A gene affecting tobacco plastid pigment synthesis and its application

Abstract

The invention discloses a gene and application related to the synthesis of tobacco plastid pigments. The gene related to the synthesis of tobacco plastid pigments is derived from tobacco and is named as pectin lyase (SPL), and its nucleotide sequence is shown in SEQ ID NO.1. The invention constructs a CRISPR / Cas9-spl editing vector for knocking out the pectin lyase gene by CRISPR / Cas9-mediated gene editing technology, obtains a safflower Dajinyuan plant with an insertion mutation in the pectin lyase gene after genetic transformation, and the content of neoxanthin, lutein, chlorophyll b and chlorophyll a in the leaves of the obtained edited plant 423 is significantly increased, indicating that the knockout of the gene can affect the content of plastid pigments in plant leaves, which provides genetic materials and theoretical basis for the study of tobacco plastid pigment synthesis pathways, tobacco leaf quality improvement, and tobacco variety genetic improvement.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a gene related to the synthesis of tobacco plastid pigments and its application. Background Art

[0002] The plastid pigments in tobacco leaves are not only important substances for tobacco plants to photosynthesize and provide nutrients for tobacco growth, but also important substances that affect the appearance and sensory quality of tobacco leaves. Therefore, research on changing the content of plastid pigments in tobacco leaves will hopefully be used to improve the quality of tobacco.

[0003] The plastid pigments in fresh tobacco leaves can be divided into two major categories. One is chlorophyll, including chlorophyll a and chlorophyll b; the other is carotenoids, mainly including carotene and lutein. The chlorophyll degradation product, neophytadiene, can enhance the taste and aroma of flue-cured tobacco, and is degraded and transformed into aroma components. There are four main types of carotenoids in tobacco, namely neoxanthin, violaxanthin, lutein and β-carotene. On the one hand, the content of carotenoids directly determines the appearance quality of tobacco leaves. On the other hand, carotenoid substances can produce many aroma substances due to different locations of double bond cleavage, such as β-damascenone, 6-methyl-5-heptene-2-one, which play a very important role in the aroma of tobacco leaves and are the main source of volatile aroma components in tobacco leaves.

[0004] Therefore, research on the function of genes that change the content of plastid pigments will provide genetic materials and theoretical basis for improving tobacco leaf quality and genetic improvement of tobacco varieties. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a gene and application related to the synthesis of tobacco plastid pigments, so as to provide genetic materials and theoretical basis for improving tobacco leaf quality and genetic improvement of tobacco varieties.

[0006] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0007] A gene affecting the synthesis of tobacco plastid pigments is derived from Nicotiana tabacum and is named as pectate lyase-like enzyme (SPL). The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] Preferably, the amino acid sequence of the protein encoded by the gene affecting tobacco plastid pigment synthesis is shown as SEQ ID NO.2.

[0009] A method for increasing the pigment content of tobacco leaf plastids, the method comprises knocking out the above gene in tobacco plants or causing the function of the encoded protein of the gene to be defective.

[0010] Preferably, the knockout is performed by CRISPR / Cas9-mediated gene editing technology, specifically comprising the following steps:

[0011] (1) Selecting a more specific 23 nt nucleotide sequence in the gene as the guide sequence of CRISPR / Cas9, connecting the sequence fragment with the CRISPR / Cas9 vector, transforming and PCR amplification detection, and obtaining a CRISPR / Cas9-spl editing vector through PCR positive cloning;

[0012] (2) Using Agrobacterium tumefaciens-mediated genetic transformation, the editing vector CRISPR / Cas9-spl was transformed into tobacco plants, and transformation-positive and editing-positive plants were screened and identified. The editing-positive plants had increased tobacco leaf plastid pigment content compared to the control untransformed plants.

[0013] Preferably, in step (1), the more specific 23 nt nucleotide sequence in the gene is as shown in SEQ ID No.8.

[0014] The invention discloses an application of a gene related to the synthesis of tobacco plastid pigments in improving the content of tobacco leaf plastid pigments.

[0015] Preferably, after gene knockout, the chlorophyll and carotenoid content in the tobacco leaves of the editing-positive plants at the mature stage is increased compared to the control untransformed plants.

[0016] The above technical solution of the present invention has the following beneficial effects:

[0017] The pectin lyase gene provided by the present invention was found to be expressed in leaves by fluorescent quantitative PCR. In plant 423 edited with the tobacco pectin lyase gene, the expression level of the tobacco pectin lyase gene in leaves was significantly lower than that of the control (untransformed) plants (e.g. Figure 1 ).

[0018] The present invention constructs a CRISPR / Cas9-spl editing vector for knocking out a pectin lyase-like enzyme gene through CRISPR / Cas9-mediated gene editing technology, and obtains a safflower Dajinyuan plant with an insertion mutation in the pectin lyase-like enzyme gene after genetic transformation. The contents of neoxanthin, lutein, chlorophyll b and chlorophyll a in the leaves of the obtained edited plant 423 are significantly increased, indicating that the knockout of this gene can affect the content of plastid pigments in plant leaves.

[0019] In summary, knocking out the pectate lyase gene using CRISPR / Cas9-mediated gene editing technology can obtain gene-edited plants 423 with increased contents of neoxanthin, lutein, chlorophyll b, and chlorophyll a in leaves. This provides genetic material and theoretical basis for the study of tobacco plastid pigment synthesis pathways, improvement of tobacco leaf quality, and genetic improvement of tobacco varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0021] Figure 1 is the relative expression level of the pectin lyase-like gene spl in the leaves of the control (untransformed) plants and the leaves of the gene-edited plant 423;

[0022] Figure 2 This is a comparison of the contents of neoxanthin, lutein, chlorophyll b, and chlorophyll a in the leaves of the control (untransformed) plants and the mature leaves of the gene-edited plant 423.

[0023] Figure 3 Comparison chart of root length, root weight, stem length, and aboveground weight of the control (untransformed) plant and gene-edited plant 423 at three growth stages. DETAILED DESCRIPTION

[0024] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that the relative arrangement of components and steps, numerical expressions and numerical values ​​set forth in these embodiments do not limit the scope of the present invention unless otherwise specifically stated.

[0025] All experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0026] Unless otherwise specified in the present invention, percentages refer to volume percentages and ratios refer to volume ratios.

[0027] Example 1

[0028] This example mainly focuses on the process of obtaining the tobacco pectin lyase gene spl, which is briefly introduced as follows.

[0029] The leaves of cultivated tobacco safflower Dajinyuan were used as samples, and total RNA was extracted from tobacco leaves using an RNA extraction kit, and then reverse transcribed into cDNA for later use.

[0030] By homology comparison, referring to the Arabidopsis gene sequence and the known tobacco partial gene sequence, the amplification primer sequences were designed as follows:

[0031] F: 5'-ATGGCAATGAGTTTTGTGCT-3', (SEQ ID No. 3);

[0032] R: 5'-CTAGCACATGCGGCTTCTGC-3', (SEQ ID No. 4);

[0033] Using the above prepared cDNA as template, PCR amplification was performed using the above primers:

[0034] Amplification system (50 μL):

[0035]

[0036]

[0037] After mixing and centrifuging, PCR amplification was performed. The PCR reaction conditions were: 95°C for 10 sec, 52°C for 30 sec, 72°C for 1.5 min, for a total of 30 cycles; 72°C for 10 min; 12°C Hold.

[0038] The amplified product was purified and sequenced to obtain the tobacco pectin lyase gene spl sequence, whose base sequence is shown in SEQ ID No. 1, including 1359 bp bases. After translating the gene sequence, the encoded protein sequence is shown in SEQ ID No. 2, including 452 amino acids. Further comparative analysis showed that the protein contained a highly homologous sequence and was highly conserved.

[0039] Example 2

[0040] Using the pectin lyase-like gene spl obtained in Example 1, the present invention further constructed a CRISPR / Cas9 vector, and the relevant construction process is briefly introduced as follows.

[0041] The more specific 23nt nucleotide sequence [GCATTAGGAACAGTACTGAGAGG (SEQ ID No. 8)] in this gene was selected as the guide sequence of CRISPR / Cas9, and the upstream primer and downstream primer were synthesized:

[0042] F5'-GATTGCATTAGGAACAGTACTGAGAGG-3' (SEQ ID No. 5);

[0043] R5'-CAAACCTCTCAGTACTGTTCCTAATGC-3' (SEQ ID No. 6).

[0044] After the synthesized primers were diluted with ddH2O to a concentration of 100 ng / μL, 5 μL of each of the upstream and downstream primers were mixed into a PCR tube. The PCR instrument annealing program was: denaturation at 95°C for 2 min, and the temperature was decreased by 0.1°C every 8 s to 25°C. After annealing, a double-stranded structure with a specific guide sequence in the middle was formed as the target fragment:

[0045] GATTGCATTAGGAACAGTACTGAGAGG

[0046] CGTAATCCTTGTCATGACTCTCCAAAC.

[0047] Digestion of CRISPR / Cas9 vector with BsaI:

[0048]

[0049]

[0050] The cells were incubated at 37°C for 1 hour, and the enzyme-digested vector fragments were recovered by 1.5% agarose gel electrophoresis.

[0051] Ligate the digested vector to the annealed product:

[0052]

[0053] Connect at 25℃ for 30min.

[0054] Place the Trans-T1 competent cells on ice, wait for them to melt, pipette 10 μL of the ligation product into the competent cells, mix gently, place on ice for 10 min, heat shock at 42°C for 90 s, and quickly place the competent cells back on ice for 2 min. Spread 60 μL of the transformation product evenly on LB solid medium containing 50 mg / L Kan, and culture at 37°C for 12-18 hours.

[0055] A single clone was selected as a template, and PCR amplification was performed using the detection primer [JC-F: 5'-ttaggtttacccgccaata-3' (SEQ ID No. 7)] and the target site downstream primer R5'-CAAACCTCTCAGTACTGTTCCTAATGC-3' (SEQ ID No. 6) as amplification primers:

[0056]

[0057]

[0058] After mixing and centrifuging, PCR amplification was performed. The PCR reaction conditions were: 95°C for 10 sec, 47°C for 30 sec, 72°C for 0.5 min, for a total of 30 cycles; 72°C for 10 min; 12°C Hold.

[0059] The PCR-positive clones were sent to a sequencing company for sequencing confirmation (sequencing primer: JC-F: 5'-ttaggtttacccgccaata-3' (SEQ ID No. 7)) to obtain the CRISPR / Cas9-sppl editing vector.

[0060] Example 3

[0061] Using the CRISPR / Cas9-sppl editing vector constructed in Example 2, the inventors further conducted a genetic transformation experiment, taking Honghua Dajinyuan as an example, to knock out the tobacco pectin lyase gene sppl in the plant. The relevant experimental process was a conventional Agrobacterium tumefaciens-mediated genetic transformation process to obtain regenerated plants.

[0062] After the target site primer detection, the upstream primer [JC-F: 5'-TAGCTACGGTTGGGGTGCTA-3' (SEQ ID No. 9)] and the downstream primer R5'-CCTGGATAACAGCATGGCGA-3' (SEQ ID No. 10) were used as amplification primers for PCR amplification, and the sequencing sequence was analyzed using SnapGene software to obtain tobacco plants with heterozygous editing of the spl gene. After harvesting, the seeds were self-pollinated and homozygous planted according to 46 plants again, and the target site sequencing primers were detected and analyzed using SnapGene software to screen and obtain the plant 423 with homozygous editing of spl. In order to detect the expression of the pectin lyase gene spl in the 423 edited plant, the leaves of the homozygous plant 423 were taken for fluorescence quantitative PCR. The fluorescence quantitative PCR reagent used was SYBR Premix Ex Taq TMII of TaKaRa Company.

[0063] The primers for qPCR amplification of the pectate lyase gene spl are as follows:

[0064] qPCR-sppl-F1: TGTAAGCCAACGGGTAATGCT (SEQ ID NO. 11);

[0065] qPCR-sppl-R1: GATAGAAACGGCATCACCATCA (SEQ ID NO. 12).

[0066] The primers for amplification of the internal reference gene (L25 ribosomal protein) are as follows:

[0067] L25-F:cccctcaccacagagtctgc(SEQ ID NO.13);

[0068] L25-R: aagggtgttgttgtcctcaatctt (SEQ ID NO. 14).

[0069] Each sample was repeated three times, and the reaction system was as follows:

[0070]

[0071] Amplification conditions: 95°C for 30 s; 95°C for 10 s, 60°C for 10 s, for a total of 32 cycles.

[0072] Melting curve: 95℃10s, 60℃60s, 95℃-0.29℃ / s.

[0073] The results showed that the expression of tobacco pectin lyase gene spl in the leaves of edited plant 423 was significantly reduced compared with the expression in the leaves of control (untransformed) plants, i.e., normal plants. Figure 1 As shown.

[0074] Example 4

[0075] Take 10 mature leaves of plant 423 with homozygous editing of spl gene and 10 leaves of control plant, freeze-dry and grind into powder for pigment detection. The specific detection method is as follows:

[0076] The obtained edited plants and control (untransformed) plants were tested for pigment content. The testing method is as follows:

[0077] Accurately weigh 0.2g (accurate to 0.1mg) of the freeze-dried sample into a 50mL conical flask, add 25mL of the extractant (90% acetone solution), and perform ultrasonic extraction for 20min under ice bath. Take an appropriate amount of the supernatant and filter it through a 0.45μm organic micro-membrane. Place the filtrate in a brown chromatographic bottle and analyze it by high performance liquid chromatography. The results are as follows Figure 2 The results showed that the contents of various pigments in the leaves of plants with edited spl genes were significantly increased compared with those of control (untransformed) plants, including neoxanthin, lutein, chlorophyll a and chlorophyll b.

[0078] Example 5

[0079] The root length, root dry weight, stem height, and aboveground dry weight of the 423 edited materials grown in the laboratory were measured on the 40th day (period 1), 47th day (period 2), and 54th day (period 3) after sowing. Figure 3As shown in the figure, with the growth and development, the values ​​of various indicators showed an increasing trend. Compared with the control, the stem height of 423 material was lower than that of the red control in period 1, the root length was significantly longer than that of the red control in period 2, and the aboveground dry weight was significantly higher than that of the red control in period 3. There were no significant differences in other indicators with the control. The phenotypic results are consistent with the results of pigment detection to a certain extent. After the content of plastid pigment increases, the aboveground part grows more vigorously.

[0080] Example 6

[0081] Accurately weigh 1.00 g of the first-cured tobacco of the edited plant 423, place it in a 20 mL brown headspace bottle, add 1 mL of saturated sodium chloride solution, quickly tighten the bottle cap, and use SPME / GC-MS analysis; the SPME extraction head is aged at 100 ° C for 30 minutes, the sample extraction temperature is 100 ° C, the extraction is 20 minutes; the desorption time is 2 minutes. The GC / MS analysis conditions are: chromatographic column: DB-5MS capillary column (30m×0.25mmi.d.×0.25μmd.f.); carrier gas: He; constant flow mode flow rate: 1.0mL / min; split ratio: 10:1. Inlet temperature: 280 ° C; program temperature rise: 40 ° C (maintained for 2.0 minutes) at 8 ° C / min to 280 ° C (maintained for 10 minutes). Transmission line temperature: 280℃; ionization mode: electron impact source (EI); ion source temperature: 220℃; electron energy: 70eV; solvent delay time: 1.0min; detection mode: full scan monitoring mode; mass scanning range: 30~400amu. The NIST spectral library was used for qualitative search and semi-quantitative analysis was performed by comparing the peak area with the internal standard. Edited material 423 The aroma components of neophytadiene, β-damascenone and 6-methyl-5-hepten-2-one in the flue-cured tobacco leaves increased significantly compared with the control.

[0082] The analysis results of some aroma components of edited material 423 tobacco leaves and control samples are shown in Table 1.

[0083] Table 1 Analysis results of some aroma components of comparison and editing material 423

[0084]

[0085]

[0086] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. A method for increasing the content of pigment in tobacco plastids, characterized in that: The method comprises knocking out a pectin lyase-like gene (SPL) in a tobacco plant, wherein the nucleotide sequence of the SPL gene is shown in SEQ ID NO.1, and after the SPL gene is knocked out, the contents of neoxanthin, lutein, chlorophyll a and chlorophyll b in tobacco leaves are increased.

2. The method for increasing the pigment content of tobacco leaves according to claim 1, characterized in that: Gene knockout is performed through CRISPR / Cas9-mediated gene editing technology, which includes the following steps: (1) selecting a more specific 23 nt nucleotide sequence in the gene as the guide sequence of CRISPR / Cas9, and connecting the sequence fragment with the CRISPR / Cas9 vector, transforming and PCR amplification detection, and PCR positive cloning to obtain a CRISPR / Cas9-spl editing vector; wherein the more specific 23 nt nucleotide sequence in the gene is shown in SEQ ID No. 8; (2) Using Agrobacterium tumefaciens-mediated genetic transformation, the editing vector CRISPR / Cas9-spl was transformed into tobacco plants, and transformation-positive and editing-positive plants were screened and identified. The editing-positive plants had increased tobacco leaf plastid pigment content compared to the control untransformed plants.

3. An application of a gene affecting tobacco plastid pigment synthesis in increasing the content of tobacco plastid pigment, characterized in that: The gene is a pectin lyase-like gene (SPL), the nucleotide sequence of the SPL gene is shown in SEQ ID NO.1, and after the SPL gene is knocked out, the contents of neoxanthin, lutein, chlorophyll a and chlorophyll b in tobacco leaves are increased.

Images