A kind of multicolor Penicillium and its application

Abstract

The present invention discloses a multicolor Penicillium and its application. The multicolor Penicillium is named Penicillium multicolor JX-M6, and its deposit number is: CCTCC NO: M 2020215. The multicolor Penicillium (Penicillium multicolor) JX-M6 screened from the rhizosphere soil of bamboo in the present invention has a high-efficiency phosphate solubilizing ability; under different initial pH, the strain JX-M6 has good growth and adaptability, and has a strong dissolving effect on 5 kinds of insoluble phosphates, calcium phosphate, iron phosphate, aluminum phosphate, calcium hydrogen phosphate, and calcium phytate; in addition, the liquid bacterial agent made from the strain JX-M6 of the present invention has a significant growth-promoting effect on the ground diameter and seedling height of Chinese fir. Therefore, the present invention provides excellent strain resources for the development of environmentally friendly Chinese fir biological special fertilizers.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and biofertilizers, and in particular relates to multicolor Penicillium and application thereof. Background Art

[0002] Chinese fir (Cunninghamia lanceolata) is the most important fast-growing high-quality timber species in southern my country, accounting for 60%-80% of the total forest area in southeastern provinces of my country. It is a timber production species with excellent economic and ecological benefits. Continuous planting of Chinese fir for many generations will lead to a decline in forest productivity and soil fertility. In addition, in recent years, with the indiscriminate logging of Chinese fir forests and unreasonable management, the phenomenon of forest nutrient depletion has become increasingly serious. At present, weak soil fertility and insufficient nutrient supply are one of the main problems faced in the cultivation of Chinese fir resources. For example, studies have shown that the effectiveness of soil phosphorus has become an important factor restricting the improvement of productivity of Chinese fir plantations.

[0003] Rhizosphere microorganisms are key participants and regulators of rhizosphere processes. Rhizosphere soil microorganisms directly or indirectly affect plant community structure and productivity by changing the availability of soil nutrients and the way they coexist with plant roots. There are a large number of microorganisms in the rhizosphere of plants, some of which have the functions of solubilizing phosphate, dissolving potassium and secreting IAA, thereby promoting plant growth. As an important type of microorganism in soil phosphorus cycle, phosphate-solubilizing fungi can improve the phosphorus supply of soil. Using phosphate-solubilizing microorganisms to improve the ability of Chinese fir soil to absorb phosphorus and improve the productivity of Chinese fir forests has alleviated the problem of soil phosphorus deficiency in Chinese fir forests in southern my country, and can also solve a series of problems such as pollution of bamboo forest ecological environment and soil compaction caused by chemical fertilizers. At present, there are no reports on the screening and application of efficient phosphate-solubilizing fungal strains in the rhizosphere of Chinese fir. Summary of the invention

[0004] The purpose of the present invention is to provide a Penicillium multicolor JX-M6 and its application in promoting the growth of Chinese fir. The Penicillium multicolor JX-M6 has a good solubility for sparingly soluble phosphates, promotes the absorption and utilization of soil phosphorus by Chinese fir, and can significantly promote the growth and development of plants, such as Chinese fir seedlings.

[0005] The technical solution adopted by the present invention is as follows:

[0006] A highly efficient phosphate-solubilizing fungus Penicillium multicolor JX-M6 was screened from the rhizosphere soil of a Chinese fir plantation in Shixi Forest Farm, Taihe County, Ji'an City, Jiangxi Province. It has been deposited in the China Center for Type Culture Collection (CCTCC), address: Wuhan University, Wuhan City, Hubei Province, China, zip code: 430072, with the deposit number: CCTCC NO: M2020215, and the deposit date is June 18, 2020.

[0007] Main biological characteristics of Penicillium multicolor JX-M6: The optimal growth temperature on PDA medium is 28°C. After 5-6 days of cultivation, 3-4 cm colonies are formed. The colonies are gray-green ( Figure 1 ); conidiophores are broom-like branches, conidia are elliptical, single-celled ( Figure 2 ).

[0008] The ITS, BenA and CaM sequences of Penicillium multicolor JX-M6 are shown in SEQ ID NO.1-3. The ITS, BenA and CaM sequences were compared with the sequences in the GeneBank database. The results showed that the strain JX-M6 had a high homology with Penicillium multicolor, with a similarity of 91%. Combined with the morphology and ITS, BenA and CaM sequence analysis, it was identified as Penicillium multicolor.

[0009] Therefore, the first object of the present invention is to provide a Penicillium multicolor JX-M6, whose preservation number is: CCTCC NO: M 2020215.

[0010] The second object of the present invention is to provide a microbial preparation comprising the above-mentioned Penicillium multicolor JX-M6.

[0011] Preferably, the microbial preparation further comprises an auxiliary material that can prolong the activity time of the strain, or other auxiliary materials acceptable to microbial preparations.

[0012] The third object of the present invention is to provide the use of the above-mentioned Penicillium multicolor JX-M6 or microbial preparation in promoting plant growth.

[0013] Preferably, the plant is Chinese fir.

[0014] The fourth object of the present invention is to provide the use of the above-mentioned Penicillium multicolor JX-M6 or microbial preparation in dissolving insoluble phosphates and / or insoluble potassium salts.

[0015] Preferably, the dissolving of the sparingly soluble phosphate and / or sparingly soluble potassium salt is to convert the sparingly soluble phosphate and / or sparingly soluble potassium salt into a soluble phosphate and / or soluble potassium salt that is easily absorbed by plants.

[0016] Preferably, the poorly soluble phosphate includes tricalcium phosphate, iron phosphate, calcium hydrogen phosphate, aluminum phosphate or calcium phytate.

[0017] A fifth object of the present invention is to provide the use of the above-mentioned Penicillium multicolor JX-M6 or microbial preparation in the preparation of biological fertilizers.

[0018] The sixth object of the present invention is to provide a biological fertilizer containing the above-mentioned Penicillium multicolor JX-M6 or microbial preparation. The dosage form of the biological fertilizer is preferably powder, suspension or granule.

[0019] The present invention has the following beneficial effects:

[0020] The invention discloses a highly efficient phosphate-solubilizing fungus Penicillium multicolor JX-M6 in the rhizosphere of Chinese fir, which can decompose insoluble phosphates such as calcium phosphate (Ca3(PO4)2), iron phosphate (FePO4), calcium hydrogen phosphate (CaHPO4), aluminum phosphate (AlPO4) and calcium phytate (C6H6Ca6O 24 P6) has a strong dissolving effect, and the difference in phosphate solubilization ability is extremely significant compared with the control (CK); the liquid microbial agent prepared from the high-efficiency phosphate solubilizing fungi JX-M6 strain in the rhizosphere of Chinese fir of the present invention is inoculated into one-year-old Chinese fir seedlings. The results show that the microbial agent can significantly promote the growth and development of Chinese fir, so the present invention provides an excellent strain resource for the future development of special microbial fertilizers for Chinese fir.

[0021] Penicillium multicolor JX-M6 was deposited in the China Center for Type Culture Collection (CCTCC) on June 18, 2020, address: Wuhan University, Wuhan City, Hubei Province, China, Postal Code: 430072, and the deposit number is: CCTCC NO: M 2020215. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The colony morphology of JX-M6 strain cultured in PDA medium for 7 days. A: front; B: back.

[0023] Figure 2 These are the conidiophores and conidia of the JX-M6 strain.

[0024] Figure 3 This is the phylogenetic tree of the JX-M6 strain.

[0025] Figure 4 This is the phosphosphere produced by the JX-M6 strain after being cultured in NBRIP medium for 8 days.

[0026] Figure 5 The JX-M6 strain was used to characterize the effects of five insoluble phosphates, tricalcium phosphate (Ca3(PO4)2), iron phosphate (FePO4), calcium hydrogen phosphate (CaHPO4), aluminum phosphate (AlPO4) and calcium phytate (C6H6Ca6O4) on the growth of the phosphate-soluble phosphates. 24 P6) solubility. DETAILED DESCRIPTION

[0027] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0028] Example 1: Isolation and identification of bacterial strains

[0029] A highly efficient phosphate-solubilizing fungus Penicillium multicolor JX-M6 was screened from the rhizosphere soil of a Chinese fir plantation in Shixi Forest Farm, Taihe County, Ji'an City, Jiangxi Province. The main biological characteristics of Penicillium multicolor JX-M6 are: the colonies on the Potato Dextrose Agar (PDA) plate are round, gray-green spores grow in the later stage, and the back of the colonies is yellow ( Figure 1 Conidiophores are broom-like branches, spores are spherical, and single-celled ( Figure 2 The ITS, BenA and CaM sequences of Penicillium multicolor JX-M6 are shown in SEQ ID NOs. 1 to 3. The ITS, BenA and CaM sequences were compared with the sequences in the GeneBank database ( Figure 3 The results showed that the JX-M6 strain had a high homology with Penicillium multicolor, with a similarity of 91%.

[0030] The ITS fragment sequence of the JX-M6 strain is shown in SEQ ID NO.1, specifically:

[0031] GGAAGTAAAAAATCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGA

[0032] GTGAGGGCCCTCCGGGTCCAACCTCCCACCCGTGTTTATTCGTACCTTGTTGCTTCGGCA

[0033] GGCCCGCCTCACGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCTGCCGGAGACA

[0034] ATTCTGAACGCTGTCTGAAGAATGCAGTCTGAGCGATTAGCAAAATTAGTTAAAACTTTC

[0035] AACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAAT

[0036] GTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTAT

[0037] TCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGG

[0038] GCCCTGTTCCCCCGGGAACAGGCCCGAAAGGCAGTGGCGGCACCGCGTCCGATCCTCG

[0039] AGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGTCGACCCCCCAA

[0040] CCTTTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCTCGCTGAACTTAAGCATATCAAAAGCCGGAGGAA。

[0041] The sequence of the BenA fragment of the JX-M6 strain is shown in SEQ ID NO.2, specifically: TTTGGTAACCAAATCGGTGCTGCTTTCTGGTACGTGTTGCTACCCGACCTCACTTCCCCGGTCAAATCATCAATTGTTGAACCCAGGGGCATGATGCTAACTCTGATTACAGGCAGAACATTGCTAGCGAGCATGGCCTCGACGGCGAGGGCCAGTAAGTATCGATTCAGTTGGAATTGGATGTGATGAGAATGGCGGTCTGATGTTTTTTTTTCTTAGCTTCACTGGCCAGTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACCACGTAAGTGTGGATTCGACACTCGATTTTCAACTTGATCTAATACAATGAATTCTCATAGGCCAGCGGTGACCGTTACGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGATGCTGTCCGTGCCGGTCCTTTCGGCAAGCTTTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCTGGTGCCTGGTAACAACTGGGCCAAGGGTCACTACACTGAGGGTA。

[0042] The CaM fragment sequence of strain JX-M6 is shown in SEQ ID NO.3, specifically: TGCCGACCTCTTTGACTGAAGAGCAAGTACTCCGAGTACATAGGAGGCATTCTCCCTCTTTGTAAGTGCTCCTACGCGTCGATTGGAAGACTCGTGACTGGATTTAATGCTGATGGATATGTTCTCCGGCAATAGGACAAGGATGGTGATGGTTAGTGCGACCGTCGGCGATTTTTCTGATCCAAGCCGACTGAATGATGCCCACCGGGAGAACCGAATAACTGAGACCGTACAATTATAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCCGAGCTTCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCTGGTACGATTTCCTTTCCACCCGAAAGCTCCCACGCTCGGCCCCCGGACATATGTTAACATGCGGCACAGAGTTCCTTACCATGATGGCCCGTAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGTGAGGCATTCAAGGTTTTCGACCGTGACAACAACGGTTTCATTTCCGCTGCTGAGCTGCGCCACGTTATGACCTCGATTGGCGAGAAGCTCACTGACGACGAGGTGGATGAGATGATCCGTGAGGCTGACCAGGATGGCGATGGCCGCATCGACTGTATGTTGCAAAACACCAGACTCAAAGTGACGAGTCTAGGCTTCACTTTTCCTCAACGCATATACTAACTTTGCCACAGACAACGAGTTCGTCCAGTTCCATGATGC。

[0043] Combined with morphology and ITS, BenA and CaM sequence analysis, it was identified as Penicillium multicolor and named Penicillium multicolor JX-M6. Penicillium multicolor JX-M6 was deposited in the China Center for Type Culture Collection (CCTCC) on June 18, 2020, address: Wuhan University, Wuhan, Hubei Province, China, Postal Code: 430072, and the deposit number is: CCTCC NO: M2020215.

[0044] Example 2: Determination of biomass of Penicillium multicolor JX-M6 at different initial pH

[0045] The activated strain JX-M6 was inoculated into PDA liquid medium (formula: 200g potato, 20g glucose, 1000mL distilled water, preparation: dissolve each component in water, mix evenly, and sterilize), and cultured at 25°C, 120r / min shaking for 5d as seed liquid. The pH of the PDA liquid medium was set to 1.5, 2.5, 3.5, 4.5, 5.5, and 6.5 in six gradients, and the liquid volume was 100mL in 250mL triangular flasks. Subsequently, the seed liquid was inoculated into the PDA liquid medium at a 1% (v / v) inoculation amount, and each treatment was repeated 3 times, and cultured at 25°C, 120r / min shaking for 8d. After filtering the mycelium, it was dried at 65°C for 48h and weighed. The results are shown in Table 1. The JX-M6 strain grew better under different acidic conditions of pH 1.5, 2.5, 3.5, 4.5, 5.5 and 6.5, and there was no difference in mycelial biomass. The above showed that the JX-S1 strain can adapt to different acidic environments and has the ability to grow in different acidic soil environments.

[0046] Table 1. Effects of different pH on mycelial biomass and fermentation broth pH of JX-M6 strain

[0047]

[0048]

[0049] Note: Different lowercase letters in the same column indicate significant differences.

[0050] Example 3: Detection of the phosphate solubilization ability of Penicillium multicolor JX-M6

[0051] NBRIP culture medium: 10 g glucose, 25 g Ca3(PO4), 25 g MgCl2, 0.2 g KCl, 0.25 g MgSO4.7H2O, 0.1 g (NH4)2SO4, 1000 mL distilled water, 15 g agar, mix well and sterilize.

[0052] Pour the sterilized NBRIP medium onto the plate, wait for the medium in the plate to solidify, then inoculate the activated strain JX-M6 onto the NBRIP plate, culture at 30°C for 5 days, and observe whether a phosphate ring is produced. Figure 4 As shown, from Figure 4 It can be seen that there is a phosphate-solubilizing zone around the colony of Penicillium multicolor JX-M6, which indicates that Penicillium multicolor JX-M6 has the ability to solubilize phosphate.

[0053] Example 4: Test on the phosphate solubilization ability of Penicillium multicolor JX-M6 at different initial pH

[0054] Phosphate-solubilizing medium A: 10 g glucose, 25 g Ca3(PO4), 25 g MgCl2, 0.2 g KCl, 0.25 g MgSO4.7H2O, 0.1 g (NH4)2SO4, 1000 mL distilled water, mix well and sterilize.

[0055] Phosphate-solubilizing medium B: Use aluminum phosphate (AlPO4) to replace Ca3(PO4)3 in phosphate-solubilizing medium A. Keep other ingredients and contents the same. Mix well and sterilize to obtain the product.

[0056] Phosphate-solubilizing medium C: Use iron phosphate (FePO4) to replace Ca3(PO4)3 in phosphate-solubilizing medium A. Keep other ingredients and contents the same. Mix well and sterilize to obtain the product.

[0057] Phosphate-solubilizing medium D: Use calcium hydrogen phosphate (CaHPO4) to replace Ca3(PO4)3 in phosphate-solubilizing medium A. Keep other ingredients and contents the same. Mix well and sterilize to obtain the product.

[0058] Phosphate-dissolving medium E: Calcium phytate (C6H6Ca6O 24 P6) replaces Ca3(PO4)3 in phosphate-solubilizing medium A, and the other ingredients and contents are the same, and the mixture is mixed evenly and sterilized.

[0059] The activated strain JX-M6 was inoculated into PDA medium (formula: 200 g potato, 20 g glucose, 18 g agar, 1000 mL distilled water, preparation: dissolve each component in water, mix evenly, and sterilize), and cultured at 25°C, 120 r / min for 5 days as seed solution. The seed solution was inoculated at 1% (v / v) into 100 mL triangular flasks containing 50 mL of phosphate-solubilizing medium A, B, C, D and E with pH adjusted to 2.5, 3.5, 4.5, 5.5, 6.5 and 7.2, respectively. The phosphate-solubilizing medium inoculated with the same volume of blank seed solution was used as the control (CK). Each treatment was repeated three times. After culturing at 25°C, 121 r / min for 8 days, the fermentation broth was centrifuged at 4°C, 10000 r / min for 10 min, and the soluble phosphorus content in the fermentation broth was determined by molybdenum antimony colorimetric method.

[0060] Results Figure 5 .from Figure 5 It can be concluded that the insoluble phosphates tricalcium phosphate (Ca3(PO4)2), iron phosphate (FePO4), calcium hydrogen phosphate (CaHPO4), aluminum phosphate (AlPO4) and calcium phytate (C6H6Ca6O 24 P6) was the only phosphorus source. After 8 days of cultivation in different environments with pH values ​​of 2.5, 3.5, 4.5, 5.5, 6.5, and 7.2, the soluble phosphorus content in the fermentation broth of strain JX-M6 was significantly higher than that of CK (10.57 mg / L) in different pH environments. The above showed that strain JX-M6 had a strong solubility for the five insoluble phosphorus sources under different pH conditions.

[0061] Example 5: Greenhouse potted test of Penicillium multicolor JX-M6

[0062] (1) Cultivation of Chinese fir seedlings

[0063] The seeds of Chinese fir were immersed in a 0.5% potassium permanganate solution for 2 hours for surface disinfection, then rinsed with tap water for 1 hour, sown in sterilized sand, and cultured in a greenhouse at 25°C. When they grew to the cotyledon stage, the roots of the seedlings were cut and transplanted.

[0064] (2) Potting medium: The medium soil was collected from the back mountain of Jiangxi Agricultural University campus. It was mixed in a ratio of soil: sand: vermiculite = 2:1:1, sterilized at 165°C for 2 h, and cooled for use.

[0065] (3) Preparation of liquid inoculant: Inoculate the preserved strain JX-M6 into PDA solid plate medium and culture at 25°C for 6 days. When the mycelium grows all over the plate, use a puncher (d = 7 mm) to punch the edge of the colony into a cake under sterile conditions. Then transfer it to a 500 mL triangular flask containing 250 mL PDA liquid medium for propagation. Pick 10 cakes from each flask. Place the culture temperature at 25°C and the culture speed at 120 r / min. -1 The mycelium is cultured under culture conditions until it reaches the vigorous stage, and then crushed with a sterilized homogenizer to prepare a liquid bacterial agent.

[0066] (4) Potted plant test with liquid microbial inoculation

[0067] The root cutting method was used to transplant Chinese fir seedlings, and the inoculation amount of the microbial agent was 10mL / plant. The specific method is as follows: take an appropriate amount of sterile potting matrix and put it into the flowerpot, gently take the Chinese fir seedlings out of the seedling pot, try not to hurt the root system, and rinse the sand at the root of the seedlings with clean water, cut off a small amount of the main root of the seedlings with a scalpel and transplant them into the flowerpot, put the liquid microbial agent around the root zone of the Chinese fir, compact the soil, and then cover the matrix soil and water to establish the roots. The treatment of inoculating only PDA liquid culture medium and not inoculating bacteria was used as the control (CK), and 12 replicates were used for each treatment. Placed in a 25℃ greenhouse for cultivation, watered in time, and managed uniformly. The growth of Chinese fir seedlings 180 days after inoculation is shown in Table 2. It can be seen that the application of microbial agent JX-M6 can significantly promote the growth of Chinese fir seedlings. Compared with the control, the growth rates of the treatment inoculated with microbial agent JX-M6 in seedling height and ground diameter reached 36.76% and 36.42% respectively, and the growth-promoting effect was significant.

[0068] Table 2. Effects of strain JX-M6 on the growth of bamboo seedlings

[0069]

[0070] Note: P < 0.05, different lowercase letters in the same column but different rows indicate significant differences.

[0071] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A strain of Penicillium multicolor JX-M6, whose deposit number is: CCTCC NO: M2020215.

2. A microbial preparation, characterized in that: The invention comprises the Penicillium multicolor JX-M6 as claimed in claim 1.

3. The microbial preparation according to claim 2, characterized in that The microbial preparation also contains auxiliary materials that can prolong the activity time of the strain, or other auxiliary materials acceptable to microbial preparations.

4. Use of the Penicillium multicolor JX-M6 according to claim 1 or the microbial preparation according to claim 2 in promoting plant growth.

5. The use according to claim 4, characterized in that: The plant is Chinese fir.

6. Use of the Penicillium multicolor JX-M6 according to claim 1 or the microbial preparation according to claim 2 in dissolving poorly soluble phosphates.

7. The use according to claim 6, characterized in that: The dissolving of the insoluble phosphate is to convert the insoluble phosphate into soluble phosphate which is easily absorbed by plants.

8. The use according to claim 6 or 7, characterized in that: The poorly soluble phosphate includes tricalcium phosphate, iron phosphate, calcium hydrogen phosphate, aluminum phosphate or calcium phytate.

9. Use of the Penicillium multicolor JX-M6 according to claim 1 or the microbial preparation according to claim 2 in the preparation of biological fertilizer.

10. A biological fertilizer, characterized in that: Contains the multicolor Penicillium JX-M6 according to claim 1 or the microbial preparation according to claim 2.

Images