. The key to marker-assisted breeding is to find markers linked to phenotypes, construct genetic linkage maps and locate quantitative trait loci (QTLs), which can effectively establish linkage relationships between markers and phenotypes and are an effective way to implement MAS.

[0004] Due to the limitations of traditional breeding methods, it is difficult to carry out breeding at the kiwifruit seedling stage. Combining QTL positioning interval information, developing molecular markers linked to the QTL of tree trunk diameter will help improve breeding efficiency and provide strong guarantees for cultivation management and comprehensive resistance of kiwifruit after planting. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker linked to the QTL for trunk diameter of kiwifruit and its application, so as to solve the problems existing in the above-mentioned prior art. The molecular marker provided by the present invention is tightly linked to the QTL for trunk diameter of kiwifruit and can be used to predict the trunk diameter trait of kiwifruit plants.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a molecular marker linked to a QTL of a kiwifruit trunk diameter. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. A SNP site exists in 199 bp of the molecular marker, which is A or G.

[0008] Furthermore, the genotype of the SNP site is AA or AG.

[0009] Furthermore, when the genotype of the SNP site is AA, the trunk diameter of the kiwifruit plant is greater than AG.

[0010] The present invention also provides a method for predicting the trunk diameter of kiwifruit plants using the above molecular markers, comprising the following steps:

[0011] (1) Obtaining genomic DNA of the kiwifruit plant to be predicted;

[0012] (2) Using the primer pair shown in SEQ ID NO. 2-3, the genomic DNA was amplified by PCR to obtain an amplified product, and then sequencing was performed to obtain the genotype of the amplified product 199 bp. When the genotype was AA, the trunk diameter of the kiwifruit plant was greater than AG.

[0013] Furthermore, in step (1), the reaction system for PCR amplification includes: PlusPCR Master Mix (With Dye) 25 μL, forward and reverse primers 2 μL each, genomic DNA template 3 μL, ddH2O to 50 μL.

[0014] Furthermore, in step (1), the reaction procedure of the PCR amplification is: 98°C for 3 min; 98°C for 10 sec, 55°C for 20 sec, 72°C for 30 sec; 72°C for 5 min.

[0015] The present invention also provides a kit for predicting the trunk diameter of a kiwifruit plant, comprising a primer pair as shown in SEQ ID NO.2-3.

[0016] The present invention also provides application of the above molecular marker or kit in kiwifruit breeding.

[0017] Furthermore, the application is to predict the trunk diameter of kiwi fruit plants.

[0018] The present invention discloses the following technical effects:

[0019] The present invention locates the QTL linked to the trunk diameter of kiwifruit in kiwifruit. In conventional breeding methods, the growth traits of kiwifruit trees are difficult to judge at the seedling stage, and the accuracy and breeding efficiency are low. By detecting the molecular markers linked to the traits, not only the production cost is saved but also the selection efficiency is greatly improved. In the present invention, the QTL site position of the trunk diameter of kiwifruit is clear, and the detection method of the molecular marker site is convenient and fast, and is not affected by climate, environment, etc. By detecting the molecular markers linked to the traits, the trunk diameter trait of kiwifruit plants can be predicted, and early screening can be performed. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 This is the genetic map of the hybrid population of Actinidia chinensis;

[0022] Figure 2 The results of the main trunk diameter (i.e., main trunk thickness) test of 173 individual plants; *** indicates P < 0.001. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] Example 1

[0029] 1. Methods

[0030] 1. The Chinese kiwifruit variety "Hongyang" was used as the female parent and the matching male plant of "Boshan Biyu" was used as the male parent to hybridize to obtain the F1 generation, from which 173 F1 generation plants were selected as research objects.

[0031] 2. Take fresh young leaves of 173 individual plants in the hybrid population and the hybrid parents, quickly freeze them in liquid nitrogen, and use the SDS method to extract genomic DNA, and then test the DNA quality.

[0032] 3. The genomic DNA that passed the quality inspection was randomly interrupted with enzymes, and then the ends were repaired, A-tailed, and Illumina sequencing adapters were added. The DNA fragments were amplified and enriched by PCR, and the products were purified. The sequencing libraries of the matching male plants of diploid Chinese kiwifruit "Hongyang" and "Boshan Biyu" and 173 progeny plants were constructed. The sequencing libraries were tested and quantified by real-time PCR. Finally, the PE 150 sequencing strategy was used for sequencing on the Novasek 6000 sequencer.

[0033] 4. FASTP (version 0.18.0) was used to filter the raw data of the Illumina platform. The filtering criteria were as follows: (1) reads containing unknown nucleotides (N) ≥ 10% were removed; (2) reads containing bases ≥ 50% with a phred quality score ≤ 20 were removed; (3) reads containing sequencing adapters were deleted. The filtered reads were aligned to the reference genome using the alignment software BWA (version 0.7.12) using the mem algorithm with alignment parameters of -k32-M; after alignment, the results were marked using the software picard (version 1.129), and the population SNP detection was performed using the variation detection software GATK. The distribution of SNP detection results on the genome is shown in Table 1.

[0034] Table 1 Distribution of SNP detection results on the genome

[0035]

[0036]

[0037] 5. Based on the SNP information obtained from the above analysis, the evolutionary tree was constructed using the treebest software and the neighbor-joining methods, principal component analysis was performed using plink and GCAT64 software, and the population structure was analyzed using admixture software to complete the population analysis of the composition population.

[0038] 6. After preliminary quality filtering and variation detection, a VCF file containing variation information was obtained, which was further filtered according to the following criteria: (1) bcftools software was used to filter SNP markers; (2) Plink software was used to remove markers with a genotype missing rate greater than 0.02, samples with a sample missing rate greater than 0.03, and markers with a minor allele frequency less than 0.05; (3) R program was used to retain markers with parental genotypes of "0 / 0×0 / 1", "0 / 1×0 / 0", "0 / 1×0 / 1", "0 / 1×1 / 1", and "1 / 1×0 / 1", and markers that did not separate in the offspring were removed; (4) Chi-square test was performed to remove markers with severe skewed separation. The results of SNP filtering are summarized in Table 2.

[0039] Table 2 Summary of SNP filtering results

[0040]

[0041] 7. Use Lep-MAP3 software to construct the genetic map. The genetic map of the hybrid population of Actinidia chinensis is shown in Figure 1Each linkage group was repeated 5 times, and the one with the highest likelihood value was selected as the final result. The genetic positions between markers and the LOD value matrix of markers to each genetic position were obtained, and a high-density genetic linkage map of the diploid Chinese kiwifruit hybrid population was constructed.

[0042] 8. In the fourth year after planting, 173 hybrid progeny plants were measured and evaluated. The trunk diameter of each sample at a height of 50 cm above the ground was measured using a digital vernier caliper, and the phenotypic traits were statistically analyzed.

[0043] 9. QTL positioning was performed using R / qtl, using the composite interval mapping method cim() function, with a scanning step size of 1 cM and a LOD threshold of 3. Finally, QTL sites related to trunk diameter were detected.

[0044] 10. Molecular marker detection steps:

[0045] (1) Fresh young leaves of 173 plants in the hybrid population and the hybrid parents were quickly frozen in liquid nitrogen and then genomic DNA was extracted using the SDS method, and the DNA quality was tested.

[0046] (2) According to Plus PCR Master Mix (With Dye) kit instructions, design 50μL reaction system: Plus PCR Master Mix (With Dye) 25 μL, forward and reverse primers 2 μL each, kiwi genomic DNA template 3 μL, ddH2O to 50 μL.

[0047] (3) PCR amplification program is shown in Table 3.

[0048] Table 3

[0049]

[0050] After the PCR amplification process is completed, store it at 4°C.

[0051] (4) The PCR products were subjected to Sanger sequencing to detect the marker sites and the trunk diameter of kiwifruit was predicted based on the base types at the molecular markers, thereby achieving the goal of efficient breeding.

[0052] 2. Results

[0053] 1. The molecular marker information related to the trunk diameter trait of kiwifruit is shown in Table 4.

[0054] Table 4 Molecular marker information related to kiwifruit trunk diameter traits

[0055]

[0056] Amplification product (SEQ ID NO.1):

[0057] TAGGGAAATAGTCCTGAAGCCATCTGAGTCGAATGAGATTCATGCTTGCTCAACTACTGATACCCAAGAAAGTTTATGCTCTAATGGGCGTGTTTCACTTCAAAGTCTGTTGTCCAAATATCCTGCAGATTCAGAAACCACAAAGTTATGTGATCAATCTATAACTTGCAAGGCAAGTAGACAAGAAAAGTGCATGGA A GGGATAGATCAGCTCGAGGCCGAACTTGAAGCTGAATTGGAACATTTGCAGCTTCACTTGGATACAGGAGATACTTTTGAAAACCCAAAGCAGGAAAGAGTAGAGGTATGTGGCATCG; the underline is A or G.

[0058] Table 5 Association analysis between molecular markers and kiwifruit trunk diameter traits

[0059]

[0060] As shown in Table 5 and Figure 2 As shown in the figure, the molecular markers at the 1971916th locus of chromosome Group 23 of kiwifruit were divided into two genotypes in 173 hybrid offspring, 80 offspring individual plants were AA genotype, with an average trunk diameter of 15.03 cm; 93 offspring individual plants were AG genotype, with an average trunk diameter of 12.21 cm. The average trunk diameter of the 173 hybrid offspring was analyzed by a significance test, and the results showed that the difference in the average trunk diameter of the two genotype individuals was 2.82 cm, which was extremely significant (P<0.001).

[0061] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker linked to the QTL for trunk diameter of kiwifruit, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; there is a SNP site at 199 bp of the molecular marker, which is A or G.

2. The molecular marker according to claim 1, characterized in that The genotype of the SNP site is AA or AG.

3. The molecular marker according to claim 2, characterized in that When the genotype of the SNP site is AA, the trunk diameter of the kiwifruit plant is greater than AG.

4. A method for predicting the trunk diameter of kiwifruit plants using the molecular markers according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) Obtaining genomic DNA of the kiwifruit plant to be predicted; (2) Using the primer pair shown in SEQ ID NO. 2-3, PCR amplification is performed on the genomic DNA to obtain an amplified product, and then sequencing is performed to obtain the genotype of 199 bp of the amplified product. When the genotype is AA, the trunk diameter of the kiwifruit plant is greater than AG.

5. The method according to claim 4, characterized in that In step (2), the PCR amplification reaction system includes: 25 μL of 2×Hieff Canace® Plus PCR Master Mix with dye, 2 μL of forward and reverse primers, 3 μL of genomic DNA template, and ddH2O to 50 μL.

6. The method according to claim 4, characterized in that In step (2), the reaction procedure of the PCR amplification is: 98°C for 3 min; 98°C for 10 sec, 55°C for 20 sec, 72°C for 30 sec; 72°C for 5 min.

7. Use of a kit for predicting the trunk diameter of a kiwifruit plant, characterized in that: The kit comprises a primer pair as shown in SEQ ID NO. 2-3.

Images