An inducer for inducing mesenchymal cell to epithelial cell transformation and reprogramming

Abstract

The present invention relates to a pyrrolopyridine derivative and its application. The pyrrolopyridine derivative is a compound that can be used to induce the transformation of mesenchymal cells into epithelial cells and has the following formula: #imgabs0# wherein m1, m2, A2, and A3 are described herein.

Description

Technical Field

[0001] The present invention relates to the field of medicine, and in particular to a group of compounds and their use in inducing mesenchymal cell to epithelial cell transformation and reprogramming. Background Art

[0002] The mutual conversion between epithelial cells and mesenchymal cells is a highly conserved and reversible cellular process, in which polarized, immobile epithelial cells extend filopodia from their basal surface and produce migrating mesenchymal cells. Epithelial-mesenchymal and mesenchymal-epithelial transitions are recognized biological events, which play an important role not only in normal tissue and organ development but also in the pathogenesis of diseases. The phenotypic changes of cells between epithelial and mesenchymal states are divided into epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET). This conversion of cell morphology is not only the core of the complex remodeling of embryonic and organ structures during gastrulation and organogenesis, but also recognized as a key event in many cancer metastases (Thiery. JP. Nat Rev Cancer. 2002; 2: 442-54).

[0003] In the early development of Drosophila, the newly formed epithelial germ layer will participate in complex morphogenetic movements to allow the embryo to develop, such as the ectoderm cells formed will retain their epithelial phenotype (Tepass, U. Bioessays 19, 1997, 673–682; Tepass, U. & Hartenstein, V. Dev. Biol. 161, 1994: 563–596). The EMT-MET cycle is also observed during the development of the mesoderm, where these cells form dorsal vascular gonadal sheets and Malpighian tubules through the invagination of the ventral groove (Campbell, K. et al., Mech. Dev. 2010. 127, 345–357). The development of most other metazoans proceeds through a series of divisions of the fertilized egg and the gradual assembly of epithelial-like structures (Stern, CD (ed.). Gastrulation: From Cells to Embryos (Cold Spring Harbor Laboratory Press, New York, 2004). Therefore, MET occurs during normal development, including somitogenesis, kidney development, cardiogenesis, hepatogenesis, and coelomogenesis (Bin Let al., PLoS One. 2011; 6(2): e17092; Nakajima Y et al., Anat Rec. 2000; 258: 119–127). The above findings show that the mechanism of MET is similar during the morphogenesis of each organ, showing a unified trend of upregulation of epithelial-related genes and downregulation of mesenchymal genes, but each process has a unique signaling pathway to induce MET and related changes in gene expression.

[0004] Similarly, embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs) also undergo EMT and MET to differentiate into somatic cell types. Then, differentiated somatic cells can also be reprogrammed to enter a pluripotent state through continuous EMT-MET, where MET is a key step in obtaining pluripotency (Shu, X. & Pei, D. Curr. Opin. Genet. Dev. 28, 2014, 32–37). Studies have shown that MET in reprogramming achieves cell fate changes by synergizing with metabolic conversion and epigenetic modification (Wu, J., Ocampo, A. and Belmonte, JCICell, 2016, 166, 1371–1385). Studies have shown that MET plays a critical role in the early reprogramming of somatic cells in mouse embryos and human fibroblasts (Hofding, MK and Hyttel, P. Stem Cell Res. 2015, 14, 39–53; Subramanyam, D. et al. Nat. Biotechnol. 2011, 29, 443–448; Li, R. et al. Cell Stem Cell. 2010, 7, 51–63). In this process, the BMP4 pathway plays a key role in the activation of MET, which increases the effect of MET by activating intron 2 of CDH1 (encoding E-cadherin) and the promoter of CLDN4 (encoding claudin-4). Currently, compounds that bind to target proteins can be predicted based on protein structure prediction tools, and compounds that upregulate target proteins can be obtained through functional screening. At the same time, a variety of microRNAs (mirRNAs) have been found to be highly correlated with MET, such as mir-134, mir-145, mir-470, and mir-200c, all of which exhibit negative regulatory characteristics on MET (Esther E Creemers 1, Anke J Tijsen, Yigal M Pinto, Circ Res, 2012 Feb 3; 110(3): 483-95; Li, R. et al. Cell Stem Cell. 2010, 7, 51–63). Therefore, inhibitory compounds can be designed based on the structure of these regulatory microRNAs (mirRNAs), thereby achieving positive regulation of the MET phenomenon.

[0005] Therefore, the biological phenomenon of MET plays a crucial role in various developmental processes. Currently, various approaches exist to regulate development in vitro, thereby reconstructing aged or dysfunctional tissues and organs and treating related diseases through various medical approaches. This is a key research direction in regenerative medicine, focusing on the mechanisms of normal tissue characteristics and function, exploring the biological basis of post-traumatic repair, the regenerative mechanisms of tissues and organs, and the mechanisms of stem cell differentiation, ultimately leading to effective biotherapeutic approaches. Embryonic stem cells (ESCs, EK, or ESC cells) and induced pluripotent stem cells (iPS) are the most prominent research materials. However, current developmental regulation often involves genome manipulation, and various approaches, including viral vectors, carry the potential risk of tumorigenicity. Therefore, the use of regulatory methods that do not alter the genomic sequence is particularly important. The discovery of compounds that can regulate MET could play a significant role in reprogramming, cell differentiation, and tissue reconstruction, achieving safer and more flexible regulatory objectives. Summary of the Invention

[0006] Based on the above reasons, the present invention designs pyrrolopyridine derivatives that can simultaneously bind to the Oct4 protein structure and the negative regulatory mirRNA structure that binds to the Oct4 complex. Pyrrolopyridine derivatives can chemically activate Oct4 and regulate the expression of its downstream genes. This avoids the use of viruses or other vectors to regulate Oct4, further realizing a safe and simple chemical small molecule to enhance biological expression function.

[0007] The present invention provides the use of pyrrolopyridine derivative compounds, which can realize the biological phenomenon of MET in various cells, causing cell deformation and simultaneously achieving the expression of epithelial cell-related genes and early reprogramming genes. This provides a powerful initiating compound for chemical induction of reprogramming.

[0008] Among them, the present invention relates to a pyrrolopyridine derivative compound of formula (I) or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer or prodrug thereof, a pharmaceutical composition comprising a compound of formula (I) and its use as a highly selective Oct4 activator for cell reprogramming.

[0009] The present invention provides a compound of formula (I):

[0010]

[0011] in:

[0012] m1 and m2 are 0 or 1 respectively;

[0013] A2 is C1-C6 alkylene, C2-C6 alkenylene, -O(CH2)q-, -NR1-, -SO2-, -(CH2) V NHS(O)2- or a bond, wherein q is 1 or 2 or 3 or 4, V is 0 or 1 or 2, and R1 is selected from H or C1-C4 alkyl;

[0014] A3 is C1-C6 alkyl; C2-C6 alkenyl; C4-C6 cycloalkyl, one of the carbon atoms of which may be substituted by a N, O, or S heteroatom; Z and Z1 are independently N or CR2, R2 is selected from H, halogen, C1-C4 alkyl or cyano; Z3 is N, O, S or C=O, when the bond between Z4 and Z5 is a single bond, Z4 is N or CH, Z5 is CH2 or C=O, when the bond between Z4 and Z5 is a double bond, Z4 is C, Z5 is CH; or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, prodrug or a combination thereof.

[0015] In some embodiments: A2 is -CH2-, -CH=CH-, -C(CH3)=CH-, -O(CH2)-, -O(CH2)2-, -NH-, -N(CH3)-, -SO2-, -NHS(O)2-, -(CH2)2NHS(O)2-, or a bond.

[0016] In some embodiments: A3 is -CH3, butenyl,

[0017] In some embodiments: m1 is 0, m2 is 1; A2 is -N(CH3)-; A3 is

[0018] In some embodiments: m1 is 1, m2 is 0; A2 is -CH2-, -SO2-, -(CH2)2NHS(O)2-, or a bond; A3 is -CH3,

[0019] In some embodiments: m1 is 1, m2 is 1; A2 is -CH2-, -NH-, -C(CH3)=CH-, or a bond; A3 is -CH3, -C(CH3)=CH-CH3,

[0020] In some embodiments: m1 is 0, m2 is 0; A2 is -CH2-, -CH=CH-, -O(CH2)-, -O(CH2)2-, or a bond; A3 is

[0021] In some embodiments, the compound is:

[0022]

[0023] The present invention relates to a pharmaceutical composition comprising at least one of the above-mentioned compounds or their pharmaceutically acceptable salts, solvates, active metabolites, polymorphs, esters, optical isomers, prodrugs or combinations of two or more thereof, and at least one pharmaceutically acceptable carrier or excipient.

[0024] The present invention relates to the use of any one of the above-mentioned compounds and / or their pharmaceutically acceptable salts, solvates, active metabolites, polymorphs, esters, optical isomers, prodrugs or combinations thereof in the preparation of a drug for inducing mesenchymal cell to epithelial cell transformation.

[0025] The present invention relates to a method for activating Oct4, comprising contacting any one of the above compounds and / or their pharmaceutically acceptable salts, solvates, active metabolites, polymorphs, esters, optical isomers, prodrugs or combinations thereof with an Oct4 target protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The upper part shows the heat change of the sample pool, where the red peak line is the exotherm of miR-145 binding to A-3-6, and the blue line is the exotherm of the buffer without miR-145 binding to A-3-6. Figure 1 The lower half of the graph shows the peak area fit of the Multiple Sites model curve, where the calculated nSite values ​​of 3 and 1.8 correspond to Kd(M) values ​​of 7.017E-8 and 7.544E-9, respectively. The Kd(M) for the blank control group was 1.000E-3. The ITC test results demonstrate that the small molecules obtained in this invention can specifically bind to the target.

[0027] Figure 2 The results show that compared with the control group with the addition of pyrrolopyridine derivatives, the MET phenomenon can be induced after 24 hours of treatment of cells with pyrrolopyridine derivatives alone, and the cells show a typical epithelial morphology (CK is the control group);

[0028] Figure 3 Shown are the results of the effects of pyrrolopyridine derivatives on the basal expression of genes such as Oct4 (CK is the control group). DETAILED DESCRIPTION

[0029] In the present invention, the following definitions are applicable:

[0030] The term "alkyl" herein refers to a straight or branched chain saturated hydrocarbon containing 1 to 12 carbon atoms. Examples of (C1-C6) alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, pentyl, hexyl, isopropyl, isobutyl, sec-butyl, tert-butyl, isopentyl, neopentyl, and isohexyl.

[0031] The term "alkenyl" refers to a straight or branched chain unsaturated hydrocarbon containing 2 to 12 carbon atoms and containing at least one C=C double bond in the chain. Examples of alkenyl include ethenyl, propenyl, n-butenyl, isobutenyl, pentenyl or hexenyl.

[0032] The term "alkylene" refers to a divalent alkyl group. Any of the monovalent alkyl groups can be converted to an alkylene group by removing the second hydrogen atom from the alkyl group. As defined herein, an alkylene group can also be a C1-C6 alkylene group. An alkylene group can further be a C1-C4 alkylene group. Typical alkylene groups include, but are not limited to, -CH2-, -CH(CH3)-, -C(CH3)2-, -CH2CH2-, -CH2CH(CH3)-, -CH2C(CH3)2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, and the like.

[0033] The term "alkenylene" refers to a divalent alkenyl group. Any of the monovalent alkenyl groups can be converted to an alkenyl group by abstracting the second hydrogen atom from the alkenyl group. As defined herein, an alkenyl group can further be a C2-C6 alkenyl group. Typical alkenyl groups include, but are not limited to, -CH=CH-, -CH=C(CH3)-, -CH=CHCH2-, -CH=CHCH2CH2-, -CH=CHCH2CH2CH2-, -CH=CHCH2CH2CH2-, and the like.

[0034] The term "cycloalkyl" refers to a monocyclic saturated carbocyclic ring containing 3 to 18 carbon atoms. The cycloalkyl group may further be a C4-C6 cycloalkyl group. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like.

[0035] The term "halogen" refers to fluorine, chlorine, bromine or iodine.

[0036] The term "cyano" refers to a substituent having a carbon atom connected to a nitrogen atom by a triple bond (ie, C≡N).

[0037] The term "substituted" as used herein refers to the replacement of any one or more hydrogen atoms on a designated atom or group with a group selected from the designated range, provided that the normal valence of the designated atom is not exceeded.

[0038] In certain embodiments described herein, provided herein are compounds of formula (I), wherein when A2 is a "bond," the structure of the compound of formula (I) is:

[0039] The compounds described herein include, but are not limited to, their optical isomers, racemates, and other mixtures. In these cases, individual enantiomers or diastereomers, i.e., optically active configurations, can be obtained by asymmetric synthesis or by resolving the racemates or diastereomeric mixtures. The resolution of the racemates or diastereomeric mixtures can be accomplished by conventional methods, such as crystallization in the presence of a resolving agent or chromatography using, for example, a chiral high pressure liquid chromatography (HPLC) column. In addition, these compounds include R- and S-configurations of compounds having chiral centers. These compounds also include crystalline forms, including polymorphs and inclusion compounds. Similarly, the term "salt" also includes all isomers, racemates, other mixtures, R- and S-configurations, tautomers, and crystalline forms of the salts of the compounds.

[0040] "Pharmaceutically acceptable salts" refer to salts of free acids or bases of compounds represented by Formula (I), Formula (II) or Formula (III) that are non-toxic, biologically tolerable, or otherwise biologically suitable for administration to a subject. See generally: SM Berge, et al., "Pharmaceutical Salts", J. Pharm. Sci., 1977, 66: 1-19, and Handbook of Pharmaceutical Salts, Properties, Selection, and Use, Stahl and Wermuth, Eds., Wiley-VCH and VHCA, Zurich, 2002. Preferably, pharmaceutically acceptable salts are those that are pharmacologically effective and suitable for contact with patient tissues without undue toxicity, irritation, or allergic reaction. Compounds of Formula (I), Formula (II) or Formula (III) may have sufficient acidic groups, sufficient basic groups, or both types of functional groups, and accordingly react with some inorganic or organic bases, and inorganic and organic acids, to form a pharmaceutically acceptable salt. Examples of pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate, hydrochloride, hydrobromide, hydroiodide, acetate, propionate, decanoate, octanoate, acrylate, formate, isobutyrate, hexanoate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, hexyne-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, sulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, gamma-hydroxybutyrate, glycolate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, and mandelate.

[0041] "Solvates" such as "hydrates" are formed by the interaction of a solvent with a compound. The term "compound" includes solvates of the compound, including hydrates. Similarly, "salt" includes solvates of the salt, such as hydrates. Suitable solvates are pharmaceutically acceptable solvates, such as hydrates, including monohydrates and hemihydrates.

[0042] "Prodrug" may refer to a precursor of a given compound that, after administration to a subject, undergoes chemical or physiological processes in vivo (e.g., solvolysis, enzymatic decomposition) or under physiological conditions (e.g., conversion of the prodrug to a compound of Formula (I) at physiological pH) to yield the compound. A "pharmaceutically acceptable prodrug" is a prodrug that is non-toxic, biologically tolerated, or otherwise biologically suitable for administration to a subject. Exemplary procedures for selecting and preparing suitable prodrug derivatives are described, for example, in "Design of Prodrugs," edited by H. Bundgaard, Elsevier, 1985.

[0043] "Active metabolites" refer to pharmaceutically active products metabolized in vivo by compounds of formula (I), (II) or (III) or their salts. Prodrugs and active metabolites of compounds can be determined using conventional techniques known or available in the art. See, for example, Bertolini et al., J. Med. Chem. 1997, 40, 2011-2016; Shan et al., J. Pharm. Sci. 1997, 86(7), 765-767; Bagshawe, Drug Dev. Res. 1995, 34, 220-230; Bodor, Adv. Drug Res. 1984, 13, 224-331; Bundgaard, Design of Prodrugs (Elsevier Press, 1985); and Larsen, Design and Application of Prodrugs, Drug Design and Development (Krogsgaard-Larsen et al., eds., Harwood Academic Publishers, 1991)

[0044] A "therapeutically effective amount" refers to an amount of a compound disclosed herein that is sufficient, when administered to a mammal, preferably a human, to effect treatment (as defined below) of a disease or condition in the mammal, preferably a human. The amount of a disclosed compound that constitutes a "therapeutically effective amount" will vary with the compound, the condition and its severity, and the age of the mammal being treated, but can be routinely determined by one of ordinary skill in the art based on his or her knowledge and the disclosure herein.

[0045] The term "treatment" refers to administering to an individual at least one compound described herein and / or at least one pharmaceutically acceptable salt thereof to slow (reduce) undesirable physiological changes or diseases, such as the development or spread of inflammation or cancer. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviating symptoms, reducing the severity of the disease, stabilizing (i.e., not worsening) the state of the disease, delaying or slowing the progression of the disease, improving or alleviating the condition, and alleviating (whether partially or completely) the disease, whether detected or undetectable. "Treatment" also means that survival can be prolonged compared to the expected survival if not receiving treatment. Individuals in need of treatment include individuals who have symptoms of or suffer from these diseases.

[0046] Pharmaceutical composition

[0047] The present invention provides pharmaceutical compositions comprising one or more compounds described herein or pharmaceutically acceptable salts or esters thereof as active ingredients, and one or more pharmaceutically acceptable excipients, carriers, including inert solid diluents and fillers, diluents including sterile aqueous solutions and various organic solvents, penetration enhancers, solubilizers, and adjuvants. The pharmaceutical compositions can be administered alone or in combination with other therapeutic agents. Such compositions can be prepared using methods well known in the pharmaceutical art.

[0048] The pharmaceutical compositions can be administered in single or multiple doses by any of the acceptable modes of administration for similarly used pharmaceutical agents, such as those described in the patents and patent applications incorporated herein by reference, including rectal, buccal, intranasal and transdermal routes, by intraarterial injection, intravenously, intraperitoneally, parenterally, intramuscularly, subcutaneously, orally, topically, as an inhalant, or by implanted or coated devices such as stents, for example, or arterial insertion of pillar polymers.

[0049] The present invention also provides a kit comprising a pharmaceutical composition comprising a compound of the present invention or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier.

[0050] A "pharmaceutically acceptable carrier or excipient" refers to a non-toxic, biologically tolerable, and otherwise biologically suitable substance for administration to an individual, such as an inert substance, which is added to a pharmacological composition or used as a vehicle, carrier, or diluent to facilitate administration of the active ingredient and is compatible therewith. Examples of excipients include calcium carbonate, calcium phosphate, various types of sugars or starches, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.

[0051] “A combination of two or more thereof”: It should be understood that “a combination of two or more thereof” refers to a combination of two or more of a compound, a pharmaceutically acceptable salt thereof, a pharmaceutically acceptable solvate thereof, a pharmaceutically acceptable active metabolite thereof, a pharmaceutically acceptable polymorph thereof, a pharmaceutically acceptable ester thereof, a pharmaceutically acceptable optical isomer thereof, and a pharmaceutically acceptable prodrug thereof.

[0052] Uses of compounds and compositions thereof

[0053] The present invention provides the use of compounds and compositions thereof, which are mainly used as highly selective activators of Oct4 to activate Oct4 function, achieve expression regulation of its downstream genes through chemical regulation of the Oct4 promoter, and further transform mesenchymal cells into epithelial cells.

[0054] List of abbreviations used in the following examples and elsewhere herein:

[0055] CH2Cl2: dichloromethane; Cs2CO3: cesium carbonate; Cu2SO4: cuprous sulfate; DCM: dichloromethane; DMAC: N,N-dimethylacetamide; DMF: N,N-dimethylformamide; DIEA: N,N-diisopropylethylamine; DIOX: 1,4-dioxane; EA: acetic acid; Et3N: triethylamine; ETOH: ethanol; EtOAc: ethyl acetate; FA: formic acid; g: gram; h: hour; HATU: 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate; HBr: hydrobromic acid; (Hbim)BF4: 1-butylimidazole tetrafluoroborate; H2O: water; H Ac: acetic acid; H2O2: hydrogen peroxide; H2SO4: fuming sulfuric acid; KCN: potassium cyanide; K2CO3: potassium carbonate; MCA: chloroacetic acid; MeCN: acetonitrile; MeOH: methanol; mg: milligram; mL: milliliter; mmol: millimole; mol: mole; mol / L: mole / liter; m / z: mass-to-charge ratio; N2: nitrogen; NaBH3CN: sodium cyanoborohydride; NaNO2: sodium nitrite; NaOH: sodium hydroxide; Na2SO4: sodium sulfate; pH: pH; TBN: tert-butyl nitrosoate; TEA: triethanolamine; THF: tetrahydrofuran; TLC: thin-layer chromatography; μL: microliter; Xylene: xylene.

[0056] The following, along with the accompanying drawings and examples of the present invention, further illustrates the technical means employed by the present invention to achieve its intended objectives. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The raw materials, reagents, and other materials used in the following examples, unless otherwise specified, are commercially available products.

[0057] Universal synthesis

[0058] The general synthetic routes described in this application can be varied by replacing the starting materials with other raw materials having similar structures, thereby obtaining different products accordingly. The following synthetic route descriptions give multiple examples of how the starting materials can be varied to obtain the corresponding products.

[0059] General Method A-1-n

[0060]

[0061] Where R is wherein q is 1 or 2 or 3 or 4, Z and Z1 are N or CR2, and R2 is selected from H, halogen, C1-C4 alkyl or cyano.

[0062] General Method A-3-n

[0063]

[0064] wherein R is a C2-C6 alkenyl group; Wherein, q is 0 or 1 or 2 or 3 or 4, Z and Z1 are N or CR2 respectively, R2 is selected from H, halogen, C1-C4 alkyl or cyano, R1 is selected from H or C1-C4 alkyl, and Z3 is N, O, S or C=O.

[0065] General Method A-4-n

[0066]

[0067] Where R is wherein q is 0 or 1 or 2 or 3 or 4, Z and Z1 are N or CR2 respectively, and R2 is selected from H, halogen, C1-C4 alkyl or cyano.

[0068] General Method A-6-n

[0069]

[0070] wherein R is a C4-C6 cycloalkyl group, one of the carbon atoms of which may be substituted by a N, O, or S heteroatom; or wherein q is 0 or 1 or 2 or 3 or 4, Z and Z1 are N or CR2 respectively, and R2 is selected from H, halogen, C1-C4 alkyl or cyano.

[0071] Intermediate synthesis

[0072] Intermediate Ⅰ-3: 1H-pyrrolo[2,3-c]pyridin-5-ol

[0073] Synthesis route:

[0074]

[0075] Step 1: Intermediate 1H-pyrrolo[2,3-c]pyridine-5-diazo Ⅰ-2

[0076] To 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (66.6 mg, 0.5 mmol) was added water (2 mL) and 20% H2SO4 aqueous solution (1 mL). Under ice cooling, a sodium nitrite aqueous solution (42 mg, 0.6 mmol) solution (0.5 mL) and acetonitrile (2 mL) were added to the mixture, and the mixture was stirred for 30 minutes. To the obtained reaction mixture was added a solution of Cu2SO4 (67 mg, 0.3 mmol) in a 20% HBr aqueous solution (0.5 mL) at room temperature, and the mixture was stirred at 80 ° C for 30 minutes. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, rinsed with brine, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol=50:1) to give 1H-pyrrolo[2,3-c]pyridine-5-diazonium Ⅰ-2-hydrogen sulfate (94 mg, 78%), liquid chromatography-mass spectrometry m / z=145.1[M]+.

[0077] Step 2: Intermediate 1H-pyrrolo[2,3-c]pyridin-5-ol Ⅰ-3

[0078] A solution (1 mL) of the hydrogen sulfate salt of the above-mentioned 1H-pyrrolo[2,3-c]pyridine-5-diazonium I-2 (48 mg, 0.2 mmol) was added dropwise to a 40% aqueous sulfuric acid solution (5 mL) at 100°C, and the mixture was stirred for 10 minutes. NaOH was added to the resulting reaction mixture until the pH reached approximately 3. Ethyl acetate was added to the reaction mixture, and the organic layer was separated, washed with brine, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol = 50:1) to afford 1H-pyrrolo[2,3-c]pyridin-5-ol I-3 (20 mg, 77%). The liquid chromatography mass spectrum indicated m / z = 135.1 [M+H]+.

[0079] Example 1: ((1H-pyrrolo[2,3-c]pyridin-5-yl)oxy)methyl)benzonitrile A-1-1

[0080]

[0081] Steps: 1H-pyrrolo[2,3-c]pyridin-5-ol I-3 (10 mg, 0.07 mmol) was mixed with 3-(bromomethyl)benzonitrile (20 mg, 0.1 mmol) and K2CO3 (138 mg, 1 mmol), acetonitrile (2 mL) was added, and the mixture was heated to 40°C and stirred for 10 minutes. Ethyl acetate and water were added to the reaction mixture, the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:methanol=40:1) to give 3-((1H-pyrrolo[2,3-c]pyridin-5-yl)oxy)methyl)benzonitrile A-1-1 (11 mg, 63%), liquid chromatography mass spectrum m / z=250.1 [M+H]+

[0082] Example 2: 5-phenylethoxy-1H-pyrrolo[2,3-c]pyridine A-1-2

[0083]

[0084] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-ol I-3 (10 mg, 0.07 mmol) was mixed with (2-bromoethyl)benzene (22 mg, 0.12 mmol) and K2CO3 (138 mg, 1 mmol). Acetonitrile (2 mL) was added and the mixture was heated to 40°C and stirred for 10 minutes. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:methanol = 40:1) to afford 5-phenylethoxy-1H-pyrrolo[2,3-c]pyridine A-1-2 (13 mg, 78%). LC-MS / MS: m / z = 239.1 [M+H]+.

[0085] Example 3: (1H-pyrrolo[2,3-c]pyridin-5-yl)isoindol-1-one A-2

[0086]

[0087] Synthesis route:

[0088]

[0089] Procedure: Combine 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) and 2-formylbenzoic acid (18 mg, 0.12 mmol). Add formic acid (0.2 mL), triethylamine (1 mL), and ethanol (1 mL). Heat the mixture to 80°C and stir for 60 minutes. Add ethyl acetate and water to the reaction mixture, separate the organic layer, dry it over sodium sulfate, and concentrate under reduced pressure. The residue is purified by silica gel column chromatography (dichloromethane:ethyl acetate = 20:1) to afford (1H-pyrrolo[2,3-c]pyridin-5-yl)isoindol-1-one A-2 (15 mg, 60%). LC-MS / MS: m / z = 250.3 [M+H].

[0090] Example 4: (1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-3-carboxamide A-3-1

[0091]

[0092] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with thiophene-2-carboxylic acid (15 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7) to afford N-(1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-3-carboxamide A-3-1 (10 mg, 41%), with a liquid chromatography mass spectrum of m / z = 244.1 [M+H].

[0093] Example 5: (E)-2-methyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)but-2-enamide A-3-2

[0094]

[0095] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with (E)-2-methyl-2-enoic acid (12 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane=3:7) to give (E)-2-methyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)but-2-enamide A-3-2 (11 mg, 51%), liquid chromatography-mass spectrometry m / z=216.1 [M+H]+.

[0096] Example 6: N-(1H-pyrrolo[2,3-c]pyridin-5-yl)-2,3-dihydrobenzofuran-2-carboxamide A-3-3

[0097]

[0098] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with benzofuran-2-carboxylic acid (19 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3:7) to give N-(1H-pyrrolo[2,3-c]pyridin-5-yl)-2,3-dihydrobenzofuran-2-carboxamide A-3-3 (13 mg, 46%), liquid chromatography-mass spectrum m / z = 280.1 [M+H] +.

[0099] Example 7: 3,4-dichloro-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzamide A-3-4

[0100]

[0101] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with 3,4-dichlorobenzoic acid (23 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3:7) to give 3,4-dichloro-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzamide A-3-4 (13 mg, 43%), LC-MS m / z = 306.0 [M+H] +.

[0102] Example 8: N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzothiophene-2-carboxamide A-3-5

[0103]

[0104] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with benzothiophene-2-carboxylic acid (21 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3:7) to give N-(1H-pyrrolo[2,3-c]pyridin-5-yl)benzothiophene-2-carboxamide A-3-5 (14 mg, 48%), liquid chromatography-mass spectrometry m / z = 294.1 [M+H] +.

[0105] Example 9: 2-phenyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)acetamide A-3-6

[0106]

[0107] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with 2-phenylacetic acid (16 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7) to afford 2-phenyl-N-(1H-pyrrolo[2,3-c]pyridin-5-yl)acetamide A-3-6 (12 mg, 48%), with a liquid chromatography mass spectrum of m / z = 252.1 [M+H].

[0108] Example 10: 1-(1H-pyrrolo[2,3-c]pyridin-5-yl)-3-(p-tolyl)urea A-4-1

[0109]

[0110] Step 1: p-Nitrophenyl p-tolueneaminocarbonate I-9-1

[0111]

[0112] p-Toluidine (21 mg, 0.2 mmol) was mixed with 4-nitrophenylcarbonyl chloride (48 mg, 0.24 mmol), and triethanolamine (0.2 mL), dichloromethane (1 mL), and tetrahydrofuran (2 mL) were added. The mixture was stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:hexane = 5:1) to afford p-nitrophenyl p-toluenecarboxamidocarbonate I-9-1 (42 mg, 77%). LC-MS / MS: m / z = 273.1 [M+H]+.

[0113] Step 2: 1-(1H-pyrrolo[2,3-c]pyridin-5-yl)-3-(p-tolyl)urea A-4-1

[0114] The above-mentioned p-nitrophenyl p-toluenecarbamate I-9-1 (27 mg, 0.1 mmol) was mixed with 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (16 mg, 0.12 mmol) and K2CO3 (0.2 g, 1.45 mmol), acetonitrile (3 mL) was added and heated to 40 ° C. and stirred for 4 hours. After the reaction was completed (monitored by TLC), the reaction mixture was separated and concentrated in vacuo. The crude reaction mixture thus obtained was washed with dichloromethane, then with EtOAc, and finally with MeOH (1 mL each). Finally, the reaction product was recrystallized using EtOAc (under warm conditions) to obtain pure 1-(1H-pyrrolo[2,3-c]pyridin-5-yl)-3-(p-tolyl)urea A-4-1 (22 mg, 83%), liquid phase mass spectrum m / z=267.1[M+H]+.

[0115] Example 11: 1-(3-bromophenyl)-3-(1H-pyrrolo[2,3-c]pyridin-5-yl)urea A-4-2

[0116]

[0117] Step 1: 4-nitrophenyl (3-bromophenyl) aminocarbonate I-9-2

[0118]

[0119] 3-Bromoaniline (34 mg, 0.2 mmol) was mixed with 4-nitrophenylcarbonyl chloride (48 mg, 0.24 mmol), and triethanolamine (0.2 mL), dichloromethane (1 mL), and tetrahydrofuran (2 mL) were added. The mixture was stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane:hexane = 5:1) to afford 4-nitrophenyl (3-bromophenyl)carbamate I-9-2 (46 mg, 68%). LC-MS / MS: m / z = 338.1 [M+H]+.

[0120] Step 2: 1-(3-bromophenyl)-3-(1H-pyrrolo[2,3-c]pyridin-5-yl)urea A-4-2

[0121] The above-mentioned 4-nitrophenyl (3-bromophenyl) aminocarbonate I-9-2 (34 mg, 0.1 mmol) was mixed with 1H-pyrrolo [2,3-c] pyridine -5- amine I-1 (16 mg, 0.12 mmol) and K2CO3 (0.2 g, 1.45 mmol), acetonitrile (3 mL) was added and heated to 40 ° C and stirred for 4 hours. After the reaction was completed (monitored by TLC), the reaction mixture was separated and concentrated in a vacuum. The crude reaction mixture thus obtained was washed with dichloromethane, then washed with EtOAc, and finally washed with MeOH (each 1 mL). Finally, the reaction product was recrystallized using EtOAc (under warm conditions) to obtain pure 1- (3-bromophenyl) -3- (1H-pyrrolo [2,3-c] pyridine -5- bases) urea A-4-2 (25 mg, 75%), liquid phase mass spectrum m / z = 331.2 [M + H] +.

[0122] Example 12: N-methyl-N-phenyl-1H-pyrrolo[2,3-c]pyridine-5-carboxamide A-5

[0123]

[0124] Synthesis line:

[0125]

[0126] Step 1: 5-Nitro-1H-pyrrolo[2,3-c]pyridine Ⅰ-10

[0127]

[0128] To a solution of H₂O₂ (240 mg, 2.2 mmol) in fuming sulfuric acid (500 μL) was added dropwise a solution of 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (40 mg, 0.3 mmol) in concentrated sulfuric acid (100 μL), maintaining the reaction temperature at 0°C. After stirring at 10-25°C for 3 h, the reaction mixture was brought to pH 11-12 by the addition of 40% aqueous NaOH at 0-5°C. The resulting mixture was extracted with ethyl acetate. The combined organic layers were washed with saturated aqueous sodium chloride, dried over Na₂SO₄, and filtered. The solvent was removed by distillation under reduced pressure to yield the desired 5-nitro-1H-pyrrolo[2,3-c]pyridine I-10 (39 mg, 80%), LC-MS m / z = 164.0 [M+H]⁺.

[0129] Step 2: 1H-pyrrolo[2,3-c]pyridine-5-carboxylic acid Ⅰ-11

[0130]

[0131] The above-mentioned 5-nitro-1H-pyrrolo[2,3-c]pyridine I-10 (39 mg, 0.24 mmol) was mixed with KCN (195 mg, 3 mmol), and 1-butylimidazole tetrafluoroborate (3 mg, 0.014 mmol), EtOH (2 mL), and water (2 mL) were added. The mixture was heated to 80°C and stirred for 19 hours. Then, 10 mL of water was added, and the mixture was extracted with CH2Cl2 (3 × 5 mL) and diethyl ether (3 × 10 mL). The mixture was acidified with hydrochloric acid to pH 1-2 and extracted with diethyl ether (3 × 10 mL). Magnesium sulfate (3 g) and activated carbon (1 g) were added and stirred for 5 hours. The solid was filtered, the filtrate was evaporated, and the residue was crystallized from the corresponding solvent to obtain the desired 1H-pyrrolo[2,3-c]pyridine-5-carboxylic acid I-11 (16 mg, 41%), LC-MS m / z = 163.0 [M+H]+.

[0132] Step 3: N-Methyl-N-phenyl-1H-pyrrolo[2,3-c]pyridine-5-carboxamide A-5

[0133] The above-mentioned 1H-pyrrolo[2,3-c]pyridine-5-carboxylic acid I-11 (16 mg, 0.1 mmol) was mixed with N-methylaniline (13 mg, 0.12 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (38 mg, 0.1 mmol). N,N-diisopropylethylamine (0.2 mL) and N,N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7), and the solvent was evaporated under reduced pressure to obtain N-methyl-N-phenyl-1H-pyrrolo[2,3-c]pyridine-5-carboxamide A-5 (18 mg, 72%). The liquid chromatography mass spectrum was m / z = 252.1 [M+H]+.

[0134] Example 13: N-(tetrahydro-2H-pyran-4-yl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-1

[0135]

[0136] 1H-pyrrolo[2,3-c]pyridine-5-amine I-1 (13mg, 0.1mmol) is mixed with tetrahydro-4H-pyran-4-one (12mg, 0.12mmol), methanol (2mL) is added, stirred at room temperature for 2 hours, then sodium cyanoborohydride (20mg, 0.3mmol) is added, stirred at room temperature for 2 hours. Then NaOH aqueous solution (10mL, 0.3mol / L) is added to the mixture. The resulting mixture is extracted with DCM (20mL x 3). The combined organic phase is dried over anhydrous Na2SO4, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5:1), and the solvent was distilled off under reduced pressure to give N-(tetrahydro-2H-pyran-4-yl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-1 (18 mg, 83%), liquid chromatography-mass spectrum m / z = 218.1 [M+H] +.

[0137] Example 14: N-(Pyridin-4-ylmethyl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-2

[0138]

[0139] 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with isonicotinaldehyde (13 mg, 0.12 mmol), methanol (2 mL) was added, and the mixture was stirred at room temperature for 2 hours. Then, sodium cyanoborohydride (20 mg, 0.3 mmol) was added and stirred at room temperature for 2 hours. Aqueous NaOH (10 mL, 0.3 mol / L) was then added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate = 5:1), and the solvent was removed by distillation under reduced pressure to yield N-(pyridin-4-ylmethyl)-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-2 (16 mg, 71%), with a liquid chromatography mass spectrum of m / z = 225.1 [M+H].

[0140] Example 15: N-cyclobutyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-3

[0141]

[0142] 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with cyclobutanone (8 mg, 0.12 mmol), methanol (2 mL) was added, and the mixture was stirred at room temperature for 2 hours. Then, sodium cyanoborohydride (20 mg, 0.3 mmol) was added and stirred at room temperature for 2 hours. Aqueous NaOH (10 mL, 0.3 mol / L) was then added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate = 5:1), and the solvent was removed by distillation under reduced pressure to yield N-cyclobutyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-6-3 (15 mg, 80%), with a liquid chromatography mass spectrum of m / z = 188.1 [M+H].

[0143] Example 16: 2-(1H-pyrrolo[2,3-c]pyridin-5-yl)isoindole-1,3-dione A-7

[0144]

[0145] Synthesis route:

[0146]

[0147] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with isobenzofuran-1,3-dione (18 mg, 0.12 mmol). N,N-dimethylacetamide (2 mL) was added and the mixture was stirred at room temperature for 24 hours. Xylene (1 mL) was then added and the mixture was stirred in an oil bath at 140°C for 48 hours. After completion (monitored by TLC), the insoluble catalyst was separated by filtration, washed with acetone, and dried. The organic layer was concentrated under reduced pressure to yield the desired product, which was then washed with water and recrystallized from ethanol. The crude product was purified by silica gel column chromatography (CH2Cl2 / n-hexane = 1:1). The solvent was then removed by distillation under reduced pressure to yield 2-(1H-pyrrolo[2,3-c]pyridin-5-yl)isoindole-1,3-dione A-7 (20 mg, 76%), with a liquid chromatography mass spectrum of m / z = 264.1 [M+H]+.

[0148] Example 17: N-phenyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-8

[0149]

[0150] Synthesis route:

[0151]

[0152] Steps: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with iodobenzene (24 mg, 0.12 mmol), (N,N-bipyridyl imidazole) copper dibromide (10 mg, 0.023 mmol), and cesium carbonate (100 mg, 0.3 mmol). 1,4-dioxane (5 mL) was added and stirred in an oil bath at 170 ° C for 12 hours. Then, aqueous NaOH solution (10 mL, 0.3 mol / L) was added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5:1), and the solvent was removed by distillation under reduced pressure to give N-phenyl-1H-pyrrolo[2,3-c]pyridin-5-amine A-8 (19 mg, 91%), liquid chromatography-mass spectrometry m / z = 210.1 [M+H] +.

[0153] Example 18: (E)-5-phenylvinyl-1H-pyrrolo[2,3-c]pyridine A-9

[0154]

[0155] Synthesis route:

[0156]

[0157] Steps: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with styrene (13 mg, 0.12 mmol), bis(dibenzylideneacetone)-palladium(0) (5 mg, 0.0087 mmol), tert-butyl nitrosoate (0.5 mL), chloroacetic acid (0.5 mL), acetic acid (3 mL) and stirred in an oil bath at 50 ° C for 2 hours. Then, aqueous NaOH solution (10 mL, 0.3 mol / L) was added to the mixture. The resulting mixture was extracted with DCM (20 mL x 3). The combined organic phases were dried over anhydrous Na2SO4, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5:1), and the solvent was removed by distillation under reduced pressure to give (E)-5-phenylvinyl-1H-pyrrolo[2,3-c]pyridine A-9 (15 mg, 68%), liquid chromatography-mass spectrometry m / z = 221.1 [M+H] +.

[0158] Example 19: N-(1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-2-sulfonamide A-10

[0159]

[0160] Synthesis route:

[0161]

[0162] Procedure: 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (13 mg, 0.1 mmol) was mixed with thiophene-2-sulfonyl chloride (22 mg, 0.12 mmol), triethylamine (0.5 mL) and dichloromethane (3 mL) were added, and the mixture was stirred at room temperature under nitrogen for 24 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7), and the solvent was removed by distillation under reduced pressure to obtain N-(1H-pyrrolo[2,3-c]pyridin-5-yl)thiophene-2-sulfonamide A-10 (14 mg, 50%). LC-MS / MS: m / z = 280.0 [M+H]+.

[0163] Example 20: N-(2-((1H-pyrrolo[2,3-c]pyridin-5-yl)amino)ethyl)methanesulfonamide A-11

[0164]

[0165] Synthesis route:

[0166]

[0167] Step 1: N1-(1H-pyrrolo[2,3-c]pyridin-5-yl)ethane-1,2-diamine I-19

[0168]

[0169] 1H-pyrrolo[2,3-c]pyridin-5-amine I-1 (26 mg, 0.2 mmol) and 2-bromoethane-1-amine I-18 (29 mg, 0.24 mmol) were mixed, water (5 mL) was added, and the mixture was stirred in an oil bath at 95°C for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The mixture was purified by flash chromatography on silica gel (CH2Cl2methanol-ammonia water) to obtain the desired product. The solvent was removed by distillation under reduced pressure to obtain N1-(1H-pyrrolo[2,3-c]pyridin-5-yl)ethane-1,2-diamine I-19 (24 mg, 68%), with a liquid chromatography mass spectrum of m / z = 177.1 [M+H]+.

[0170] Step 2: N-(2-((1H-pyrrolo[2,3-c]pyridin-5-yl)amino)ethyl)methanesulfonamide A-11

[0171] The above-mentioned N-(1H-pyrrolo[2,3-c]pyridin-5-yl)ethane-1,2-diamine I-19 (24 mg, 0.13 mmol) was mixed with methanesulfonyl chloride I-20 (28 mg, 0.16 mmol), dichloromethane (5 mL) was added, and the mixture was stirred in an ice-water bath for 24 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate:hexane = 3:7), and the solvent was evaporated under reduced pressure to obtain N-(2-((1H-pyrrolo[2,3-c]pyridin-5-yl)amino)ethyl)methanesulfonamide A-11 (12 mg, 36%). The liquid chromatography-mass spectra indicated a m / z of 255.1 [M+H]+.

[0172] Example 21: The present invention uses two compound prediction methods to predict pyrrolopyridine derivatives, and the methods are as follows:

[0173] Method 1: Protein structure docking prediction

[0174] The pyrrolopyridine derivative molecules in Examples 1-20 were molecularly docked with the Oct4 target protein using AutoDock Vina and LeDock software, respectively, to produce 10 docking conformations. The binding energy and ligand efficiency of the optimal docking result of each pyrrolopyridine molecule and the Oct4 target protein were calculated, and the docking results were comprehensively analyzed for pyrrolopyridine molecule screening. The specific docking results are shown in Table 1: The second and third columns of the table are the binding free energies (binding energy) calculated by autodock vina and LeDock molecular docking software, respectively. The more negative the value, the stronger the binding ability of the small molecule ligand to the target protein. The fourth column of the table represents the ligand efficiency (ligand efficiency) calculated by LeDock. The greater the absolute value, the stronger the potential for small molecule activity. In the present invention, according to the independent algorithms of the two software, the binding energy level of the compound of the present invention is predicted. The predicted value shows that the binding energy of the compound in the present invention is much greater than the threshold value 3 set according to the target feature of the present invention.

[0175] Table 1. Prediction of binding energy between pyrrolopyridine derivative molecules used in the present invention and target sequences

[0176]

[0177]

[0178] Method 2: mir-RNA structure docking prediction:

[0179] The affinity of miR-145 for small molecules was predicted using a new computational tool, RLDOCK software. RLDOCK is a physical deformation-based model for predicting ligand-RNA binding ability. It employs a novel global multi-step search algorithm for binding sites, optimizing search efficiency and stability, enabling the algorithm to effectively predict unknown binding sites. During the RLDOCK multi-step calculation, a comprehensive scan of possible binding sites on the miR-145 structure and the possible binding poses of small molecules at these sites is performed. All binding possibilities are then scored and ranked using the minimum Lennard-Jones potential energy scoring function. The results are shown in Table 2. The score is a negative value; the larger the absolute value, the stronger the ligand-RNA affinity. RLDOCK's final score is the sum of the values ​​of the different energy functions it employs. Currently, the number of validated and available RNA targets is limited, and there is no mature computational system capable of distinguishing the threshold for actual interactions. This method prioritizes the validation of high-ranking molecules based on predicted binding energies.

[0180] Table 2: Prediction of binding energy of pyrrolopyridine derivatives with target mir-RNA

[0181]

[0182]

[0183] Through Oct4 protein structure docking prediction and mir-145 structure docking prediction, it was found that pyrrolopyridine derivatives showed large binding energy in both structure docking predictions. Therefore, it was speculated that pyrrolopyridine derivatives have the ability to enhance the expression of Oct4. Therefore, isothermal titration calorimetry and cytological experiments were used to verify the expression-enhancing effect of pyrrolopyridine derivatives on Oct4, thereby verifying the role of pyrrolopyridine derivatives as highly selective activators of Oct4.

[0184] Example 22: Verification of the interaction between small molecule compounds and target nucleic acids using isothermal titration calorimetry

[0185] Isothermal titration calorimetry (ITC) utilizes the principle of power compensation. Using a single concentration scan, it accurately measures the enthalpy change of intermolecular interactions across a wide range of concentrations. This measurement of the heat change during binding provides a complete thermodynamic profile of the nucleic acid-ligand interaction. Quantifying the thermodynamic characteristics and energy of the complex is the molecular basis for analyzing the interaction between the micronucleic acid miR-145 and compounds. This study employed a Waters Nano-ITC titration calorimeter to validate nucleic acid-small molecule interactions in vitro. The experimental procedure involved placing a 300 μL, 50 μM solution of single-chain miR-145 in a temperature-controlled sample cell, coupled to an equal volume of deionized water in a reference cell via a thermocouple loop. For example, using the small molecule A-3-6 as an example, a 50 μL, 500 μM concentration of the small molecule was placed in a syringe as a ligand. The heat change in the sample cell was measured and then equilibrated with the reference cell, resulting in a peak of endothermic or exothermic heat. By fitting the interaction pattern of the two reactants using the software provided by the instrument, the reaction binding enthalpy (ΔH), constant pressure heat capacity (ΔCp), number of binding sites (n), and binding equilibrium constant (Ka) between two or more molecules in the solution can be directly calculated, and kinetic data can be obtained through comprehensive calculation. Figure 1 The upper part shows the heat change of the sample pool, where the red peak line is the exotherm of miR-145 binding to A-3-6, and the blue line is the exotherm of the buffer without miR-145 binding to A-3-6. Figure 1 The peak area fit of the Multiple Sites model curve shows that the calculated nSite values ​​of 3 and 1.8 correspond to Kd(M) values ​​of 7.017E-8 and 7.544E-9, respectively. The Kd(M) value for the blank control group was 1.000E-3. The ITC test results demonstrate that the small molecule obtained in this invention can specifically bind to the target.

[0186] Example 23: Verification of MET cell morphological changes induced by small molecule compounds

[0187] Human mesenchymal cells were cultured in T25 medium at a rate of 4 x 10 5 Cells were inoculated and cultured in serum-free Dulbecco's modified Eagle's medium (DMEM-F12 medium), to which 20 μM of the above-mentioned pyrrolopyridine derivative small molecules were added. The culture conditions were 37° C. and 5% carbon dioxide. Figure 2 Compared with the control group without the addition of pyrrolopyridine derivatives, the MET phenomenon occurred after 24 hours of treatment with pyrrolopyridine derivatives alone, and the cells took on a typical epithelial morphology. This result morphologically proves that pyrrolopyridine derivatives can rapidly induce the transformation of mesenchymal cells into epithelial cells.

[0188] Example 24: Verification of transcriptional expression differences caused by small molecules

[0189] The present invention aims to achieve MET transformation using specific compounds. A key function of these activators is to enhance the expression of MET deformation. Previous literature reports have demonstrated that pyrrolopyridines and their derivatives can induce MET in mice, using the KRT family of structural proteins that bind to MET and the MSX family of regulatory genes as indicators for validation of the small molecule's function. Increased expression of genes downstream of the Oct4 gene is also a functional validation indicator for the compounds of the present invention. The present invention further validates the Oct4 activation function of pyrrolopyridines and their derivatives using the expression of Nanog, an early reprogramming gene.

[0190] Human mesenchymal cells were cultured in T25 medium at a rate of 4 x 10 5 The cells were inoculated and cultured in serum-free Dulbecco's modified Eagle's medium (DMEM-F12 medium), to which 50 nM of the above-mentioned pyrrolopyridine derivative small molecules were added, and the culture conditions were 37°C and 5% carbon dioxide. On the third day, total RNA was extracted using RNeasy Mini or Micro Kit (QIAGEN), and 1 mg of RNA was synthesized into cDNA using SuperScript III First-Strand Synthesis System (Invitrogen). Quantitative PCR was labeled and reacted using SYBR Premix Ex Taq (TaKaRa) and Thermal Cycler Dice Real Time System (TaKaRa), and beta-Actin was used as an internal reference. All data were analyzed using the delta-Ct method. Each group of experiments was repeated in three groups, and variance statistics were performed. The primer sequences used to identify the coding genes of different cell markers are shown in Table 3. The results are shown as follows, Figure 3 It was shown that the above pyrrolopyridine derivative small molecules significantly increased the expression of genes such as Oct4 compared with the control group without small molecules;

[0191] Table 3. QPCR primer sequences for compound-responsive genes

[0192] Oct4-F CCATGCATTCAAACTGAGGT Oct4-R CCTTTGTGTTCCCAATTCCTT Nanog-F ACCTCAGCTACAAACAGGTGAA Nanog-R AAAGGCTGGGGTAGGTAGGT KRT8-F CAGAAGTCCTACAAGGTGTCCA KRT8-R CTCTGGTTGACCGTAACTGCG KRT18-F TCGCAAATACTGTGGACAATGC KRT18-R GCAGTCGTGTGATATTGGTGT KRT19-F ACCAAGTTTGAGACGGAACAG KRT19-R CCCTCAGCGTACTGATTTCCT MSX1-F AGAAGATGCGCTCGTCAAA MSX1-R GGCTTACGGTTCGTCTTGT βActin-F GGCCGAGGACTTTGATTGCACA βActin-R GGGCACGAAGGCTCATCATTCAA

Claims

1. An inducer for transforming mesenchymal cells into epithelial cells, characterized in that The inducer comprises one of the following compounds or a pharmaceutically acceptable salt thereof:

2. A pharmaceutical composition comprising: the inducer according to claim 1, and at least one pharmaceutically acceptable excipient.

3. Use of the inducer according to claim 1 in reprogramming to obtain cell pluripotency.

Images