Multiplex ligation-dependent probe amplification assay kit for detection of multiple porcine respiratory pathogens
The multiplex ligation probe amplification identification kit solves the problem of differential diagnosis of multiple pathogens of porcine respiratory diseases, achieves high-throughput, specificity and sensitivity of pathogen detection, and simplifies the operation process.
Patent Information
- Application Number
- CN202211251397.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-13
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2042-10-13
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify multiple pathogens of porcine respiratory diseases at the same time, resulting in diagnostic difficulties.
A multiplex ligation probe amplification and identification kit is used, which contains components such as pre-amplification primers, probe mixture, MLPA buffer, ligation buffer, ligase, PCR reaction mixture and polymerase. Sample DNA/RNA is extracted by magnetic bead method, and RNA reverse transcription, probe hybridization and PCR amplification are performed. The test is performed in combination with a fully automatic nucleic acid analyzer.
It has achieved high-throughput, good specificity and high sensitivity of multiple pathogen detection, and can detect 7 pathogens at the same time, simplifying operations, shortening detection time, distinguishing viruses and bacteria, and avoiding cross-reactions.
Smart Images

Figure CN115927753B_ABST
Abstract
Description
Technical Field
[0001] The present invention provides a multiplex ligation probe amplification identification detection kit, primers and probes for detecting porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2. The kit can simultaneously detect seven pathogens that cause porcine respiratory diseases, and belongs to the field of inspection and quarantine. Background Art
[0002] Porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2 are common pathogens that cause respiratory diseases in pigs.
[0003] Because there is more than one disease causing respiratory symptoms in pigs, with similar clinical manifestations and often mixed infections with different pathogens, it is difficult to confirm the cause of the disease based on clinical symptoms and pathological changes. Currently, there is no method that can simultaneously identify multiple diseases causing respiratory symptoms in pigs. Therefore, establishing a detection method that can accurately, quickly, and efficiently distinguish different pathogens is crucial for the differential diagnosis of pig respiratory pathogens. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a multiplex ligation probe amplification and identification kit capable of detecting a variety of porcine respiratory pathogens.
[0005] In order to solve the technical problem, the present invention adopts the following technical solutions:
[0006] A multiplex ligation probe amplification and identification kit for detecting a variety of porcine respiratory pathogens is provided, the kit comprising:
[0007] (1) Pre-amplification primer mixture;
[0008] The mixture includes pre-amplification primers, the sequences of which are shown in SEQ ID NOs: 1 to 14;
[0009] (2) Probe mixture;
[0010] The mixture includes a left probe and a right probe, the sequences of which are shown in SEQ ID NOs: 15 to 28;
[0011] (3) MLPA buffer;
[0012] (4) Ligation buffer A;
[0013] (5) Ligation buffer B;
[0014] (6) Ligase-65;
[0015] (7) a PCR reaction mixture comprising universal primers as shown in SEQ ID NOs: 29 and 30;
[0016] (8) SALSA polymerase;
[0017] (9) Negative control;
[0018] (10) Positive control;
[0019] Among the pre-amplification primers in the pre-amplification primer mixture: sequence SEQ ID NO: 1 and sequence SEQ ID NO: 2 are respectively the forward and reverse primers for pre-amplification of porcine reproductive and respiratory syndrome virus; sequence SEQ ID NO: 3 and sequence SEQ ID NO: 4 are respectively the forward and reverse primers for pre-amplification of porcine Actinobacillus pleuropneumoniae; sequence SEQ ID NO: 5 and sequence SEQ ID NO: 6 are respectively the forward and reverse primers for pre-amplification of porcine Pasteurella multocida; sequence SEQ ID NO: 7 and SEQ ID NO: 8 are respectively the forward and reverse primers for pre-amplification of porcine respiratory coronavirus; sequence SEQ ID NO: 9 and SEQ ID NO: 10 are respectively the forward and reverse primers for pre-amplification of swine influenza virus; sequence SEQ ID NO: 11 and SEQ ID NO: 12 are respectively the forward and reverse primers for pre-amplification of Haemophilus parasuis; sequence SEQ ID NO: 13 and SEQ ID NO: 14 are respectively the forward and reverse primers for pre-amplification of porcine circovirus type 2;
[0020] Among the probes in the probe mixture: sequences SEQ ID NO: 15 and SEQ ID NO: 16 are respectively the left probe and the right probe for detecting porcine reproductive and respiratory syndrome virus; sequences SEQ ID NO: 17 and SEQ ID NO: 18 are respectively the left probe and the right probe for detecting porcine Actinobacillus pleuropneumoniae; sequences SEQ ID NO: 19 and SEQ ID NO: 20 are respectively the left probe and the right probe for detecting porcine Pasteurella multocida; sequences SEQ ID NO: 21 and SEQ ID NO: 22 are respectively the left probe and the right probe for detecting porcine respiratory coronavirus; sequences SEQ ID NO: 23 and SEQ ID NO: 24 are respectively the left probe and the right probe for detecting swine influenza virus; sequences SEQ ID NO: 25 and SEQ ID NO: 26 are respectively the left probe and the right probe for detecting Haemophilus parasuis; sequences SEQ ID NO: 27 and SEQ ID NO: 28 are respectively the left probe and the right probe for detecting porcine circovirus type 2;
[0021] Among the primers in the PCR reaction mixture, sequences SEQ ID NO: 29 and SEQ ID NO: 30 are universal forward and reverse primers, respectively;
[0022] wherein the 5' ends of the sequences SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, and SEQ ID NO: 28 are phosphorylated;
[0023] The positive control is a mixture of in vitro transcribed RNA and positive recombinant plasmid DNA; wherein the in vitro transcribed RNA is the in vitro transcribed RNA of the M gene of porcine reproductive and respiratory syndrome virus, the S gene of porcine respiratory coronavirus, and the M gene of swine influenza virus; the positive recombinant plasmid DNA refers to the positive recombinant plasmid DNA of the ApxIVA gene of porcine Actinobacillus pleuropneumoniae, the toxA gene of porcine Pasteurella multocida, the 16s rRNA gene of Haemophilus parasuis, and the ORF2 gene of porcine circovirus type 2.
[0024] The present invention further provides a method for simultaneously detecting multiple porcine respiratory pathogens using the aforementioned kit for non-disease detection purposes by multiple ligation probe amplification, comprising the following steps:
[0025] (1) Magnetic bead method to extract sample DNA / RNA;
[0026] Use a magnetic bead DNA / RNA co-extraction kit and a fully automatic nucleic acid extractor to simultaneously extract DNA and RNA from the sample to obtain 100 μL of sample;
[0027] (2) RNA reverse transcription into cDNA and pre-amplification
[0028] One-step reverse transcription RT-PCR reaction was performed;
[0029] Prepare a 25 μL reaction system: 10 μL OneStep Ahead RT-PCR Master Mix, 1 μL OneStep Ahead RT-Mix, 5 μL DNA or RNA, 5 μL Q-solution, 1 μL pre-amplification primer mix (final concentration of each primer 0.25 μM), and 3 μL HO. Reaction conditions: 50°C for 10 min, 95°C for 5 min; 30 cycles of 95°C for 15 s, 55°C for 20 s, and 72°C for 20 s; 72°C for 2 min.
[0030] (3) MLPA detection
[0031] a. DNA denaturation
[0032] Take a 0.2 mL PCR reaction tube, add 0.5 μL DNA solution and 4.5 μL TE to each tube, denature at 98°C for 5 min, and cool to room temperature (25°C);
[0033] b. Hybridization of probe and sample DNA
[0034] Prepare 3 μL of mixed probe mixture: 1.5 μL MLPA buffer + 1.5 μL probe mixture; add the probe mixture to the above PCR tube, incubate at 95°C for 1 minute, hybridize at 60°C for 1-16 hours, and incubate at 54°C;
[0035] c. Ligation of hybridization probes
[0036] Prepare 32 μL of ligase mixture: 25 μL dH2O + 3 μL ligation buffer A + 3 μL ligation buffer B + 1 μL ligase-65; lower the PCR instrument temperature to 54°C, open the tube cap, add 32 μL of ligase mixture, incubate at 54°C for 15 minutes, heat at 98°C for 5 minutes to inactivate the ligase, and incubate at 20°C;
[0037] d. PCR amplification of ligated probes
[0038] Prepare 10 μL of PCR mixture: 7.5 μL dH2O + 2 μL PCR reaction mixture + 0.5 μL SALSA polymerase; remove the PCR tube and add 10 μL of PCR mixture at room temperature; start the PCR reaction with the following reaction conditions: 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, for 35 cycles; incubate at 72°C for 20 minutes, then cool to 15°C;
[0039] e. Analysis by fully automatic nucleic acid analyzer:
[0040] The PCR amplification products were taken and analyzed using a fully automatic nucleic acid analyzer;
[0041] (4) Result description and judgment
[0042] a. Quality control standards:
[0043] The positive control had specific amplification bands at 94 bp, 98 bp, 112 bp, 116 bp, 122 bp, 130 bp, and 140 bp;
[0044] There was no specific amplification band in the negative control;
[0045] If the negative control and positive conditions do not meet the above conditions, the test will be considered invalid;
[0046] b. Result judgment:
[0047] Positive: There is a specific amplification band at 94bp, indicating the presence of porcine reproductive and respiratory syndrome virus nucleic acid in the sample; there is a specific amplification band at 98bp, indicating the presence of porcine Actinobacillus pleuropneumoniae nucleic acid in the sample; there is a specific amplification band at 112bp, indicating the presence of porcine Pasteurella multocida nucleic acid in the sample; there is a specific amplification band at 116bp, indicating the presence of porcine respiratory coronavirus nucleic acid in the sample; there is a specific amplification band at 122bp, indicating the presence of swine influenza virus nucleic acid in the sample; there is a specific amplification band at 130bp, indicating the presence of Haemophilus parasuis nucleic acid in the sample; there is a specific amplification band at 140bp, indicating the presence of porcine circovirus type 2 nucleic acid in the sample;
[0048] Negative: No specific amplification band, indicating that the sample does not contain porcine reproductive and respiratory syndrome virus nucleic acid, porcine Actinobacillus pleuropneumoniae nucleic acid, porcine Pasteurella multocida nucleic acid, porcine respiratory coronavirus nucleic acid, swine influenza virus nucleic acid, Haemophilus parasuis nucleic acid and porcine circovirus type 2 nucleic acid.
[0049] 3. The method according to claim 2, characterized in that when judging the result, the MLPA amplification product is sequenced to further confirm the result.
[0050] Compared with the prior art, the present invention has the following beneficial effects:
[0051] 1. High throughput. Simultaneously detect seven pathogens. Utilizing a fully automatic nucleic acid analyzer, 96 samples can be tested simultaneously, providing high-throughput detection technology for pathogen differential diagnosis and emergency diagnosis.
[0052] 2. High specificity. Through probe design, sequence alignment, and blast analysis, we ensure that the probe binds only to the target gene. Furthermore, for common clinical pathogens, this method can only amplify the target fragment of the corresponding size from the corresponding template and will not amplify other pathogens.
[0053] 3. High sensitivity. Due to the differences in sampling individuals or sampling sites, there may be differences in the content of various pathogens in the samples. According to existing practices, it is necessary to adjust the reagents used in the detection process according to various differences, which is bound to lead to a sharp increase in workload. To address this problem, the present invention proposes to pre-amplify the pathogen nucleic acid, exponentially increase the pathogen content in the sample, effectively improve the sensitivity of the test, and avoid duplication of work. The ordinary MLPA method requires at least 6000 copies of the target DNA. We enrich the target gene by adding the RT-PCR step, and can detect at least 1 copy of the target gene.
[0054] 4. Traditionally, porcine respiratory pathogen detection has been performed through pathogen isolation and culture, ELLSA testing, and RT-PCR. These identification and pathogen detection technologies have matured and are currently in a stable development phase. The MLPA analysis proposed in this paper is a novel method and technology for detecting DNA copy number changes, combining the principles of DNA probe hybridization with PCR technology.
[0055] Compared to virus and bacteria separation methods, the present invention is easier to operate and has a shorter detection time. Compared to ordinary PCR detection technology, the present invention can distinguish two closely related sequences because of the presence of MLPA probe binding, and has higher specificity and sensitivity. And the final capillary electrophoresis results are presented in two ways: gel map and peak map. In order to facilitate the comparison of different fragments in the same lane, the peak map can be selected for analysis, where fragments of different lengths correspond to different peaks on the peak map, and it is more convenient to compare the differences between different lanes using the gel map, which can be flexibly selected as needed.
[0056] 5. Unlike existing technologies, the present invention can detect both viral and bacterial pathogens through MLPA analysis, simultaneously extracting and detecting viral and bacterial nucleic acids. Results show that, depending on the size of the hybridization probe, peaks generated by different pathogens can be clearly distinguished on a capillary electrophoresis instrument, and there is no cross-reaction when detecting the simultaneous presence of viruses and bacteria in a single sample. BRIEF DESCRIPTION OF THE DRAWINGS
[0057] Figure 1 This is the capillary electrophoresis peak diagram of multiplex ligation probe amplification of porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2.
[0058] The figure shows: the specific amplification peak of porcine reproductive and respiratory syndrome virus at 94bp; the specific amplification peak of porcine Actinobacillus pleuropneumoniae at 98bp; the specific amplification peak of porcine Pasteurella multocida at 112bp; the specific amplification peak of porcine respiratory coronavirus at 116bp; the specific amplification peak of swine influenza virus at 122bp; the specific amplification peak of Haemophilus parasuis at 130bp; and the specific amplification peak of porcine circovirus type 2 at 140bp.
[0059] Figure 2 This is the capillary electrophoresis gel image of multiplex ligation probe amplification of porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2.
[0060] M: 1000bp DNA marker, NC: no template control, Lane 1, 2, 3, 4, 5, 6, 7 used in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates, respectively, and MLPA detection was performed using mixed probes.
[0061] Figure 3 This is a capillary electrophoresis gel image of MLPA detection using a porcine reproductive and respiratory syndrome virus probe, using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates.
[0062] M: 1000bp DNA marker, Lane 1: in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus as template, Lanes 2, 3, 4, 5, 6, and 7 use in vitro transcribed RNA of porcine respiratory coronavirus, swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates, respectively, NC: no template control.
[0063] Figure 4 This is a capillary electrophoresis gel image of MLPA detection using the in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and the positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates, respectively, with the porcine Actinobacillus pleuropneumoniae probe.
[0064] M: 1000bp DNA marker, Lane 1: recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae as template, Lanes 2, 3, 4, 5, 6, and 7 use in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates, respectively, NC: no template control.
[0065] Figure 5 This is a capillary electrophoresis gel image of MLPA detection using the Pasteurella multocida probe as the template, using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates.
[0066] M: 1000bp DNA marker, Lane 1: using recombinant plasmid DNA of Pasteurella multocida as template, Lanes 2, 3, 4, 5, 6, and 7: using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Haemophilus parasuis, and porcine circovirus type 2 as templates, respectively, NC: no template control.
[0067] Figure 6 This is a capillary electrophoresis gel image of MLPA detection using a porcine respiratory coronavirus probe, using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates.
[0068] M: 1000bp DNA marker, Lane 1: using in vitro transcribed RNA of porcine respiratory coronavirus as template, Lanes 2, 3, 4, 5, 6, and 7 use in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates, respectively, NC: no template control.
[0069] Figure 7 This is a capillary electrophoresis gel image of MLPA detection using a swine influenza virus probe using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates.
[0070] M: 1000bp DNA marker, Lane 1: using in vitro transcribed RNA of swine influenza virus as template, Lanes 2, 3, 4, 5, 6, and 7: using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates, respectively, NC: no template control.
[0071] Figure 8 This is a capillary electrophoresis gel image of MLPA detection using the Haemophilus parasuis probe, using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates.
[0072] M: 1000bp DNA marker, Lane 1: recombinant plasmid DNA of Haemophilus parasuis as template, Lanes 2, 3, 4, 5, 6, and 7: in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and porcine circovirus type 2 as templates, respectively, NC: no template control.
[0073] Figure 9 This is a capillary electrophoresis gel image of MLPA detection using a porcine circovirus type 2 probe, using in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Haemophilus parasuis, and porcine circovirus type 2 as templates.
[0074] M: 1000bp DNA marker, Lane 1: recombinant plasmid DNA of porcine circovirus type 2 as template, Lanes 2, 3, 4, 5, 6, and 7 use in vitro transcribed RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and Haemophilus parasuis as templates, respectively, NC: no template control. DETAILED DESCRIPTION
[0075] Multiplex ligation-dependent probe amplification (MLPA) is a new technology of high throughput, qualitative and quantitative analysis of target sequence in nucleic acid. The technology combines hybridization detection and PCR chain amplification of nucleic acid, so as to realize efficient and specific analysis of target molecules, and detect and quantitatively analyze 60 different target genes in the same reaction tube. The basic principle of MLPA includes hybridization of probes and target sequence DNA, followed by ligation, PCR amplification, product separation by capillary electrophoresis and data collection, analysis of collected data by DNA analysis software, and finally conclusion. Each MLPA probe includes two oligonucleotide fragments, one of which is chemically synthesized and the other is prepared by M13 bacteriophage derivation method; each probe includes a primer sequence and a specific sequence. In the MLPA reaction, the two oligonucleotide fragments are hybridized with the target sequence, and then the two probe fragments are connected by using a ligase. The ligation reaction is highly specific, and only when the two probes are completely hybridized with the target sequence, i.e. the target sequence is completely complementary to the specific sequence of the probe, the ligase can connect the two probe fragments into a complete nucleic acid single strand; otherwise, if the target sequence is not completely complementary to the probe sequence, even if there is only one base difference, it will lead to incomplete hybridization, and the ligation reaction cannot be carried out. After the ligation reaction is completed, the connected probe is amplified by using a pair of universal primers, and the length of the amplification product of each pair of probes is unique, and for the chemically synthesized probe, the range is 90-150bp. Finally, the amplification product is separated by capillary electrophoresis, and the software is analyzed to obtain the conclusion.
[0076] The application establishes an MLPA differential detection method for simultaneously detecting 7 pathogenic bacteria causing porcine respiratory disease, which has high specificity, high sensitivity and good repeatability, and provides a high-throughput detection technology for differential diagnosis and emergency diagnosis of pathogenic bacteria.
[0077] A standard MLPA reaction requires at least 6,000 copies of target DNA. To increase the sensitivity of pathogen detection, the present invention has improved it and introduced a pre-amplification step. By reverse transcribing RNA into cDNA and pre-amplifying the target DNA using PCR, the detection limit is increased. Primers and probes are designed for the most conserved genes of the virus. The sequences are obtained from GenBank and sequence alignment is performed using MUSCLE Alignment (Geneious 8.1.4) to determine the most conserved regions in each gene. Primers are designed using Primer3 (sequences are shown in Table 1) for specific reverse transcription and pre-amplification. The fragments amplified by these primers contain the region that the MLPA probe binds to. Probe design refers to the process disclosed by MRC-Holland (Designing synthetic MLPA probes, Version 04). Probes were designed to bind to the most conserved regions of the M gene of porcine reproductive and respiratory syndrome virus (PRRSV), the ApxIVA gene of porcine Actinobacillus pleuropneumoniae (APXIV), the toxA gene of porcine Pasteurella multocida (PMC), the S gene of porcine respiratory coronavirus (PRC), the M gene of swine influenza virus (IVV), the 16S rRNA gene of Haemophilus parasuis (H. parasuis), and the ORF2 gene of porcine circovirus type 2 (ORF2) (sequences shown in Table 2). Finally, a pair of universal primers for PCR amplification was designed (sequences shown in Table 3). The left probe consists of two nucleotide stretches: a universal primer for PCR amplification and a virus-specific sequence (LHS); the right probe consists of two nucleotide stretches: a virus-specific sequence (RHS) and a universal primer for PCR amplification. The 5′ end of the right probe is phosphorylated. Probes of varying lengths were designed to distinguish between different pathogens. All primers and probes were blasted against the NCBI database to ensure specificity. PCR products of varying sizes were generated through template denaturation, probe hybridization, ligation, and PCR amplification with universal primers. Analyzed using an automated nucleic acid analyzer, these products enabled simultaneous detection of seven pathogens.
[0078] Table 1 Preamplified names and sequences of porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2
[0079] Table 2 Names and sequences of the left and right probes for porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2
[0080]
[0081] Among them, the above SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22,
[0082] The 5' ends of SEQ ID NO: 24, SEQ ID NO: 26, and SEQ ID NO: 28 are phosphorylated;
[0083] Table 3 Universal primer sequences
[0084]
[0085] The present invention adopts multiplex ligation probe amplification technology to establish a detection method for simultaneously detecting porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2, and assembles a kit.
[0086] The Multiplex Ligation-Based Probe Amplification Detection Kit for the detection of porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis, and porcine circovirus type 2 consists of the following components:
[0087] (1) a pre-amplification primer mixture, comprising reverse transcription and pre-amplification primers for porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis, and porcine circovirus type 2. The primer sequences are shown in Table 1. The concentration of each primer in the mixture is 0.25 μM.
[0088] (2) a probe mixture comprising left and right probes for detecting porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis, and porcine circovirus type 2, the sequences of the probes being shown in Table 2, wherein the 5' ends of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, and SEQ ID NO: 28 are phosphorylated; the concentration of each probe in the mixture is 1.33 nM;
[0089] (3) MLPA buffer;
[0090] (4) Ligation buffer A;
[0091] (5) Ligation buffer B;
[0092] (6) Ligase-65;
[0093] (7) a PCR reaction mixture comprising universal primers shown in SEQ ID NO: 29 and SEQ ID NO: 30;
[0094] (8) SALSA polymerase;
[0095] (9) Negative control: TE;
[0096] (10) Positive control: a mixture of in vitro transcribed RNA and positive recombinant plasmid DNA, wherein the in vitro transcribed RNA is the in vitro transcribed RNA of the M gene of porcine reproductive and respiratory syndrome virus, the S gene of porcine respiratory coronavirus, and the M gene of swine influenza virus; and the positive recombinant plasmid DNA refers to the positive recombinant plasmid DNA of the ApxIVA gene of porcine Actinobacillus pleuropneumoniae, the toxA gene of porcine Pasteurella multocida, the 16s rRNA gene of Haemophilus parasuis, and the ORF2 gene of porcine circovirus type 2.
[0097] Preparation of in vitro transcribed RNA of the porcine reproductive and respiratory syndrome virus (PRRSV) M gene: A relatively conserved 269-bp sequence within the porcine reproductive and respiratory syndrome virus (PRRSV) M gene was selected for in vitro gene synthesis by sequence alignment in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-PRRSV. Purified plasmid was used as a template, linearized with MluI, and in vitro transcription was performed using the Ambion MEGAscript T7 kit. The in vitro transcription product was precipitated with LiCl, washed with 70% ethanol, and dissolved in RNase-free ddH2O. The integrity and accuracy of RNA synthesis were verified by nucleic acid electrophoresis, and the RNA concentration was determined. The in vitro transcribed RNA of the porcine reproductive and respiratory syndrome virus (PRRSV) M gene was designated PRRSV-M-RNA. The porcine reproductive and respiratory syndrome virus (PRRSV) M gene is shown in the sequence listing as SEQ ID NO: 31.
[0098] Preparation of a recombinant plasmid expressing the ApxIVA gene of Actinobacillus pleuropneumoniae: A relatively conserved 223-bp sequence from the ApxIVA gene of Actinobacillus pleuropneumoniae was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-APP. The ApxIVA gene of Actinobacillus pleuropneumoniae is shown in SEQ ID NO: 32 in the sequence listing.
[0099] Preparation of a recombinant plasmid expressing the toxA gene of Pasteurella multocida: A relatively conserved 280-bp sequence from the toxA gene of Pasteurella multocida was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-PM. The toxA gene of Pasteurella multocida is shown in the sequence listing as SEQ ID NO: 33.
[0100] Preparation of in vitro transcribed RNA of porcine respiratory coronavirus S gene: Through sequence alignment in the database, a relatively conserved 310bp sequence in the porcine respiratory coronavirus S gene was selected for in vitro gene synthesis and cloned into the pUC57 vector (purchased from Promega), named pUC-PRCV-S. Using the purified plasmid as a template, the plasmid was linearized with MluI enzyme and then in vitro transcribed using Ambion's MEGAscript T7 kit. The in vitro transcription product was precipitated with LiCl, washed with 70% ethanol, and dissolved in RNase-free ddH2O. The integrity and correctness of RNA synthesis were detected by nucleic acid electrophoresis, and the RNA concentration was determined. The in vitro transcribed RNA of the porcine respiratory coronavirus S gene was named PRCV-S-RNA. The porcine respiratory coronavirus S gene is shown in SEQ ID NO: 34 in the sequence listing.
[0101] Preparation of in vitro transcribed RNA of the swine influenza virus M gene: A relatively conserved 349-bp sequence from the swine influenza virus M gene was selected for in vitro gene synthesis by sequence alignment in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-SIV-M. Using the purified plasmid as a template, the plasmid was linearized with MluI and in vitro transcription was performed using the Ambion MEGAscript T7 kit. The in vitro transcription product was precipitated with LiCl, washed with 70% ethanol, and dissolved in RNase-free ddH2O. The integrity and accuracy of RNA synthesis were verified by nucleic acid electrophoresis, and the RNA concentration was determined. The in vitro transcribed RNA of the swine influenza virus M gene was designated SIV-M-RNA. The swine influenza virus M gene is shown in SEQ ID NO: 35 in the sequence listing.
[0102] Preparation of a recombinant plasmid expressing the Haemophilus parasuis 16S rRNA gene: A relatively conserved 338-bp sequence from the Haemophilus parasuis 16S rRNA gene was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-HPS-16s. The Haemophilus parasuis 16S rRNA gene is shown in SEQ ID NO: 36 in the sequence listing.
[0103] Preparation of a recombinant plasmid expressing the porcine circovirus type 2 ORF2 gene: A relatively conserved 312-bp sequence from the porcine circovirus type 2 ORF2 gene was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-PCV2-ORF2. The sequence of the porcine circovirus type 2 ORF2 gene is shown in the sequence listing as SEQ ID NO: 37.
[0104] The present invention provides a multiplex ligation probe amplification detection method for simultaneously detecting porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2. The specific operation process is as follows:
[0105] 1. Extract sample DNA / RNA using magnetic bead method;
[0106] The DNA and RNA in the sample were simultaneously extracted using the Tianlong NP968 fully automatic nucleic acid extractor using the TIANGEN magnetic bead DNA / RNA co-extraction kit to obtain 100 μL of sample.
[0107] 2. RNA reverse transcription into cDNA and pre-amplification
[0108] Perform one-step reverse transcription RT-PCR according to the QIAGEN OneStep Ahead RT-PCR Kit instructions. Prepare a 25 μL reaction system: 10 μL OneStep Ahead RT-PCR Master Mix, 1 μL OneStep Ahead RT-Mix, 5 μL DNA or RNA, 5 μL Q-solution, 1 μL pre-amplification primer mix (final concentration of each primer 0.25 μM), and 3 μL HO. Reaction conditions: 50°C for 10 min, 95°C for 5 min; 30 cycles of 95°C for 15 s, 55°C for 20 s, and 72°C for 20 s; 72°C for 2 min.
[0109] 3.MLPA detection
[0110] 1) DNA denaturation
[0111] Take a 0.2 mL PCR reaction tube, add 0.5 μL DNA solution and 4.5 μL TE to each tube, denature at 98°C for 5 min, and cool to room temperature (25°C).
[0112] 2) Hybridization of probe and sample DNA
[0113] Prepare 3 μL of probe mixture: 1.5 μL MLPA buffer + 1.5 μL probe mixture. Add the probe mixture to the above PCR tube, incubate at 95°C for 1 minute, hybridize at 60°C for 1-16 hours, and then incubate at 54°C.
[0114] 3) Ligation of hybridization probes
[0115] Prepare 32 μL of ligase mix: 25 μL dHO + 3 μL Ligation Buffer A + 3 μL Ligation Buffer B + 1 μL Ligase-65. Lower the PCR instrument temperature to 54°C, open the tube cap, add 32 μL of ligase mix, incubate at 54°C for 15 minutes, heat at 98°C for 5 minutes to inactivate the ligase, and then incubate at 20°C.
[0116] 4) PCR amplification of ligated probes
[0117] Prepare 10 μL of PCR mixture: 7.5 μL of dH2O + 2 μL of PCR reaction mix + 0.5 μL of SALSA polymerase. Remove the PCR tube and add 10 μL of the PCR mixture at room temperature. Start the PCR reaction using the following reaction conditions: 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, for 35 cycles; incubate at 72°C for 20 minutes, then cool to 15°C.
[0118] 5) Analysis by fully automatic nucleic acid analyzer:
[0119] The PCR amplification products were analyzed using a fully automatic nucleic acid analyzer (Qsep100 DNA Analyzer).
[0120] 4. Result description and judgment
[0121] 1) Quality control standards:
[0122] The positive control had specific amplification bands at 94bp, 98bp, 112bp, 116bp, 122bp, 130bp, and 140bp.
[0123] There was no specific amplified band in the negative control.
[0124] If the negative control and positive conditions do not meet the above conditions, the test will be considered invalid.
[0125] 2) Result judgment:
[0126] Positive: There is a specific amplification band at 94bp, indicating the presence of porcine reproductive and respiratory syndrome virus nucleic acid in the sample; there is a specific amplification band at 98bp, indicating the presence of porcine Actinobacillus pleuropneumoniae nucleic acid in the sample; there is a specific amplification band at 112bp, indicating the presence of porcine Pasteurella multocida nucleic acid in the sample; there is a specific amplification band at 116bp, indicating the presence of porcine respiratory coronavirus nucleic acid in the sample; there is a specific amplification band at 122bp, indicating the presence of swine influenza virus nucleic acid in the sample; there is a specific amplification band at 130bp, indicating the presence of Haemophilus parasuis nucleic acid in the sample; there is a specific amplification band at 140bp, indicating the presence of porcine circovirus type 2 nucleic acid in the sample; the MLPA amplification product can be sequenced for further confirmation;
[0127] Negative: No specific amplification band, indicating that the sample does not contain porcine reproductive and respiratory syndrome virus nucleic acid, porcine Actinobacillus pleuropneumoniae nucleic acid, porcine Pasteurella multocida nucleic acid, porcine respiratory coronavirus nucleic acid, swine influenza virus nucleic acid, Haemophilus parasuis nucleic acid and porcine circovirus type 2 nucleic acid.
[0128] The present invention is described in detail below with reference to specific embodiments.
[0129] 1. Use of the kit
[0130] 1 Composition of the kit
[0131]
[0132] MLPA buffer, ligation buffer A, ligation buffer B, ligase Ligase-65 and SALSA polymerase were purchased from MRC-Holland.
[0133] Storage conditions:
[0134] 1) Store all components except the positive control at -15°C to -25°C. The positive control should be stored at -80°C.
[0135] 2) To ensure the experimental results, the test kit products must be used within one year.
[0136] 2. How to use
[0137] 2.1 Extract DNA / RNA from samples using magnetic beads;
[0138] The DNA and RNA in the sample were simultaneously extracted using the Tianlong NP968 fully automatic nucleic acid extractor using the TIANGEN magnetic bead DNA / RNA co-extraction kit to obtain 100 μL of sample.
[0139] 2.2 RNA reverse transcription into cDNA and pre-amplification
[0140] Perform one-step reverse transcription RT-PCR according to the QIAGEN OneStep Ahead RT-PCR Kit instructions. Prepare a 25 μL reaction system: 10 μL OneStep Ahead RT-PCR Master Mix, 1 μL OneStep Ahead RT-Mix, 5 μL DNA or RNA, 5 μL Q-solution, 1 μL pre-amplification primer mix (final concentration of each primer 0.25 μM), and 3 μL HO for saturation. Reaction conditions: 50°C for 10 min, 95°C for 5 min; 30 cycles of 95°C for 15 s, 55°C for 20 s, and 72°C for 20 s; 72°C for 2 min.
[0141] 2.3 MLPA detection
[0142] 2.3.1 DNA denaturation
[0143] Take a 0.2 mL PCR reaction tube, add 0.5 μL DNA solution and 4.5 μL TE to each tube, denature at 98°C for 5 min, and cool to room temperature (25°C).
[0144] 2.3.2 Hybridization of probe and sample DNA
[0145] Prepare 3 μL of probe mixture: 1.5 μL MLPA buffer + 1.5 μL probe mixture. Add the probe mixture to the above PCR tube, incubate at 95°C for 1 minute, hybridize at 60°C for 1-16 hours, and then incubate at 54°C.
[0146] 2.3.3 Ligation of hybridization probes
[0147] Prepare 32 μL of ligase mix: 25 μL dHO + 3 μL Ligation Buffer A + 3 μL Ligation Buffer B + 1 μL Ligase-65. Lower the PCR instrument temperature to 54°C, open the tube cap, add 32 μL of ligase mix, incubate at 54°C for 15 minutes, heat at 98°C for 5 minutes to inactivate the ligase, and then incubate at 20°C.
[0148] 2.3.4 PCR amplification of ligated probes
[0149] Prepare 10 μL of PCR mixture: 7.5 μL of dH2O + 2 μL of PCR reaction mix + 0.5 μL of SALSA polymerase. Remove the PCR tube and add 10 μL of the PCR mixture at room temperature. Start the PCR reaction using the following reaction conditions: 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, for 35 cycles; incubate at 72°C for 20 minutes, then cool to 15°C.
[0150] 2.3.5 Analysis by fully automatic nucleic acid analyzer:
[0151] The PCR amplification products were analyzed using a fully automatic nucleic acid analyzer (Qsep100 DNA Analyzer).
[0152] 2.4. Result description and judgment
[0153] 1) Quality control standards:
[0154] The positive control had specific amplification bands at 94bp, 98bp, 112bp, 116bp, 122bp, 130bp, and 140bp.
[0155] There was no specific amplified band in the negative control.
[0156] If the negative control and positive conditions do not meet the above conditions, the test will be considered invalid.
[0157] 2) Result judgment:
[0158] Positive: There is a specific amplification band at 94bp, indicating the presence of porcine reproductive and respiratory syndrome virus nucleic acid in the sample; there is a specific amplification band at 98bp, indicating the presence of porcine Actinobacillus pleuropneumoniae nucleic acid in the sample; there is a specific amplification band at 112bp, indicating the presence of porcine Pasteurella multocida nucleic acid in the sample; there is a specific amplification band at 116bp, indicating the presence of porcine respiratory coronavirus nucleic acid in the sample; there is a specific amplification band at 122bp, indicating the presence of swine influenza virus nucleic acid in the sample; there is a specific amplification band at 130bp, indicating the presence of Haemophilus parasuis nucleic acid in the sample; there is a specific amplification band at 140bp, indicating the presence of porcine circovirus type 2 nucleic acid in the sample; the MLPA amplification product can be sequenced for further confirmation;
[0159] Negative: No specific amplification band, indicating that the sample does not contain porcine reproductive and respiratory syndrome virus nucleic acid, porcine Actinobacillus pleuropneumoniae nucleic acid, porcine Pasteurella multocida nucleic acid, porcine respiratory coronavirus nucleic acid, swine influenza virus nucleic acid, Haemophilus parasuis nucleic acid and porcine circovirus type 2 nucleic acid.
[0160] Notes:
[0161] 1) DNA sample:
[0162] a. Reduce the content of salt ions, alcohols, etc. in the DNA solution as much as possible.
[0163] b. Use TE instead of water to dissolve or dilute DNA to avoid depurination of DNA at high temperatures.
[0164] c. Dilute all DNA samples to roughly equal concentrations before the experiment (20-40 ng / ul is recommended).
[0165] 2) The probe, ligase-65, ligation buffer A, and ligation buffer B should be aliquoted before use to avoid repeated freezing and thawing.
[0166] 3) Buffers and reagents should be mixed thoroughly by vortexing and centrifuging before use. Gently pipette and mix thoroughly, taking care to avoid creating bubbles or hitting the tube walls. All enzyme-containing steps should not be centrifuged.
[0167] 4) When adding the ligase reaction, the PCR tube should be placed in the PCR instrument and should not be removed;
[0168] 5) Evaporation quality control: 8 μL TE / water blank connection, at least 5 μL remains at the bottom of the tube after connection.
[0169] 6) Fully automatic nucleic acid analyzer settings: Optimize injection voltage and time. PCR products can be diluted with diluent before loading to ensure that the signal is within the optimal analysis range.
[0170] 2. Specificity of the kit
[0171] 1. Materials
[0172] RNA extract of porcine reproductive and respiratory syndrome virus, DNA extract of porcine Actinobacillus pleuropneumoniae, DNA extract of porcine Pasteurella multocida, RNA extract of porcine respiratory coronavirus, RNA extract of swine influenza virus, DNA extract of Haemophilus parasuis and DNA extract of porcine circovirus type 2.
[0173] 2 Methods
[0174] 2.1 Use single pathogen probes to verify the specificity of the probes on RNA extracts of porcine reproductive and respiratory syndrome virus, DNA extracts of porcine Actinobacillus pleuropneumoniae, DNA extracts of porcine Pasteurella multocida, RNA extracts of porcine respiratory coronavirus, RNA extracts of swine influenza virus, DNA extracts of Haemophilus parasuis and DNA extracts of porcine circovirus type 2.
[0175] 2.2 MLPA detection was performed on RNA extracts of porcine reproductive and respiratory syndrome virus, DNA extracts of porcine Actinobacillus pleuropneumoniae, DNA extracts of porcine Pasteurella multocida, RNA extracts of porcine respiratory coronavirus, RNA extracts of swine influenza virus, DNA extracts of Haemophilus parasuis and DNA extracts of porcine circovirus type 2 using a mixed probe of seven pathogens to verify the specificity of the probes.
[0176] 3 Results
[0177] 3.1 When any set of designed probes is used for detection, only bands of corresponding sizes can be amplified from the corresponding pathogen template, indicating that the probes have good specificity.
[0178] 3.2 MLPA detection was performed on the viral templates using probes mixed with seven pathogens. Only bands of corresponding sizes could be amplified from the corresponding pathogen templates, indicating that the established method has good specificity.
[0179] 3. Sensitivity of the kit
[0180] 1. Materials
[0181] A positive recombinant plasmid containing the M gene of porcine reproductive and respiratory syndrome virus, the ApxIVA gene of porcine Actinobacillus pleuropneumoniae, the toxA gene of porcine Pasteurella multocida, the S gene of porcine respiratory coronavirus, the M gene of swine influenza virus, the 16s rRNA gene of Haemophilus parasuis, and the ORF2 gene of porcine circovirus type 2.
[0182] 2 Methods
[0183] 2.1 Plasmid construction and in vitro RNA transcription
[0184] Preparation of in vitro transcribed RNA of the porcine reproductive and respiratory syndrome virus (PRRSV) M gene: A relatively conserved 269-bp sequence within the porcine reproductive and respiratory syndrome virus (PRRSV) M gene was selected for in vitro gene synthesis by sequence alignment in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-PRRSV. Purified plasmid was used as a template, linearized with MluI, and in vitro transcription was performed using the Ambion MEGAscript T7 kit. The in vitro transcription product was precipitated with LiCl, washed with 70% ethanol, and dissolved in RNase-free ddH2O. The integrity and accuracy of RNA synthesis were verified by nucleic acid electrophoresis, and the RNA concentration was determined. The in vitro transcribed RNA of the porcine reproductive and respiratory syndrome virus (PRRSV) M gene was designated PRRSV-M-RNA. The porcine reproductive and respiratory syndrome virus (PRRSV) M gene is shown in the sequence listing as SEQ ID NO: 31.
[0185] SEQ ID NO: 31
[0186] PRRSV
[0187] GTACAAATAAGGTCGCGCTCACTATGGGAGCAGTAGTTGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCC CCTGCCCACCACGTTGAAAGTGCCGCAGGCTTTCATCCGATTGCGGCAAATGATAACCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTGAAAAGCCTCGTGTTG
[0188] Preparation of a recombinant plasmid expressing the ApxIVA gene of Actinobacillus pleuropneumoniae: A relatively conserved 223-bp sequence from the ApxIVA gene of Actinobacillus pleuropneumoniae was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-APP. The ApxIVA gene of Actinobacillus pleuropneumoniae is shown in SEQ ID NO: 32 in the sequence listing.
[0189] SEQ ID NO: 32
[0190] APP
[0191] GTGCGGGTAATGATACGGTTAATGGCGGTAATGGCGATGACACCCTCATCGGCGGCAAAGGTAATGATTTCTAAGAGGTGGCTACGGTGCGGACACCTATATCTTTAGCAAAGGACACGGACAGGATATCGTTTATGAAGATACCAATAATGATAACCGCGCAAGAGATATCGACACCTTAAAATTTACTGATATTAATTTATCCGAACTTTGGTTTAGCCG
[0192] Preparation of a recombinant plasmid expressing the toxA gene of Pasteurella multocida: A relatively conserved 280-bp sequence from the toxA gene of Pasteurella multocida was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-PM. The toxA gene of Pasteurella multocida is shown in the sequence listing as SEQ ID NO: 33.
[0193] SEQ ID NO: 33
[0194] PM
[0195] ATGCCAACAATTAATCAAAGTGCATTAGTGCCTTATAGTGCTGCACAAATGTATCAATTAGTGAATAATTATGAACGTTATCCTGAATTTGTACCGGGCTGTGTGAATGGGCGTACCTTGACCCAAAATGGTAATGAATT AACGGCGGAACTGGTGATTTCAAAAGCGGGCATTCGCCAGCAATTTACGACTCGCAATCAAATGGTGGAGAACCGTTCGATCAAAATGCAATTGGTGGAAGGTCCCTTTCGTTTTTTGCAAGGGGAATGGCAATTTGATG
[0196] Preparation of in vitro transcribed RNA of porcine respiratory coronavirus S gene: Through sequence alignment in the database, a relatively conserved 310bp sequence in the porcine respiratory coronavirus S gene was selected for in vitro gene synthesis and cloned into the pUC57 vector (purchased from Promega), named pUC-PRCV-S. Using the purified plasmid as a template, the plasmid was linearized with MluI enzyme and then in vitro transcribed using Ambion's MEGAscript T7 kit. The in vitro transcription product was precipitated with LiCl, washed with 70% ethanol, and dissolved in RNase-free ddH2O. The integrity and correctness of RNA synthesis were detected by nucleic acid electrophoresis, and the RNA concentration was determined. The in vitro transcribed RNA of the porcine respiratory coronavirus S gene was named PRCV-S-RNA. The porcine respiratory coronavirus S gene is shown in SEQ ID NO: 34 in the sequence listing.
[0197] SEQ ID NO: 34
[0198] PRCV
[0199] ATTATTACTAGCGCAGTTGATTGTGCTAGTAGTTATACCAGTGAAATAAAGTGTAAGACTCAAAGTATGAATCCCAATACGGGAGTCTATGATTTATCCGGTTACACCGTCCAACCTGTAGGACTAGTGTACCGGCGTGTTAGAAATTTGCCTGA TTGTAAAATTGAGGAATGGCTTGCTGCTAACACAGTACCCTCTCCTCTCAATTGGGAGCGCAAAACATTTCAAAATTGTAACTTCAACCTGAGCAGTCTATTAAGATTTGTTCAGGCTGAGTCACTCTCATGTAGTAATATAGATGCTTCCAAGG
[0200] Preparation of in vitro transcribed RNA from the swine influenza virus M gene: A relatively conserved 349-bp sequence from the swine influenza virus M gene was selected for in vitro gene synthesis by sequence alignment in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-SIV-M. Using the purified plasmid as a template, the plasmid was linearized with MluI and in vitro transcription was performed using the Ambion MEGAscript T7 kit. The in vitro transcription product was precipitated with LiCl, washed with 70% ethanol, and dissolved in RNase-free ddH₂O. The integrity and accuracy of RNA synthesis were verified by nucleic acid electrophoresis, and the RNA concentration was determined. The in vitro transcribed RNA from the swine influenza virus M gene was designated SIV-M-RNA. The swine influenza virus M gene is shown in SEQ ID NO: 35 in the sequence listing.
[0201] SEQ ID NO: 35
[0202] SIV
[0203] TCGGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCAGGGAAGAACACCGATCTCGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGGTTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTG CAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGGAAATGGAGATCCAAACAACATGGATAGGGCAGTTAAACTATACAGGAAACTGAAAAGAGAGATAACATTCCATGGGGCTAAGGAGGTCGCACTCAGCTACTCAACCGGTGCACTTGCCAGTTGTATGGGTCTCATATACA
[0204] Preparation of a recombinant plasmid expressing the Haemophilus parasuis 16S rRNA gene: A relatively conserved 338-bp sequence from the Haemophilus parasuis 16S rRNA gene was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-HPS-16s. The Haemophilus parasuis 16S rRNA gene is shown in SEQ ID NO: 36 in the sequence listing.
[0205] SEQ ID NO: 36
[0206] HPS
[0207] TTTTAGGGAGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAATACCGAAGGCGAAGGCAGCCCCTTGGGAAAATACTGACGCTCATGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGCTGTCGATT TGGGGATTGGGCTTTATGTTTTGGTGCCCGTAGCTAACGTGATAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATC
[0208] Preparation of a recombinant plasmid expressing the porcine circovirus type 2 ORF2 gene: A relatively conserved 312-bp sequence from the porcine circovirus type 2 ORF2 gene was selected for in vitro gene synthesis by sequence comparison in a database. The sequence was then cloned into the pUC57 vector (purchased from Promega) and designated pUC-PCV2-ORF2. The sequence of the porcine circovirus type 2 ORF2 gene is shown in the sequence listing as SEQ ID NO: 37.
[0209] SEQ ID NO: 37
[0210] PCV2
[0211] GAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAGTTGGATCCAGTGCTATTATTCTAGATGACAACTTTGTAATAAAGGCCACAGCCCAAACCTATGACCCCTATGTAAACTACTCCTCCCGCCATA CAATCCCCCAACCCTTCTCCTACCACTCCCGTTACTTCACACCCAAACCTGTTCTTGATTCCACTATTGATTACTTCCAACCAAATAACAAAAGGAATCAGCTGTGGATGAGACTACAAACCAGTAGAAATGTGGACCACGTAGGCCTCGGCACTG
[0212] 2.2 Sensitivity Verification
[0213] In vitro transcribed RNA or recombinant plasmid DNA was washed with TE buffer from 10 -1 to 10 -11 Serial dilutions were performed and then MLPA reactions were performed.
[0214] 3 Results
[0215] This method can detect a minimum of 33.7 copies of porcine reproductive and respiratory syndrome virus RNA, 4.56 copies of porcine Actinobacillus pleuropneumoniae DNA, 32.57 copies of porcine Pasteurella multocida DNA, 29.42 copies of porcine respiratory coronavirus RNA, 26.14 copies of swine influenza virus RNA, 26.99 copies of Haemophilus parasuis DNA, and 29.23 copies of porcine circovirus type 2 DNA.
[0216] It should be emphasized that the present invention only provides a multiplex ligation probe amplification detection method, the purpose of which is to detect 7 pathogenic nucleic acids that can cause porcine respiratory diseases. However, even if the presence of pathogens is detected, it cannot directly determine whether the test subject has the corresponding disease. The diagnosis of whether the test subject has a disease still needs to be judged in combination with epidemiological, pathological and other factors. The detection method of the present invention can only provide detection experimental data for reference during diagnosis, and the experimental data cannot directly give a conclusion on whether the test subject is sick.
Claims
1. A multiplex ligation probe amplification and identification kit capable of detecting a variety of porcine respiratory pathogens, characterized in that: The kit includes: (1) Pre-amplification primer mix; The mixture includes pre-amplification primers, the sequences of which are shown in SEQ ID NOs: 1 to 14; (2) Probe mixture; The mixture includes a left probe and a right probe, the sequences of which are shown in SEQ ID NOs: 15 to 28; (3) MLPA buffer; (4) Ligation buffer A; (5) Ligation buffer B; (6) Ligase-65; (7) a PCR reaction mixture comprising universal primers as shown in SEQ ID NOs: 29 and 30; (8) SALSA polymerase; (9) Negative control; (10) Positive control; Among the pre-amplification primers in the pre-amplification primer mixture: sequence SEQ ID NO: 1 and sequence SEQ ID NO: 2 are respectively the forward and reverse primers for pre-amplification of porcine reproductive and respiratory syndrome virus; sequence SEQ ID NO: 3 and sequence SEQ ID NO: 4 are respectively the forward and reverse primers for pre-amplification of porcine Actinobacillus pleuropneumoniae; sequence SEQ ID NO: 5 and sequence SEQ ID NO: 6 are respectively the forward and reverse primers for pre-amplification of porcine Pasteurella multocida; sequence SEQ ID NO: 7 and SEQ ID NO: 8 are respectively the forward and reverse primers for pre-amplification of porcine respiratory coronavirus; sequence SEQ ID NO: 9 and SEQ ID NO: 10 are respectively the forward and reverse primers for pre-amplification of swine influenza virus; sequence SEQ ID NO: 11 and SEQ ID NO: 12 are respectively the forward and reverse primers for pre-amplification of Haemophilus parasuis; sequence SEQ ID NO: 13 and SEQ ID NO: 14 are respectively the forward and reverse primers for pre-amplification of porcine circovirus type 2; Among the probes in the probe mixture: sequences SEQ ID NO: 15 and SEQ ID NO: 16 are respectively the left probe and the right probe for detecting porcine reproductive and respiratory syndrome virus; sequences SEQ ID NO: 17 and SEQ ID NO: 18 are respectively the left probe and the right probe for detecting porcine Actinobacillus pleuropneumoniae; sequences SEQ ID NO: 19 and SEQ ID NO: 20 are respectively the left probe and the right probe for detecting porcine Pasteurella multocida; sequences SEQ ID NO: 21 and SEQ ID NO: 22 are respectively the left probe and the right probe for detecting porcine respiratory coronavirus; sequences SEQ ID NO: 23 and SEQ ID NO: 24 are respectively the left probe and the right probe for detecting swine influenza virus; sequences SEQ ID NO: 25 and SEQ ID NO: 26 are respectively the left probe and the right probe for detecting Haemophilus parasuis; sequences SEQ ID NO: 27 and SEQ ID NO: 28 are respectively the left probe and the right probe for detecting porcine circovirus type 2; Among the primers in the PCR reaction mixture, sequences SEQ ID NO: 29 and SEQ ID NO: 30 are universal forward and reverse primers, respectively; wherein the 5' ends of the sequences SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, and SEQ ID NO: 28 are phosphorylated; The positive control is a mixture of in vitro transcribed RNA and positive recombinant plasmid DNA; wherein the in vitro transcribed RNA is the in vitro transcribed RNA of the M gene of porcine reproductive and respiratory syndrome virus, the S gene of porcine respiratory coronavirus, and the M gene of swine influenza virus; the positive recombinant plasmid DNA refers to the positive recombinant plasmid DNA of the ApxIVA gene of porcine Actinobacillus pleuropneumoniae, the toxA gene of porcine Pasteurella multocida, the 16s rRNA gene of Haemophilus parasuis, and the ORF2 gene of porcine circovirus type 2.
2. A method for simultaneously detecting multiple porcine respiratory pathogens by multiple ligation probe amplification for non-disease detection purposes using the kit according to claim 1, characterized in that: The following steps are involved: (1) Extraction of sample DNA / RNA using magnetic beads; DNA and RNA were extracted simultaneously using a magnetic bead DNA / RNA co-extraction kit and an automatic nucleic acid extractor to obtain 100 µL of sample. (2) RNA reverse transcription into cDNA and pre-amplification One-step reverse transcription RT-PCR reaction was performed; Prepare a 25 μL reaction system: 10 μL OneStep Ahead RT-PCR Master Mix, 1 μL OneStep Ahead RT-Mix, 5 μL DNA or RNA, 5 μL Q-solution, 1 μL pre-amplification primer mix with a final concentration of 0.25 μM for each primer, and 3 μL HO. Reaction conditions: 50°C for 10 min, 95°C for 5 min; 30 cycles of 95°C for 15 s, 55°C for 20 s, and 72°C for 20 s; 72°C for 2 min. (3) MLPA testing a. DNA denaturation Take a 0.2 mL PCR reaction tube, add 0.5 μL DNA solution and 4.5 μL TE to each tube, denature at 98°C for 5 min, and cool to room temperature (25°C); b. Hybridization of probe and sample DNA Prepare 3 μL of probe mixture: 1.5 μL MLPA buffer + 1.5 μL probe mixture; add the probe mixture to the above PCR tube, incubate at 95°C for 1 min, hybridize at 60°C for 1-16 h, and incubate at 54°C; c. Ligation of hybridization probes Prepare 32 μL of ligase mix: 25 μL dH2O + 3 μL ligation buffer A + 3 μL ligation buffer B + 1 μL ligase-65; The PCR instrument temperature was lowered to 54°C, the tube cap was opened, 32 μL of ligase mixture was added, incubated at 54°C for 15 min, heated at 98°C for 5 min to inactivate the ligase, and incubated at 20°C; d. PCR amplification of ligated probes Prepare 10 μL of PCR mixture: 7.5 μL of dH2O + 2 μL of PCR reaction mixture + 0.5 μL of SALSA polymerase; remove the PCR tube and add 10 μL of PCR mixture at room temperature; start the PCR reaction with the following reaction conditions: 95°C for 30 s, 60°C for 30 s, and 72°C for 60 s, for 35 cycles; incubate at 72°C for 20 min, then cool to 15°C; e. Analysis by fully automatic nucleic acid analyzer: The PCR amplification products were taken and analyzed using a fully automatic nucleic acid analyzer; (4) Result description and judgment a. Quality control standards: The positive control had specific amplification bands at 94 bp, 98 bp, 112 bp, 116 bp, 122 bp, 130 bp, and 140 bp; There was no specific amplification band in the negative control; If the negative control and positive conditions do not meet the above conditions, the test will be considered invalid; b. Result judgment: Positive: There is a specific amplification band at 94 bp, indicating the presence of porcine reproductive and respiratory syndrome virus nucleic acid in the sample; there is a specific amplification band at 98 bp, indicating the presence of porcine Actinobacillus pleuropneumoniae nucleic acid in the sample; there is a specific amplification band at 112 bp, indicating the presence of porcine Pasteurella multocida nucleic acid in the sample; there is a specific amplification band at 116 bp, indicating the presence of porcine respiratory coronavirus nucleic acid in the sample; there is a specific amplification band at 122 bp, indicating the presence of swine influenza virus nucleic acid in the sample; there is a specific amplification band at 130 bp, indicating the presence of Haemophilus parasuis nucleic acid in the sample; there is a specific amplification band at 140 bp, indicating the presence of porcine circovirus type 2 nucleic acid in the sample; Negative: No specific amplification bands are found, indicating that the sample does not contain nucleic acid of porcine reproductive and respiratory syndrome virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, swine influenza virus, Haemophilus parasuis and porcine circovirus type 2. When judging the results, the MLPA amplification products were sequenced to further confirm the results.
Citation Information
Patent Citations
Multiplex ligation-dependent probe amplification detection kit for simultaneously detecting five swine disease viruses, primers and probes
CN102943129A
MLPA (multiplex ligation-dependent probe amplification) identification kit capable of detecting multiple pathogens causing sudden death of pigs
CN108220479A
MLPA detection kit for detection of pathogenic nucleic acids of porcine viral reproductive disorder syndrome
CN109207635A