A method for generating medium spiny neurons

Abstract

The present invention relates to the field of biotechnology, and more specifically, to a method for inducing NPCs to become MSNs. The method for generating MSNs comprises expressing in NPCs one or several combinations of the following exogenous transcription factors or sgRNAs: ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2; wherein, one of the ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2 also includes homologs, analogs or variants thereof. After in vitro and in vivo verification, the method of the present invention can observe neuronal morphology in as short as 4-5 days, obtain neurons with multiple dendrites in about 14 days, and obtain more mature MSNs in about 21 days, wherein DARPP32 + and GAD2 + MSN can reach more than 95%.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a method for inducing NPCs to become MSNs. Background Art

[0002] Human pluripotent stem cells (hPSCs; including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs)) are important models for studying various human genetic diseases, including neurodegenerative diseases. Neural progenitor cells (NPCs) derived from hPSCs can further differentiate into neurons and glial cells, playing a broad and important role in studying the pathogenesis of neurodegenerative diseases, screening disease markers, drug screening, and cell transplantation therapy.

[0003] Huntington's disease (HD) is a hereditary neurodegenerative disorder characterized by progressive movement disorders, psychiatric symptoms, and cognitive impairment. Loss of γ-aminobutyric acid (GABA)-ergic medium spiny neurons (MSNs) in the striatum is a key pathological hallmark of HD. Therefore, cell transplantation using human pluripotent stem (hPSC)-derived NPCs or MSNs is a promising HD treatment strategy and provides an important cell model and platform for elucidating new HD pathological mechanisms. The primary goal of HD treatment based on hPSCs and their neural differentiation is to replenish the patient's lost MSNs, thereby alleviating the clinical manifestations associated with neuronal dysfunction and death.

[0004] General strategies for differentiating hPSCs into neurons: The in vitro differentiation of hPSCs into neurons generally follows a multi-step process of neuronal development in vivo: i) induction of neural lineages; ii) NPC differentiation; iii) specific differentiation of mature neuronal subtypes. Therefore, various transcription factors, cytokines or small molecule compounds (including antagonists or agonists) that play an important role in neural development are also used to induce hPSCs to differentiate into specific neural phenotypes in vitro. For example, the addition of sonic hedgehog (SHH), valproic acid (VPA), cAMP and ascorbic acid (L-AA) can effectively induce hESCs to differentiate into functionally mature MSNs. During the neural induction and differentiation process of hPSCs, the time point, duration and concentration of cytokine or small molecule compound treatment are critical for obtaining specific neuronal subtypes. For example, short-term treatment with SHH can efficiently induce ESC-derived NPCs to differentiate into dopaminergic neurons. The addition of low concentrations of SHH can induce ESCs to differentiate into NESTIN + NPCs are then differentiated into TH by the introduction of the transcription factor LMX1A. +Dopaminergic neurons. Adding transcription factors, cytokines, or small molecule compounds at the appropriate time and concentration window provides an important theoretical basis for effectively promoting hPSC differentiation into MSNs.

[0005] Currently, there are two main methods for obtaining MSN:

[0006] The first type is induced by somatic cells such as skin fibroblasts or hPSCs to transdifferentiate or differentiate into MSNs through cytokines and small molecule compounds. The second type is induced by hPSCs to become MSNs through transcription factors. The existing combination of transcription factors to induce hPSCs to become MSNs is NOLZ1 (ZNF503) / ISL1, GSX2 / EBF1 and other transcription factor combinations, but the differentiation time is long, generally more than 45 days, and the efficiency of inducing MSN generation is low, generally not higher than 50%. In 2017, it was reported that hPSCs were infected with transcription factors GSX2 and EBF1 in sequence, and CTIP2 was used on the 60th day. + The cells expressed 42.9% DARPP32 at day 80 of differentiation. + / CTIP2 + The neuronal expression efficiency is 38.8%, but the differentiation time is long, the differentiation efficiency is low, and the obtained neurons are impure.

[0007] There are also a large number of research reports on the use of transcription factors to directly transdifferentiate somatic cells into neurons. For example, the earliest research reports showed that infecting mouse fibroblasts with transcription factors (ASCL1, MYT1L and BRN2) can produce functional neurons, such as expressing synaptic markers and generating action potentials. Similarly, ASCL1, BRN2 and MYT1L transcription factors can also be used to directly transdifferentiate into functional neurons in human fibroblasts. Transcription factors are also used for the direct transdifferentiation or differentiation of different subtypes of neurons. For example, in 2014, co-expression of miR-9 / 9*-124 with transcription factors CTIP2, DLX1, DLX2 and MYT1L, which are enriched in the developing striatum, can induce human fibroblasts to transform into DARPP32 in about 4 weeks. + MSN (77%), but its conversion time is long and the efficiency is average.

[0008] In summary, the current methods for differentiating hPSCs into MSNs still have some shortcomings, including low differentiation efficiency, long time consumption, and impure neurons. Since hPSC neural differentiation can provide important cell models and cell platforms for the study of neurodegenerative diseases including HD, obtaining high-yield and pure neurons, including MSNs, is crucial. In addition, NPCs generated by hPSC differentiation basically have forebrain characteristics, and therefore basically spontaneously differentiate into most excitatory and inhibitory neurons, but rarely differentiate into neuronal subtypes specifically associated with neurodegenerative disease damage, such as HD MSNs. Therefore, it is necessary to develop and improve the technology of MSN neuronal differentiation to improve differentiation efficiency and neuronal purity. Summary of the Invention

[0009] The purpose of the present invention is to provide a method for efficiently and rapidly inducing the generation of MSNs from hPSC-derived NPCs. Compared with traditional protocols, the time required for differentiation into functional MSNs is reduced, the resulting MSNs are of higher purity, and the yield is increased. This is conducive to conducting a wide range of disease simulation and mechanism studies, as well as related experiments requiring large numbers of cell samples, such as mass spectrometry analysis, immunoprecipitation, next-generation sequencing, and functional studies related to cell transplantation.

[0010] To achieve the above object, the present invention provides the following technical solutions:

[0011] A method for generating MSNs, comprising expressing (including recombinant expression or overexpression) exogenous transcription factors or sgRNAs in NPCs: one or a combination of ASCL1, NGN2, miR-9 / 124, sgPTBP1 (sgRNA), CTIP2, DLX1 and DLX2; wherein one of ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2 also includes homologs, analogs or variants thereof.

[0012] Preferably, the transcription factor or sgRNA is a combination of three of ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2.

[0013] Preferably, the transcription factor is a combination of three of ASCL1, NGN2, CTIP2, DLX1 and DLX2.

[0014] Preferably, the transcription factor is a combination of ASCL1, CTIP2, and DLX1, a combination of ASCL1, CTIP2, and DLX2, a combination of NGN2, CTIP2, and DLX1, or a combination of NGN2, CTIP2, and DLX2.

[0015] The above four groups of compositions are all obtained by combining them in a ratio of 1:1:1.

[0016] Preferably, the NPCs are derived from hPSCs differentiated by SMAD dual inhibition induction.

[0017] Preferably, the method for expressing the following exogenous transcription factors in NPCs is: (a) providing cells; (b) transferring the transcription factors into the cells of (a) using an expression vector, or transferring the transcription factors into the cells of (a) by protein transfection; (c) culturing the cells obtained in (b).

[0018] Preferably, the expression vector is a viral vector or a non-viral vector, including a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a retroviral vector or a non-viral plasmid.

[0019] In another aspect of the present invention, provided is an MSN or a culture thereof, which is obtained by the above-described method.

[0020] Preferably, the MSN has one or more of the following properties: 1) expressing MSN marker molecules DARPP32, GAD1, and GAD2; 2) possessing the basic electrophysiological characteristics of neurons, including: membrane impedance, resting membrane potential, the ability to generate action potentials under depolarization stimulation, and the ability to record sodium currents generated by the opening of sodium channels, and the ability to receive input from other cells and generate output; 3) being able to establish synaptic connections with target cells or target organs and control their activities.

[0021] In another aspect of the present invention, the use of the MSN or its culture is provided for: preparing drugs for preventing, improving or treating nervous system diseases (mainly including neurodegenerative diseases such as HD); or as an in vitro model for simulating nervous system diseases and screening drugs therefor; or preparing compositions for in vivo cell transplantation.

[0022] Preferably, the research on nervous system diseases and drugs thereof includes: research on drug transport, drug metabolism, nervous system formation; or neuronal toxicity testing, screening of neuronal toxic substances, and screening of substances that regulate neuronal function.

[0023] In another aspect of the present invention, a composition is provided, comprising: the MSN or a culture thereof, and a pharmaceutically acceptable carrier.

[0024] In another aspect of the present invention, a transcription factor combination for producing MSN is provided; comprising one or more of the following transcription factors or sgRNAs: ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2; wherein one of ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2 further comprises a homolog, analog or variant thereof.

[0025] Preferably, the transcription factor or sgRNA is a combination of three of ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2.

[0026] Preferably, the transcription factor is a combination of three of ASCL1, NGN2, CTIP2, DLX1 and DLX2.

[0027] Preferably, the transcription factor is a combination of ASCL1, CTIP2, and DLX1, a combination of ASCL1, CTIP2, and DLX2, a combination of NGN2, CTIP2, and DLX1, or a combination of NGN2, CTIP2, and DLX2.

[0028] In another aspect of the present invention, the use of the transcription factor combination is provided for introducing NPCs to induce them into MSNs.

[0029] In another aspect of the present invention, a kit for preparing MSN is provided, comprising a transcription factor or a gene encoding the transcription factor, an expression cassette or an expression vector;

[0030] The transcription factor or sgRNA includes: one or more of ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2; wherein, one of ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1 and DLX2 also includes a homolog, analog or variant thereof.

[0031] Preferably, the transcription factors included in the kit are: a combination of ASCL1, CTIP2, and DLX1, a combination of ASCL1, CTIP2, and DLX2, a combination of NGN2, CTIP2, and DLX1, or a combination of NGN2, CTIP2, and DLX2.

[0032] Preferably, the kit further contains one or more selected from the following: cells for overexpressing transcription factors or their homologs, analogs or variants; expression vectors expressing transcription factors or their homologs, analogs or variants; transformation or transfection reagents; cell culture medium; growth factors or additives, including: N2, B27, BDNF, GDNF or Forskolin (FSK), L-AA.

[0033] Preferably, the cell culture medium includes but is not limited to: DMEM, Neurobasal; preferably, the DMEM is selected from: DMEM / F12, Advanced DMEM / F12.

[0034] The present invention will be further explained below:

[0035] The present invention uses four neurotrophic factors (ASCL1, NGN2, miR-9 / 124, and sgPTBP1) and clones them into lentiviral vectors. These are then transfected into 293T cells along with a lentiviral packaging system. Viral fluids are collected after 48 and 72 hours and then transfected into NPCs. Experimental results confirm that ASCL1 and NGN2 are more potent in inducing neuronal differentiation.

[0036] Since the neurons induced by the two transcription factors ASCL1 and NGN2 belong to different brain regions, the present invention combines these two transcription factors with specific transcription factors in MSN growth and development, in order to obtain the best combination for inducing MSN differentiation.

[0037] In the process of inducing MSNs, the above two transcription factors were combined with CTIP2 / DLX1 and CTIP2 / DLX2, respectively, and divided into four groups to induce NPCs, namely ASCL1+CTIP2 / DLX1, ASCL1+CTIP2 / DLX2, NGN2+CTIP2 / DLX1, and NGN2+CTIP2 / DLX2.

[0038] During the induction process, the four transcription factors were cloned into lentiviral vectors and transfected into 293T cells together with the lentiviral packaging plasmids using lipofectamine transfection. The virus fluids were collected after 48 hours and 72 hours, respectively, and filtered through a 0.45 μm filter for later use. NPCs were divided into 2.5×10 5 Cells were plated per well (6-well plate) onto Matrigel-coated plates. Different combinations of viral fluid were added every other day (the appropriate amount of each viral fluid was added based on the optimal multiplicity of infection (MOI) of 50 for NPCs). Four to five days after the start of differentiation, the four groups of transcription factor-induced MSNs were passaged and co-cultured with primary mouse glial cells. A subset of neurons were not passaged and continued to be cultured in the original 6-well plate for subsequent cell collection.

[0039] In this method, neurons differentiated to day 4-5 of neuronal differentiation are digested with Accutase and carefully transferred to a culture dish containing primary mouse glial cells. The co-cultured MSNs can reach maturity around 14-21 days. Thereafter, half of the C2A medium is replaced every two days for the neurons co-cultured with glial cells until the time point at which the cells are collected for experiments such as immunofluorescence. A portion of the neurons, which are not passaged, are collected using TransZol and mRNA is extracted for Q-PCR analysis.

[0040] Immunofluorescence staining and Q-PCR analysis showed that all four groups of transcription factors can induce NPCs to become MSNs, but the efficiency and maturity of neuronal differentiation are different. Due to the differences in the ability of ASCL1 and NGN2 to induce neuronal maturation and axon length, our experimental results show that in the same period of time, NGN2 induces longer axons, more dendrites, and more complex neuronal morphology. The neurons induced by the group with the addition of ASCL1 transcription factor showed a greater tendency to produce GABA. + Neurons, namely ASCL1+CTIP2 / DLX1 and ASCL1+CTIP2 / DLX2, are more likely to acquire GABA in the striatum that is lost in HD. + Further comparison of the two groups showed that ASCL1+CTIP2 / DLX2 had a slightly higher induction efficiency.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] The present invention mediates the differentiation of NPCs into MSNs by utilizing different combinations of transcription factors.

[0043] Based on previous studies, the present invention improves the set of transcription factors that mediate the differentiation of NPCs into neurons. By adding the transcription factor combinations ASCL1+CTIP2 / DLX1 and ASCL1+CTIP2 / DLX2 supplemented with appropriate differentiation conditions, a large number of functional MSNs can be generated quickly and efficiently.

[0044] After in vitro and in vivo verification, the method of the present invention can observe neuronal morphology in as short as 4-5 days by inducing differentiation from the NPC stage, obtain neurons with multiple dendrites in about 14 days, and obtain more mature MSNs in about 21 days. + and GAD2 + MSN can reach more than 95%. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1hPSCs were induced to differentiate into NPCs by dual SMAD inhibition and then spontaneously differentiated into neurons and glial cells;

[0046] A: Flowchart showing how hPSCs differentiate into NPCs through dual SMAD inhibition and then into neurons in C2 medium.

[0047] B: Bright field micrograph of NSP cells obtained by differentiation of hPSCs in A to day 7;

[0048] C: Immunostaining of markers NESTIN / SOX2 / PAX6, cell nuclei and their superposition in NPCs derived from hPSCs by dual SMAD inhibition;

[0049] D: The proportion of cells positive for NESTIN / SOX2 / PAX6, the markers of NPC, is 97%;

[0050] E: Immunofluorescence image of NPC spontaneous differentiation; NPCs spontaneously differentiate into neurons and astrocytes, where neuronal markers are represented by TUBB3 and MAP2; astrocyte marker is represented by GFAP;

[0051] The neural subtypes of NPCs differentiate into excitatory and inhibitory neurons, which are represented by the markers GLUT and GABA, respectively;

[0052] F: Statistics of the types and proportions of neurons that can be obtained through spontaneous differentiation of NPCs.

[0053] Figure 2 This is a T7E1 enzyme digestion experiment of two sgPTBP1s, indicating that sgPTBP1 can function in cells.

[0054] Figure 3 Statistical diagram to verify the ability of four neurotrophic factors to induce NPCs and neurons;

[0055] AB are schematic diagrams of cloning neurotrophic factors into lentiviral vectors;

[0056] Figure C shows the fluorescence visual field of NPCs induced by four neurogenic factors to form neuronal cells;

[0057] Figure D shows the statistics of the number of neurons formed by NPC induced by four neurogenic factors;

[0058] Figure E shows the statistical graph of the length of neurites of neuron-like cells induced by ASCL1 and NGN2, as well as fluorescence images of typical examples.

[0059] Figure 4 The fluorescence visual field images of neuron-like cells induced by four neurotrophic factors in the A375 cell line.

[0060] Figure 5 To determine the most suitable MOI for NPC; according to the results, an MOI of 50 had the best infection effect and the largest number of surviving cells.

[0061] Figure 6 Different combinations of transcription factors induce neurogenesis;

[0062] Figure A shows the fluorescence field of different transcription factor combinations that induce NPCs to form neuronal cells;

[0063] Figure B shows the Q-PCR results of different transcription factor combinations inducing NPC to form MSN neuron markers DARPP32, GAD1, and GAD2.

[0064] Figure 7 The images and statistical graphs of MSN immunofluorescence staining are shown;

[0065] A: Immunofluorescence staining of MSN-specific marker DARPP32 and neuronal markers;

[0066] B: Immunofluorescence staining of GABA-specific marker GAD2 and neuronal markers;

[0067] C: Statistical graph of the relative number of neuron-like cells induced by four groups of transcription factors;

[0068] D: Four groups of transcription factors induce cell DARPP32 + / GAD2 + With TUJ + The proportion of cells.

[0069] Figure 8 These are the results of inducing iPSCs from three types of patients, ALS, HD, and DYT1, into NPCs using the SB / LDN method.

[0070] Figure 9 The purity of NPCs induced from iPSCs derived from three types of patients: ALS, HD, and DYT1 using the SB / LDN method.

[0071] Figure 10 This is a diagram of the structure of the pCSC-LHX8-T2A-DLX1-IRES-Puro lentiviral vector;

[0072] Figure 11 This is a diagram of the structure of the pCSC-LHX8-T2A-DLX2-IRES-Puro lentiviral vector;

[0073] Figure 12 This is a diagram of the structure of the pCSC-ASCL1-ires-GFP-T2A-mSOX11 lentiviral vector;

[0074] Figure 13 This is a diagram of the structure of the pCSC-NGN2-ires-GFP-T2A-mSOX11 lentiviral vector;

[0075] Figure 14 This is a diagram of the structure of the pCSC-CMV-ires-GFP lentiviral vector;

[0076] Figure 15 This is a diagram of the structure of the pCSC-ASCL1-IRES-GFP-T2A-BclXL lentiviral vector;

[0077] Figure 16 This is a diagram of the structure of the pCSC-NGN2-IRES-GFP-T2A-BclXL lentiviral vector;

[0078] Figure 17 This is a diagram of the structure of the pCSC-NGN2-IRES-GFP-T2A-BclXL lentiviral vector;

[0079] Figure 18 This is a diagram of the lentiCRISPR-sgPTBP1-mCherry lentiviral vector structure;

[0080] Figure 19 This is a diagram of the lentiCRISPR-sgPTBP1-2-mCherry lentiviral vector structure;

[0081] Figure 20 This is a diagram of the structure of the pCSC-CTIP2-T2A-DLX1-IRES-Puro lentiviral vector;

[0082] Figure 21 This is a diagram of the structure of the pCSC-CTIP2-T2A-DLX2-IRES-Puro lentiviral vector;

[0083] Figure 22 This is a diagram of the structure of the pCSC-DLX1-IRES-GFP lentiviral vector;

[0084] Figure 23 This is a diagram of the structure of the pCSC-DLX2-IRES-GFP lentiviral vector;

[0085] Figure 24 This is a diagram of the structure of the pCSC-CTIP2-IRES-GFP lentiviral vector;

[0086] Figure 25 is the structure diagram of the psPAX2 vector plasmid;

[0087] Figure 26 This is the structural diagram of the PMD2.G envelope protein particle. DETAILED DESCRIPTION

[0088] In order to more clearly and concisely demonstrate the technical solutions, objects and advantages of the present invention, the technical solutions of the present invention are described in detail below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which no specific conditions are indicated, are generally based on conventional conditions such as those compiled by J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd edition, Science Press, 2002, or according to the conditions recommended by the manufacturer. Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be purchased through commercial channels.

[0089] the term

[0090] As used herein, unless otherwise specified, the term "cell" or "cell for overexpressing a transcription factor" refers to a variety of non-neuronal cells, as long as they are capable of transdifferentiating into MSNs after the introduction of the transcription factor. Preferably, the cells are mammalian somatic cells; for example, the cells are hiPSCs / hESCs, astrocytes, NPCs, neurons, or MSNs. Despite the presence of different somatic cell types within the same individual, the genomic sequences of these somatic cells are identical, and their major components are also essentially the same. This allows a variety of somatic cells to be used in this application, as long as they are capable of generating MSNs after the introduction of the transcription factor. As a preferred embodiment of the present invention, the cells are NPCs or MSNs.

[0091] As used herein, "overexpression" refers to the level (e.g., expression level) of a transcription factor in a cell exceeding that of an initial cell (a cell without the exogenous gene), for example, by 20% higher, preferably 50% higher, and more preferably by 100% higher, such as 200%, 300%, ..., 500% or higher, compared to the initial cell. One example of "overexpression" occurs when a gene encoding an exogenous transcription factor is introduced into the cell and expressed.

[0092] As used herein, the "mammal" is an animal of the class Mammalia, subphylum Vertebrata, phylum Chordata. The mammals described in the present invention include humans and non-human mammals. Examples of non-human mammals include mice, rats, rabbits, dogs, rabbits, monkeys, pigs, cattle, sheep, horses, and the like. Whether non-human mammals or humans, they are very similar in terms of genome composition, individual development, metabolic patterns, organ anatomy, and disease pathogenesis. During the evolutionary process, some key cell functions or regulatory pathways are conserved between different species, such as the signaling pathways of cell proliferation and apoptosis, which are basically the same in mammals. The aging pathway of cells is also a conserved regulatory mechanism.

[0093] Transcription factors and their uses

[0094] The present inventors used a combination of multiple transcription factors or sgRNAs including ASCL1, NGN2, miR-9 / 124, sgPTBP1, CTIP2, DLX1, and DLX2. The transcription factors or sgRNAs and their GenBank accession numbers are shown in Table 1.

[0095] Table 1 Transcription factors or sgRNAs and their GenBank accession numbers

[0096]

[0097] In the present invention, the term "transcription factor" refers to a polypeptide having the sequence shown in Table 1. The term also includes variants that have the same function as the polypeptides with the sequences shown in Table 1. These variants include (but are not limited to): deletion, insertion, and / or substitution of one or more (e.g., 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, as well as addition or deletion of one or several (e.g., up to 20, preferably up to 10, and more preferably up to 5) amino acids at the C-terminus and / or N-terminus. For example, substitution with amino acids having similar or similar properties generally does not alter protein function. For another example, addition or deletion of one or several amino acids at the C-terminus and / or N-terminus generally does not alter protein function. The term also includes active fragments and active derivatives of the polypeptides with the sequences shown in Table 1. These variants must retain the function of the full-length transcription factors shown in Table 1.

[0098] Variants of the polypeptide include homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, and the like. The present invention also provides other polypeptides, such as fusion proteins comprising the polypeptides or fragments thereof shown in Table 1. In addition to substantially full-length polypeptides, the present invention also encompasses soluble fragments of the polypeptides shown in Table 1, as long as they retain the functions of the full-length transcription factors shown in Table 1.

[0099] The present invention also provides analogs of the transcription factors shown in Table 1. The differences between these analogs and natural transcription factors can be differences in amino acid sequence, or differences in modified forms that do not affect the sequence, or both. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, or by site-directed mutagenesis or other known molecular biology techniques. Analogs also include analogs with residues different from natural L-amino acids (such as D-amino acids), as well as analogs with non-natural or synthetic amino acids (such as β, γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides listed above.

[0100] The gene encoding the transcription factor may be a polynucleotide comprising the transcription factor, or may be a polynucleotide further comprising additional coding and / or non-coding sequences.

[0101] The present invention also relates to variants that hybridize to the aforementioned transcription factor-encoding gene and have at least 70%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, and even more preferably at least 98% identity between the two sequences. In particular, the present invention relates to polynucleotides that hybridize under stringent conditions to the transcription factor polynucleotides of the present invention.

[0102] In light of the present invention, the transcription factor or variants or derivatives of its encoding gene are easily obtained and used by those skilled in the art.

[0103] Gene sequences encoding the transcription factors can typically be obtained by PCR amplification, recombinant methods, or synthetic methods. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art can be used as templates to amplify the relevant sequences.

[0104] Main experimental materials

[0105] iPSC-WT (Nuwacell, Hefei, China, #RC01001-A; #RC01001-B)

[0106] ncEpic stem cell culture medium: Nuwacell, #RP01001;

[0107] hPSC Dissociation Buffer(Nuwacell,#RP01007)

[0108] Accutase(Millipore Sigma,Burlington,MA,USA,#SCR005)

[0109] Device Matrigel(Corning,Kakegawa,Japan,#354277)

[0110] Y-27632(Selleck,Houston,TX,USA,#S1049)

[0111] DMEM / F12 (Procell, Wuhan, China, #PM150312)

[0112] Neurobasal medium(ThermoFisher,#21103049).

[0113] GlutaMax(Gibco,Yellow,TX,USA,#35050061)

[0114] NEAA(Gibco,#11140050)

[0115] β-ME(Procell,#PB180633)

[0116] High-Speed ​​Canopy (Solarbio,Beijing,China,#P1400)

[0117] DMSO(Solarbium,#D8371)

[0118] AraC(Sigma,#C1768)

[0119] B27 supplement(Gibco,#17504044)

[0120] N2 supplement(Gibco,#17502048)

[0121] L-Ascorbic Acid (L-AA, Sigma, #A4403)

[0122] Forskolin(Sigma,#F6886)

[0123] Puromycin(Solarbium,#P8230)

[0124] BDNF(Novoprotein,Shanghai,China,#C076)

[0125] GDNF (Novoprotein, #C226)

[0126] TransZol(TransGen Biotech,#ET101-01)

[0127] RevertAid First Strand cDNA Synthesis Kit (ThermoFisher, #K1622)

[0128] PerfectStart Green qPCR SuperMix (TransGen Biotech, #AQ601-01)

[0129] 4% paraformaldehyde (Servicebio, Wuhan, China, #G1101)

[0130] Triton X-100 (Solarbio, #T8200)

[0131] Tween-20(Macklin,Rochelle,IL,USA,#C10232628)

[0132] Bovine serum albumin(BSA,BioFroxx,Guangzhou,China,#4240)

[0133] Hoechst 33342(Beyotime,Shanghai,China,#C1025)

[0134] Poly(vinyl alcohol)(PVA,Macklin,P816862)

[0135] Blocking solution: 3% BSA, 2% Triton X-100 in DPBS

[0136] C2A medium: DMEM / F12:Neurobasal medium (2:1) containing 0.8% N2, 0.4% B27, 0.4 μg / mL L-AA, 5 μM forskolin, 10 ng / mL BDNF and 10 ng / mL GDNF

[0137] NPC culture medium: DMEM / F12 and Neurobasal medium (1:1) containing 0.5% N2, 1% B27, 1% GlutaMax, 1% NEAA, 50 μM β-ME, 1% penicillin-streptomycin mixture, 20 ng / mL EGF and 20 ng / mL bFGF

[0138] KOSR culture medium: DMEM / F12 containing 20% ​​KOSR, 1% GlutaMax, 1% NEAA, 50 μM β-ME, and 1% P / S.

[0139] NSP medium: DMEM / F12 containing 1% N2, 1% GlutaMax, 1% NEAA, 50 μM β-ME, 1% P / S, 8 μg / mL Heparin, 20 ng / mL bFGF, and 20 ng / mL EGF.

[0140] 10% DMEM: DMEM, 10% fetal bovine serum and 1% penicillin-streptomycin mixture

[0141] TBS (10×): Tris-base 48.4 g, NaCl 160 g, add water to 0.8 L, and adjust the pH to 7.6 with concentrated hydrochloric acid.

[0142] LB liquid medium: peptone 10g, yeast extract 5g, sodium chloride 10g (make up to 1L, sterilize with high pressure steam, store at 4℃)

[0143] TAE buffer (10×): Tris 24.2 g, EDTA 5.71 g, glacial acetic acid 5.71 ml (make up to 1 L)

[0144]

[0145] The models and sources of the primary and secondary antibodies used in immunofluorescence staining are shown in Table 2.

[0146] Table 2 Primary and secondary antibodies used in immunofluorescence staining

[0147]

[0148]

[0149] Example 1

[0150] Establishment of a system for inducing differentiation of hPSCs into NPCs

[0151] The present invention is based on a platform for efficiently inducing NPCs from hPSCs, as shown in the flowchart. Figure 1A (using a six-well plate as an example). The hPSCs used were from Zhongsheng Suyuan Biotechnology Co., Ltd. (#RC01001-A). The two key inhibitors used in this induction method are dual SMAD inhibitors (SB431542 and LDN193189: SB / LDN), which are TGFβ and BMP signaling inhibitors, respectively. hPSCs were cultured in ncEpic stem cell medium in Matrigel-coated culture dishes (1:200).

[0152] The process of coating culture dishes with Matrigel (1:200) specifically includes the following steps:

[0153] 1) Preparation: Pre-chill the gun box at -20°C for 1 hour, thaw DMEM / F12 and Matrigel at 4°C overnight;

[0154] 2) Place Matrigel thawed at 4°C on ice;

[0155] 3) Using a pre-chilled pipette tip, add the thawed Matrigel to 1 ml of cold DMEM / F12 and mix thoroughly by pipetting repeatedly.

[0156] 4) Aspirate the thawed and mixed Matrigel and add it to the remaining DMEM / F12 in the centrifuge tube, and mix again by pipetting repeatedly;

[0157] 5) Aliquot 1 ml per well in a 6-well plate and gently shake to mix thoroughly.

[0158] 6) The culture plate can be used after being placed at room temperature or 37°C for 1 hour, or stored at 4°C and used within 2 weeks (plates stored at 4°C can be used after being rewarmed at room temperature or 37°C for 30 minutes).

[0159] When the cell density is higher than 90% of the bottom area of ​​the culture dish, induction begins. For the first 7 days, 10 μM SB431542 / 0.1 μM LDN193189 is added to the stem cell culture medium. The medium is changed every day. On the 8th day, the cells are digested with Accutase for 3-5 minutes and resuspended in KOSR medium to a low-attachment bacterial culture dish. The medium is changed every other day. At this time, the cells can be seen to form neurospheres (NSP) ( Figure 1 B), then replace the NSP medium and continue culturing until day 18. At this time, NPCs have basically been induced to mature. Collect NSPs from the culture dish into a 15ml centrifuge tube, centrifuge at 800g for 4 minutes, remove the supernatant and add 6ml Accutase to digest for 5-6 minutes until the NSPs are digested into single cells. Resuspend the cells in NPC medium and place them in a culture dish coated with Matrigel (1:200). When the cells have grown to full size in the 10cm culture dish, the NPCs can be frozen or tested.

[0160] In order to detect the purity and efficiency of NPCs induced by differentiation, we used immunofluorescence staining to detect the expression of NPC-specific markers NESTIN, SOX2, and PAX6 in NPCs. The results showed that the purity of NPCs induced by this method was as high as over 97% ( Figure 1 CD), which means that this method can induce high-purity NPCs in just 18 days. At the same time, we verified that iPSCs derived from three other patients, ALS, HD, and DYT1, can also be induced into NPCs using the same SB / LDN method. The results are as follows Figure 8 As shown in Figure 2. The purity of NPC after induction also reached more than 97%. Figure 9 As shown, it provides a good platform for the application of later transcription factors.

[0161] Example 2

[0162] Spontaneous differentiation of NPC cells.

[0163] In order to verify the differentiation potential of NPCs generated in Example 1, we induced the generated NPCs to undergo spontaneous differentiation. The NPCs obtained in Example 1 were cultured at a rate of 2.5×10 5 Cells (6-well plates) were transferred to new culture plates coated with Matrigel (1:200) using the same coating process as in Example 1. 5 μM Y-27632 was added to promote cell survival. The next day, the C2A medium for neural differentiation was replaced, and the medium was changed every two days thereafter. The results showed that NPCs could differentiate into neurons and glial cells with considerable efficiency ( Figure 1 E) Since the NPCs generated by the current method basically have forebrain characteristics, most of the neurons they spontaneously differentiate into are excitatory (GLUT + ) and inhibitory (GABA + ) neurons, which have a similar ratio of excitatory / inhibitory neurons to those in the brain, but produce fewer specific subtypes of principal neurons (such as medium spiny neurons (MSNs), motor neurons (MNs), or dopaminergic neurons (DAs). Figure 1 F).

[0164] Example 3

[0165] 1. Construction of lentiviral vector and lentiviral packaging

[0166] The primer sequences mentioned below are shown in Table 3.

[0167] Table 3 Primer sequences used in the construction and packaging of lentiviral vectors

[0168]

[0169]

[0170] (1) Construction of pCSC-ASCL1-IRES-GFP-T2A-BclXL lentiviral vector (the constructed pCSC-ASCL1-IRES-GFP-T2A-BclXL lentiviral vector structure is as follows Figure 15 shown):

[0171] Using pTight-BclXL-9-124-IRES-Puro (addgene 60857; Andrew Yoo Lab) as a template, primers 0372-F1-NheI and 0372-R1-XhoI were used to amplify the BclXL sequence (the specific sequence of the amplified PCR product is shown in SEQ ID NO 25).

[0172] The PCR system is as follows:

[0173] Table 4 PCR system 1

[0174] Added substances Addition amount pTight-BclXL-9-124-IRES-Puro 100ng 0372-F1-NheI 1.25 μl 0372-R1-XhoI 1.25 μl 5×PS Buffer 10 μl dNTP (2.5 μM) 4 μl PrimeStar Enzyme 0.5 μl water Add to 50 μl

[0175] The PCR program was as follows, with a total of 34 cycles:

[0176] Table 5 PCR program 1

[0177] Preheat to 94°C 1min Denaturation 98℃ 10s Annealing 56℃ 15s Extension 72℃ 1min / 1kb Cooling 4℃ 10min

[0178] The obtained PCR product was double-digested with NheI and XhoI and then recovered by running on TAE gel.

[0179] Enzyme digestion system (20 μl), 37 ° C for 1 hour, the enzyme digestion system is as follows:

[0180] Table 6 Enzyme digestion system for PCR products

[0181] Added substances Addition amount PCR products 1 μg 10×CutSmart Buffer 2 μl NheI 1 μl XOt 1 μl water Add to 20 μl

[0182] After enzyme digestion, add 1× DNA loading buffer and run electrophoresis on 1% agarose gel at 160V for 30min. Then analyze on a UV analyzer to find the target band and use a surgical blade to cut the agarose in the area where the target band is located to prepare for gel recovery.

[0183] Preparation of 1% agarose gel: Add 1% agarose to 1×TAE buffer and heat in a microwave until completely dissolved. After cooling slightly, add 1×Gel-Green, shake well, and pour into a gel-making box with a comb inserted. Let it dry naturally before use.

[0184] Gel recovery was performed using the SanPrep nucleic acid purification kit:

[0185] Preparation: Check whether ethanol has been added to the eluent in the kit; check whether there is precipitation in buffer B2 in the kit, then:

[0186] 1) Adjust the water bath to 60°C;

[0187] 2) Cut out the gel block containing the target fragment from the agarose gel and weigh it;

[0188] 3) Add 3-6 times the weight of the gel block in buffer B2 and allow to dissolve in a 60°C water bath for 5-10 minutes;

[0189] 4) (Optional) For fragments < 500 bp, add 1 / 3 the volume of buffer B2 to the isopropanol.

[0190] 5) Transfer the sol solution into the adsorption column and centrifuge at 8000g for 30 seconds. Discard the liquid in the collection tube.

[0191] 6) Add 500 μl of elution buffer and centrifuge at 9000 g for 30 seconds. Discard the liquid in the collection tube.

[0192] 7) Repeat step 6 once;

[0193] 8) Centrifuge the empty adsorption column at 9000 g for 1 min;

[0194] 9) Place the centrifuged adsorption column into a clean 1.5 ml centrifuge tube, add 15-40 μl of Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 1 minute, and centrifuge for 1 minute to obtain the purified PCR product fragment.

[0195] 10) Store the DNA solution at -20°C or use it for subsequent experiments.

[0196] Then the pCSC-ASCL1-ires-GFP-T2A-mSOX11 (lentiviral vector structure as Figure 12 ) The lentiviral vector was double-digested with NheI and XhoI and run on a TAE gel to obtain a purified digested vector, which was ligated with the purified PCR product fragment using T4 ligase. The ligated product was then transformed into Escherichia coli Stbl3.

[0197] The enzyme digestion system is the same as that of the above PCR product digestion system, and the gel recovery steps are also the same as above.

[0198] The gel-cleaved product of pCSC-ASCL1-ires-GFP-T2A-mSOX11 and the purified PCR product were ligated at room temperature for 1 hour using the following system:

[0199] Table 7 T4 ligase ligation system

[0200] Added substances Addition amount Purified PCR product fragments 150ng Purified pCSC-ASCL1-ires-GFP-T2A-mSOX11 digested vector 50ng T4 ligase 1 μl 10× ligation buffer 10 μl water Add to 20 μl

[0201] The transformation steps into E. coli are as follows:

[0202] 1. Remove Stbl3 competent cells from -80°C and thaw on ice;

[0203] 2. Take out the 1.5ml EP tube and mark it;

[0204] 3. Add the ligated product to 100 μl of Stbl3 competent cells and mix well;

[0205] 4. Place the mixture on ice for 30 minutes while preheating the LB plate.

[0206] 5. After 30 minutes on ice, heat shock in a water bath at 42°C for 45 seconds.

[0207] 6. Immediately place on ice for 2 minutes;

[0208] 7. In a clean bench, use coating beads to evenly spread the mixture of the competent cells and ligation products on an LB plate;

[0209] 8. Incubate the plate in a 37°C incubator overnight for 16-18 hours.

[0210] 9. Use a tip to pick out the single colony grown on the above LB plate and transfer it to LB liquid medium (with 0.1 mg / ml ampicillin) and shake at 37°C for 16-18 hours.

[0211] 10. The next day, single clones were picked and transferred to LB liquid medium and shaken at 37°C for 16-18 hours. The plasmid was then extracted and sequenced for verification. The resulting pCSC-ASCL1-IRES-GFP-T2A-BclXL lentiviral vector was as follows: Figure 15 shown.

[0212] The steps for extracting plasmid are as follows:

[0213] Reagent Preparation: 1. For the SanPrep Column-Based Plasmid DNA Miniprep Reagent (B518191-0100, Sangon Biotech), initially transfer 1 ml of Buffer P1 to a centrifuge tube labeled with RNase A. Pipet and mix thoroughly, then add the remaining 1 ml to Buffer P1. Mix thoroughly, label, and store at 2-8°C. The shelf life is 6 months. 2. Add anhydrous ethanol to the wash solution. 3. If precipitate forms in Buffer P2 or Buffer P3, dissolve it at 37°C and cool to room temperature. 4. Ensure the centrifuge speed reaches the target speed.

[0214] Specific steps:

[0215] 1. Centrifuge the shaken bacterial suspension in liquid LB medium at room temperature at 8000g for 2 minutes to collect the cells. Pour off or aspirate the medium (usually 4 ml).

[0216] 2. Add 250 μl of Buffer P1 to the bacterial pellet and pipette or shake until the cells are completely suspended. You can use a 1.5 ml EP tube at this step.

[0217] 3. Add 250 μl buffer P2 (dissolve the precipitate at 37°C and cover tightly after use to prevent loss of efficacy), gently invert the tube 5-10 times to mix, and let it stand at room temperature for 2-4 minutes (<5 minutes).

[0218] 4. Add 350 μl of Buffer P3 and immediately mix thoroughly by gently inverting the tube 5-10 times.

[0219] 5. Centrifuge at the maximum speed of the centrifuge (centrifugal force ≥ 12000g) for 5-10 minutes, carefully transfer all the supernatant into the adsorption column, centrifuge at 9000g for 30 seconds, pour out the liquid in the collection tube (maximum effective volume is 750μl), and place the adsorption column in the same collection tube;

[0220] 6. (Optional) Add 500 μl of deproteinization buffer PW to the adsorption column and centrifuge at 9000 g for 30 seconds. Discard the liquid in the collection tube and place the adsorption column in the same collection tube.

[0221] 7. Add 500 μl of Wash solution to the adsorption column and centrifuge at 9000 g for 30 seconds. Pour off the liquid in the collection tube and place the adsorption column in the same collection tube. Repeat once.

[0222] 8. Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9000 g for 1 minute.

[0223] 9. Add 50-100 μl of elution buffer to the center of the adsorption membrane and let it stand at room temperature for 1-2 minutes. Centrifuge at 9000g for 1 minute. Store the resulting plasmid DNA solution at -20℃ or use it for subsequent experiments.

[0224] (2) Construction of pCSC-NGN2-IRES-GFP-T2A-BclXL lentiviral vector (the constructed pCSC-NGN2-IRES-GFP-T2A-BclXL lentiviral vector structure is as follows Figure 16 shown):

[0225] Using pTight-BclXL-9-124-IRES-Puro (addgene 60857; Andrew Yoo Lab) as a template, primers 0372-F1-NheI and 0372-R1-XhoI were used to amplify the BclXL sequence (the specific sequence of the amplified PCR product is shown in SEQ ID NO 25). The PCR product was double-digested with NheI and XhoI and then recovered by running on a TAE gel. The PCR, enzyme digestion, and gel running steps and reagents used were the same as above. The pCSC-NGN2-ires-GFP-T2A-mSOX11 lentiviral vector (lentiviral vector structure as shown in the figure) available in our laboratory was used. Figure 13 (Tang et al., 2017) After double digestion with NheI and XhoI, the vector was recovered by TAE gel running, using the same digestion and gel running procedures and reagents as above. The resulting vector was ligated with the purified PCR product fragment of pTight-BclXL-9-124-IRES-Puro using T4 ligase, following the same ligation system and procedures as above, and then transformed into Escherichia coli Stbl3. The next day, a single colony was picked and transferred to LB liquid medium for overnight shaking. The plasmid was then isolated and verified by sequencing, following the same transformation and plasmid extraction procedures as above.

[0226] (3) Construction of pCSC-BclXL-mir9-124-IRES-GFP lentiviral vector (the constructed pCSC-NGN2-IRES-GFP-T2A-BclXL lentiviral vector structure is as follows Figure 17 shown):

[0227] Using pTight-BclXL-9-124-IRES-Puro (addgene 60857; Andrew Yoo Lab) as a template, the miR-9 / 124 and BclXL sequences were amplified using primers 0371-F1-AgeI and 0371-R1-PstI (the specific sequence of the amplified PCR product is shown in SEQ ID NO 26). The PCR product was double-digested with AgeI and PstI and then recovered by running on TAE gel. Except for the type of primers, the PCR, enzyme digestion and gel running steps and the reagents used were the same as above. The pCSC-CMV-ires-GFP lentiviral vector (lentiviral vector structure as shown in FIG) was inserted into the pCSC-CMV-ires-GFP lentiviral vector. Figure 14) After double digestion with AgeI and PstI, the vector was recovered by TAE gel run. The digestion and gel run procedures and reagents used were the same as above, except for the enzyme targets and enzyme types. The resulting vector was ligated with the purified PCR product fragment of pTight-BclXL-9-124-IRES-Puro using T4 ligase. The ligation system and procedures were the same as above, except for the different ligation targets. The vector was then transformed into E. coli Stbl3. The next day, a single colony was picked and transferred to LB liquid medium for overnight shake incubation. The plasmid was then isolated and verified by sequencing. The transformation and plasmid extraction procedures were the same as above, except for the different transformation and extraction targets.

[0228] (4) Construction of lentiCRISPR-sgPTBP1-mCherry lentiviral vector and lentiCRISPR-sgPTBP1-2-mCherry lentiviral vector (the structures of the constructed lentiCRISPR-sgPTBP1-mCherry lentiviral vector and lentiCRISPR-sgPTBP1-2-mCherry lentiviral vector are as follows: Figure 18 , Figure 19 ):

[0229] LentiCRISPR v2-mCherry (addgene 99154) was digested with BsmBI, and the long fragment vector was recovered by TAE gel.

[0230] Enzyme digestion system (20 μl), 37 ° C for 1 hour, the enzyme digestion system is as follows:

[0231] Table 8 Enzyme digestion system of lentiCRISPR v2-mCherry

[0232] Added substances Addition amount lentiCRISPR v2-mCherry 1 μg 10×CutSmart Buffer 2 μl BsmB 1 μl water Add to 20 μl

[0233] After enzyme digestion, add 1× DNA loading buffer and run electrophoresis on a 1% agarose gel at 160V for 30 minutes. Then analyze on a UV analyzer to find the target band and use a surgical blade to cut the agarose in the area where the target band is located to prepare the gel to recover the CRISPR vector.

[0234] The steps and reagents used for glue recovery are the same as above.

[0235] sgRNA targeting PTBP1 was designed using the CRISPOR website, and sgPTBP oligo primers were synthesized (two pairs of primers, sgPTBP1-1F / sgPTBP1-1R and sgPTBP1-2F / sgPTBP1-2R). Each primer pair was incubated at 37°C for 30 minutes, denatured at 95°C for 5 minutes, and finally cooled to 25°C at a rate of 5°C / min to anneal double-stranded DNA. The resulting double-stranded DNA was ligated with the CRISPR vector digested and run on a gel using T4 ligase. The ligation system and procedures were the same as above, except for the target. The resulting double-stranded DNA was then transformed into Escherichia coli Stbl3. The next day, a single colony was picked and incubated overnight in LB liquid medium. Plasmids were then isolated and verified by sequencing. The transformation and plasmid extraction procedures were the same as above, except for the target. The double-stranded DNA was inserted behind the U6 promoter.

[0236] (5) Construction of pCSC-CTIP2-T2A-DLX1-IRES-Puro lentiviral vector (the constructed pCSC-CTIP2-T2A-DLX1-IRES-Puro lentiviral vector structure is as follows Figure 20 shown):

[0237] The pCMV3-CTIP2 vector (Sino Biological Inc. HG18714-UT) was used as a template and primers 0388-F1 and 0388-R1 were used to amplify the CTIP2 sequence (the specific sequence of the amplified PCR product is shown in SEQ ID NO 27). Except for the types of primers, the PCR steps and reagents used were the same as above.

[0238] The pCSC-LHX8-T2A-DLX1-IRES-Puro lentiviral vector (lentiviral vector structure as shown in Figure 10 After double digestion with XbaI and BamHI, the vector was recovered by TAE gel running. The digestion and gel running procedures and reagents were the same as above, except for the enzyme targets and enzyme types. The purified digested vector pCSC-LHX8-T2A-DLX1-IRES-Puro was ligated to the aforementioned PCR product via Gibson Assembly. The ligation system (20 μl) was as follows:

[0239] Table 9 Gibson Assembly connection system

[0240] Added substances Addition amount Amplified PCR products 0.5 pmols Purified pCSC-LHX8-T2A-DLX1-IRES-Puro digested vector 0.5 pmols Gibson Assembly Master Mix(2X) 10 μl water Add to 20 μl

[0241] After ligation at room temperature for 1 hour, transform into E. coli Stbl3. The next day, pick a single colony and transfer it to LB liquid medium for overnight shaking. Then, extract the plasmid and verify it by sequencing. The transformation and plasmid extraction procedures are the same as above, except that the target of transformation and extraction differs.

[0242] (6) Construction of pCSC-CTIP2-T2A-DLX2-IRES-Puro lentiviral vector (the constructed pCSC-CTIP2-T2A-DLX2-IRES-Puro lentiviral vector structure is as follows Figure 21 shown):

[0243] The pCSC-CTIP2-T2A-DLX1-IRES-Puro lentiviral vector ( Figure 20 As shown in the figure) and the pCSC-LHX8-T2A-DLX2-IRES-Puro (lentiviral vector structure as shown in the figure) already available in our laboratory Figure 11 ) lentiviral vectors were double-digested with XbaI and BsrGI, and then run on TAE gels to recover DNA fragments of the vectors pCSC-CTIP2-T2A-IRES-Puro and DLX2, respectively. The digestion and gel running procedures and reagents used were the same as above, except for the differences in the digestion targets and enzyme types.

[0244] The vector pCSC-CTIP2-T2A-IRES-Puro was ligated to DLX2 using T4 ligase. The ligation system and procedures were the same as above, except for the different targets. The cells were then transformed into E. coli Stbl3. The next day, a single colony was picked and transferred to LB liquid medium for overnight shaking. The plasmid was then isolated and verified by sequencing. The transformation and plasmid extraction procedures were the same as above, except for the different targets.

[0245] (7) Construction of pCSC-DLX1-IRES-GFP lentiviral vector (the constructed pCSC-DLX1-IRES-GFP lentiviral vector structure is as follows Figure 22 shown):

[0246] Using cDNA from 293T cells as a template (RNA extraction and reverse transcription steps and reagents are the same as above), primers DLX1-F and DLX1-R were used to amplify the DLX1 sequence (the specific sequence of the amplified PCR product is shown in SEQ ID NO28), and the PCR product was double-digested with AgeI and XhoI and then recovered by running on TAE gel. Except for the type of primers, the steps of PCR, enzyme digestion and running on gel and the reagents used were the same as above. The pCSC-CMV-ires-GFP lentiviral vector (lentiviral vector structure as shown in FIG28) was inserted into the lentiviral vector. Figure 14After double digestion with AgeI and XhoI, the vector was recovered by TAE gel running. The digestion and gel running procedures and reagents were the same as above, except for the enzyme targets and enzyme types. The resulting vector was ligated with the DLX1 fragment using T4 ligase. The ligation system and procedures were the same as above, except for the target. The vector was then transformed into E. coli Stbl3. The next day, a single colony was picked and incubated overnight in LB liquid medium. The plasmid was then isolated and verified by sequencing. The transformation and plasmid extraction procedures were the same as above, except for the target.

[0247] (8) Construction of pCSC-DLX2-IRES-GFP lentiviral vector (the constructed pCSC-DLX2-IRES-GFP lentiviral vector structure is as follows Figure 23 shown):

[0248] Using cDNA from 293T cells as a template (RNA extraction and reverse transcription steps and reagents are the same as above), primers DLX2-F and DLX2-R were used to amplify the DLX2 sequence (the specific sequence of the amplified PCR product is shown in SEQ ID NO29), and the PCR product was double-digested with AgeI and XhoI and then recovered by running on TAE gel. Except for the type of primers, the steps of PCR, enzyme digestion and running on gel and the reagents used were the same as above. The pCSC-CMV-ires-GFP lentiviral vector (lentiviral vector structure as shown in FIG29) was inserted into the lentiviral vector. Figure 14 After double digestion with AgeI and XhoI, the vector was recovered by TAE gel running. The digestion and gel running procedures and reagents were the same as above, except for the differences in the digestion target and enzyme type. The resulting vector was ligated with the DLX2 fragment using T4 ligase. The ligation system and procedures were the same as above, except for the differences in the ligation target. The vector was then transformed into E. coli Stbl3. The next day, a single colony was picked and transferred to LB liquid medium for overnight shaking. The plasmid was then isolated and verified by sequencing. The transformation and plasmid extraction procedures were the same as above, except for the differences in the target.

[0249] (9) Construction of pCSC-CTIP2-IRES-GFP lentiviral vector (the constructed pCSC-CTIP2-IRES-GFP lentiviral vector structure is as follows Figure 24 shown):

[0250] The pCMV3-CTIP2 vector (Sino Biological Inc. HG18714-UT) was used as a template, and the primers 0588-F and 0588-R were used to amplify the CTIP2 sequence (the specific sequence of the amplified PCR product is shown in SEQ ID NO 30). The PCR product was double-digested with AgeI and XhoI and then recovered by running on TAE gel. Except for the type of primers, the steps of PCR, enzyme digestion and running on gel and the reagents used were the same as above. The pCSC-DLX1-IRES-GFP lentiviral vector (lentiviral vector structure as shown in FIG) was inserted into the lentiviral vector. Figure 22 After double digestion with AgeI and XhoI, the vector was recovered by TAE gel running. The digestion and gel running procedures and reagents were the same as above, except for the differences in the digestion target and enzyme type. The resulting vector was ligated with the CTIP2 fragment using T4 ligase. The ligation system and procedures were the same as above, except for the differences in the ligation target. The vector was then transformed into E. coli Stbl3. The next day, a single colony was picked and incubated overnight in LB liquid medium. The plasmid was then isolated and verified by sequencing. The transformation and plasmid extraction procedures were the same as above, except for the differences in the target.

[0251] (10) Lentiviral packaging

[0252] The lentiviral packaging method is as follows: take more than 6 μg of the constructed Figures 15 to 21 The viral vector shown, 4.5 μg psPAX2 vector (packaging plasmid, structure as shown Figure 25 As shown) and 3 μg PMD2.G (envelope protein plasmid, structure as Figure 26 The plasmid and liposome mixture was mixed with the vector shown in Figure 1 and transfected with 3 volumes of liposomes in 293T cells cultured in a 10 cm dish. The transfection process was as follows: the plasmid and liposome mixture was slowly added to the culture medium, gently shaken, and incubated at 37°C for 12-16 hours. The culture medium was then replaced and cultured. After overnight transfection, the cells were washed twice with PBS and replaced with fresh 10% complete DMEM medium for continued culture. 48 and 72 hours after transfection, the culture medium was collected into centrifuge tubes and filtered through a 0.45 μm pore filter to remove cells and other debris, obtaining a sample containing the following: Figures 15-24 Viral solutions of the indicated viral vectors.

[0253] Example 4

[0254] The NPCs obtained in Example 1 were plated at a rate of 2.5×10 5 The cells (6-well plate) were transferred to a new culture plate coated with matrigel (1:200), with a total of four wells. The coating process was the same as in Example 1. The next day, the coated virus solution was added to the culture medium at MOIs of 100, 50, 25, and 12.5. The medium was changed after about 16 hours overnight. The cell survival status and infection efficiency were observed after 6 days. The results showed that ( Figure 5 ) When the MOI was 50, both the infection efficiency and cell survival were optimal.

[0255] Example 5

[0256] Verify the ability of neurotrophic factors to induce NPCs into neurons.

[0257] The NPCs obtained in Example 1 were cultured in NPC culture medium in a culture dish coated with Matrigel (1:200). The coating process was the same as in Example 1. The NPC culture medium was changed every other day during normal culture. When the cells grew to 80%-90% of the bottom area of ​​the culture dish, they were passaged. During passage, they were digested with Accutase for 2 minutes and then terminated with an equal volume of DMEM / F12. Centrifuged at 800 rpm for 4 minutes, the supernatant was discarded, and the cells were resuspended in NPC culture medium at a concentration of 2.5×10 cells per well. 5 The cells (6-well plate) were transferred to a new matrigel-coated culture plate and 5 μM Y-27632 was added to promote cell survival. The next day, the four neurotrophic factor virus solutions (ASCL1, NGN2, miR-9 / 124, sgPTBP1; i.e., containing 5 μM Y-27632, 5 μM Y-27632, and 5 μM Y-27632) prepared in Example 2 were added at an MOI of 50. Figure 15 The viral solution of the pCSC-ASCL1-IRES-GFP-T2A-BclXL viral vector shown above contains Figure 16 The viral solution of the pCSC-NGN2-IRES-GFP-T2A-BclXL viral vector shown above contains Figure 17 The viral solution of the pCSC-BclXL-mir9-124-IRES-GFP viral vector shown above contains Figure 18 The ability of ASCL1 and NGN2 to induce neuron generation was tested by using the viral solution of lentiCRISPR-sgPTBP1-1-mCherry viral vector shown in Figure 2. The experimental results showed that ASCL1 and NGN2 could efficiently induce neuron generation (both greater than 90%), while miR-9 / 124 and sgPTBP1 had very low ability to induce neurons (both less than 20%) ( Figure 3 D), the same conclusion was also confirmed in another melanoma cell line A375 ( Figure 4 ), that is, culturing A375 cells in the same manner and adding the four neurotrophic factor viral solutions. Therefore, we only used ASCL1 and NGN2 in our subsequent MSN-inducing experiments.

[0258] Example 6

[0259] Different transcription factor combinations induce neurogenesis.

[0260] The NPCs obtained in Example 1 were cultured in NPC culture medium in a culture dish coated with Matrigel (1:200). The coating process was the same as in Example 1. The NPC culture medium was changed every other day during normal culture. The cells were passaged when they grew to 80%-90% of the bottom area of ​​the culture dish. During passage, they were digested with Accutase for 2 minutes and then terminated with an equal volume of DMEM / F12. Centrifuged at 800 rpm for 4 minutes, the supernatant was discarded, and the cells were resuspended in NPC culture medium at a concentration of 2.5×10 cells per well. 5The cells (6-well plates) were transferred to new matrigel-coated culture plates and 5 μM Y-27632 was added to promote cell survival. The next day, the five transcription factor viral solutions prepared in Example 2 were added at an MOI of 50 and different combinations, namely CTIP2, DLX1, DLX2, NGN2, ASCL1, ASCL1 / CTIP2, ASCL1 / DLX1, ASCL1 / DLX2, ASCL1 / CTIP2 / DLX1, and ASCL1 / CTIP2 / DLX2, respectively. Figure 15 The viral solution of the pCSC-ASCL1-IRES-GFP-T2A-BclXL viral vector shown above contains Figure 16 The viral solution of the pCSC-NGN2-IRES-GFP-T2A-BclXL viral vector shown above contains Figure 20 The viral solution of the pCSC-CTIP2-T2A-DLX1-IRES-Puro viral vector shown above contains Figure 21 The viral solution of the pCSC-CTIP2-T2A-DLX2-IRES-Puro viral vector shown above contains Figure 22 The viral solution of the pCSC-DLX1-IRES-GFP viral vector shown above contains Figure 23 The viral solution of the pCSC-DLX2-IRES-GFP viral vector shown in FIG Figure 24 The viral solution of the pCSC-CTIP2-IRES-GFP viral vector was tested for its ability to induce the formation of MSN neuron markers DARPP32, GAD1, and GAD2. The experimental results showed that both ASCL1 / CTIP2 / DLX1 and ASCL1 / CTIP2 / DLX2 groups were able to efficiently induce the generation of MSN neurons (both greater than 90%), while the other groups were lower ( Figure 6 A, B).

[0261] Example 7

[0262] Verify the efficiency of four combinations of transcription factors in inducing MSN generation.

[0263] According to the method in Example 4, 2.5×10 5 NPC cells were passaged into 6-well plates coated with matrigel (1:200), and the coating process was the same as in Example 1. On the second day, virus solutions with an MOI of 50 (ASCL1+CTIP2 / DLX1, ASCL1+CTIP2 / DLX2, NGN2+CTIP2 / DLX1, NGN2+CTIP2 / DLX2, i.e., containing Figure 15 The pCSC-ASCL1-IRES-GFP-T2A-BclXL viral vectors shown and Figure 20The mixed virus solution of the pCSC-CTIP2-T2A-DLX1-IRES-Puro viral vector (1:1; v / v) containing Figure 15 The pCSC-ASCL1-IRES-GFP-T2A-BclXL viral vectors shown and Figure 21 The mixed virus solution of the pCSC-CTIP2-T2A-DLX2-IRES-Puro viral vector (1:1; v / v) containing Figure 16 The pCSC-NGN2-IRES-GFP-T2A-BclXL viral vectors shown and Figure 20 The mixed virus solution of the pCSC-CTIP2-T2A-DLX1-IRES-Puro viral vector (1:1; v / v) containing Figure 16 The pCSC-NGN2-IRES-GFP-T2A-BclXL viral vectors shown and Figure 21 The mixed virus solution of pCSC-CTIP2-T2A-DLX2-IRES-Puro virus vector (1:1; v / v) was added, and C2A medium was replaced after 24 hours. On the 4th to 5th day after the addition of the virus solution, the cells were transferred to mouse astrocytes and cultured for 21 days. The neuronal marker TUJ1 and the MSN-specific markers DARPP32 and GAD2 were detected by immunostaining (the results are shown in Figure 7 A and Figure 7(As shown in Figure 2B), indicating that all four groups can induce the generation of MSNs. Neurons transferred onto mouse astrocytes and cultured for 21 days were treated with aspirated culture medium, washed once with PBS, and fixed with 300 μl of 4% paraformaldehyde per well for 15 minutes. The formaldehyde was aspirated, and the cells were blocked with blocking buffer containing 3% BSA and 0.3% Triton-X-100 for 30 minutes. The blocking buffer was removed, and the cells were incubated overnight at 4°C with the primary antibodies (TUJ1 1:500; GFP 1:500; DARPP32 1:50; GAD2 1:100). The cells were washed three times with PBST, each for 10 minutes. The corresponding fluorescent secondary antibodies, Alexa fluor 488 / 555 / 647 (1:500; Invitrogen), were added and incubated for 1 hour at room temperature in the dark. The cells were then washed three times with PBST, each for 10 minutes. Finally, Hoechst 33342 nuclear stain was added for 5 minutes, followed by 5-minute PBS washes and 4% PVA blocking. Immunostaining was then observed under a fluorescence microscope (Leica DMi8). The results showed that all four transcription factors were highly effective in inducing the generation of MSNs. However, because ASCL1 was less efficient than NGN2 in inducing neurons, the number of neurons induced by the ASCL1+CTIP2 / DLX1 and ASCL1+CTIP2 / DLX2 groups was less than that by the NGN2+CTIP2 / DLX1 and NGN2+CTIP2 / DLX2 groups ( Figure 7 C), but in these four groups, the ratio of MSN production (i.e., the ratio of the number of MSNs to the number of neurons) was high, suggesting that the induced MSNs were all high-purity ( Figure 7 D).

[0264] Example 8

[0265] Q-PCR was used to detect markers of MSN induced by four groups of transcription factors.

[0266] RNA extraction: Total mRNA was extracted from cells (NPC and MSN induced with four sets of transcription factors for 14 days) using TransZol reagent as follows:

[0267] 1) Add 0.5 ml of TransZol to each well of cells to fully lyse the cells and transfer them to an EP tube;

[0268] 2) Add 0.2 times the volume of chloroform, mix thoroughly by inversion, and vortex for 30 seconds; let stand on ice for 5 minutes;

[0269] 3) Centrifuge at 12,000 rpm and 4°C for 15 min;

[0270] 4) Carefully pipette the supernatant into a new EP tube;

[0271] 5) Add isopropanol at a 1:1 volume ratio to the supernatant, mix thoroughly by inversion, and incubate at -20°C to precipitate RNA for 1 hour.

[0272] 6) Centrifuge at 12,000 rpm and 4°C for 10 min;

[0273] 7) Remove the supernatant, add 500 μl of 70% alcohol, and shake up and down to float the precipitate;

[0274] 8) Centrifuge at 12,000 rpm and 4°C for 5 min;

[0275] 9) Carefully remove all the supernatant and air-dry at room temperature until the white precipitate becomes translucent;

[0276] 10) Add 30 μl of enzyme-free water, mix well, incubate in a 55°C water bath for 5 min, and then store at -80°C for later use.

[0277] mRNA reverse transcription and Q-PCR:

[0278] The two total mRNAs extracted above were reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit.

[0279] 1) First, add the following template, primers, and enzyme-free water to an enzyme-free PCR tube;

[0280] Table 10 Primers and mRNA for reverse transcription

[0281] Add substances sequence Addition amount Template mRNA Extracted mRNA 0.1ng-5μg Primers Random hexamer primer 1 μl water Enzyme-free water to 12 μl

[0282] 2) Add the following ingredients to each tube (total volume per tube 20μl)

[0283] Table 11 Reverse transcription system

[0284] Added substances Addition amount 5×reaction buffer 4 μl RT block RNase inhibitor(20U / μl) 1 μl 10mM dNTP Mix 2 μl Revert aid RT (200U / μl) 1 μl

[0285] 3) Mix the liquid in the PCR tube evenly (20 μl per tube);

[0286] 4) Reverse transcription procedure: primer annealing at 25°C for 5 minutes, DNA polymerization at 42°C for 60 minutes, enzyme inactivation at 70°C for 5 minutes

[0287] Q-PCR assay: PCR was performed using PerfectStart Green qPCR SuperMix. First, the two cDNAs obtained by reverse transcription were diluted 10-fold;

[0288] Add samples to a 96-well plate according to the table below to detect the genes expressed in each sample;

[0289] Table 12 Q-PCR system

[0290] Added substances Addition amount Reaction Mix x1 2xSYBR Green Mix 10 μl water 7.8 μl cDNA 1 μl Primer F (10 μM) 0.4 μl Primer R (10 μM) 0.4 μl

[0291] The specific sequences of the primers are shown in the following table:

[0292] Table 13 Q-PCR primers

[0293] Primer name Primer sequences HPRT-F GCTTTCCTTGGTCAGGCAGTA(SEQ ID NO 31) HPRT-R GTCTGGCTTATATCCAACACTTCGT(SEQ ID NO 32) DARPP32-F CCTGAAGGTCATCAGGCAGT(SEQ ID NO 33) DARPP32-R GGTCTTCCACTTGGTCCTCA(SEQ ID NO 34) FoxP1-F CTACCGCTTCCATGGGAAATC(SEQ ID NO 35) FoxP1-R CTGTTGTCACTAAGGACAGGG(SEQ ID NO 36) GAD1-F GCGGACCCCAATACCACTAAC(SEQ ID NO 37) GAD1-R CACAAGGCGACTCTTCTCTTC(SEQ ID NO 38) GAD2-F TTTTGGTCTTTCGGGTCGGAA(SEQ ID NO 39) GAD2-R TTCTCGGCGTCTCCGTAGAG(SEQ ID NO 40)

[0294] Q-PCR was performed on an ABI QuantStudio Dx Q-PCR instrument. The PCR program was 42 cycles of denaturation at 94°C for 5 s, annealing at 62°C for 15 s, and extension at 72°C for 15 s. The quality of all primers was verified by melting curve analysis. The housekeeping gene HPRT and 2 relative to the control sample were used. -ΔΔCt Algorithms analyze relative gene expression levels.

[0295] The results show that ( Figure 7 ) After 14 days of NPC cell neuronal markers DARPP32, FOXP1, GAD1, and GAD2 induced by the four groups of transcription factors, all increased to varying degrees, indicating that these four groups of transcription factor combinations can induce DARPP32-positive MSNs, but the GAD1 / GAD2 genes increased more significantly in the ASCL1 group, indicating that the MSNs induced by the ASCL1 group are more consistent with the characteristics of striatal GABAergic neurons and are suitable for cell transplantation in HD disease models.

[0296] Example 9

[0297] Verification of the ability of four groups of transcription factors to individually induce NPCs to produce MSNs.

[0298] To verify the necessity of the transcription factor combination, we used ASCL1, NGN2, DLX1, DLX2, and CTIP2 to induce NPCs individually, using the pCSC-ASCL1-IRES-GFP-T2A-BclXL ( Figure 15 ), pCSC-NGN2-IRES-GFP-T2A-BclXL( Figure 16 )、pCSC-DLX1-IRES-GFP( Figure 22 )、pCSC-DLX2-IRES-GFP( Figure 23 )、pCSC-CTIP2-IRES-GFP( Figure 24 ). To determine the efficiency of inducing MSN production.

[0299] The above vector was packaged into lentivirus using the method of Example 3, and 2.5×10 5NPC cells were passaged onto six-well plates coated with Matrigel (1:200). The next day, virus was added at an MOI of 50. Neuron-like cells were counted on day 14 of culture, and MSN-specific markers were detected by immunofluorescence on day 21. The results showed that ASCL1 and NGN2 induced the generation of a large number of neuron-like cells, but expression of MSN-specific markers was almost absent. DLX1, DLX2, and CTIP2 alone had a low ability to induce neuron-like cells and were almost incapable of inducing MSN-specific markers.

[0300] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The present description and examples are intended to be illustrative only.

Claims

1. A method for generating medium spiny neurons, characterized in that The method comprises expressing an exogenous transcription factor in neural precursor cells: the transcription factor is a combination of ASCL1, CTIP2, and DLX1, a combination of ASCL1, CTIP2, and DLX2, a combination of NGN2, CTIP2, and DLX1, or a combination of NGN2, CTIP2, and DLX2.

2. The method for producing medium spiny neurons according to claim 1, wherein The method for expressing exogenous transcription factors in neural precursor cells comprises: (a) providing cells; (b) transferring the transcription factors into the cells in (a) using an expression vector, or transferring the transcription factors into the cells in (a) by protein transfection; and (c) culturing the cells obtained in (b).

3. The method for producing medium spiny neurons according to claim 2, wherein The expression vector is a viral vector or a non-viral vector, including an adenoviral vector, an adeno-associated viral vector, a retroviral vector or a non-viral plasmid.

4. A transcription factor combination for generating medium spiny neurons, characterized in that The transcription factor combination is a combination of ASCL1, CTIP2, and DLX1, a combination of ASCL1, CTIP2, and DLX2, a combination of NGN2, CTIP2, and DLX1, or a combination of NGN2, CTIP2, and DLX2.

5. A kit for preparing medium spiny neurons, characterized in that: comprising a transcription factor or a gene encoding the transcription factor, an expression cassette or an expression vector; The transcription factor is a combination of ASCL1, CTIP2, and DLX1, a combination of ASCL1, CTIP2, and DLX2, a combination of NGN2, CTIP2, and DLX1, or a combination of NGN2, CTIP2, and DLX2.

Images