HSV vectors with enhanced replication in cancer cells

By inserting NF-κB or Oct3/4-SOX2 response elements into the HSV vector, the replication and oncolytic activity of the virus in cancer cells are enhanced, solving the problem of resistance of existing oncolytic viruses to cancer stem cells and achieving more effective killing of cancer cells.

CN115960966BActive Publication Date: 2026-02-06VIROGIN BIOTECH CANADA LTD
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202211203616.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2016-04-29
Filing Date
2017-04-29
Publication Date
2026-02-06
Estimated Expiration
2037-04-29

AI Technical Summary

Technical Problem

Existing commercial oncolytic viruses suffer from low efficiency and resistance to cancer stem cells when treating cancer, making it difficult to effectively kill cancer cells.

Method used

By inserting NF-κB or Oct3/4-SOX2 response elements into the viral gene regulatory region of the HSV vector, the replication efficiency of the virus in cancer cells can be enhanced, and combined with substances encoding therapeutic substances such as IL12, IL15, OX40L, PDL-1 blockers or PD-1 blockers, the killing effect on cancer cells can be improved.

Benefits of technology

It enhanced the replication and oncolytic activity of HSV vectors in cancer cells, and improved the killing efficiency against cancer stem cells and other cancer cells, especially in cancer types where the NF-κB pathway is activated.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115960966B_ABST
    Figure CN115960966B_ABST
Patent Text Reader

Abstract

Oncolytic HSV vectors comprising NF-κB response elements or Oct-3 / 4-SOX2 response elements in the regulatory regions of viral genes that affect the efficiency of viral replication.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 62 / 329,877, filed April 29, 2016, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0003] The present patent application relates generally to HSV vectors with enhanced replication in cancer cells. BACKGROUND

[0004] In addition to direct cell killing by the virus, oncolytic viruses (OVs) have emerged as a therapeutic arsenal for specifically destroying cancer cells through an oncolytic effect, a killing mechanism characterized by lysis of cancer cells through a process of viral replication. Among various OVs, oncolytic type 1 herpes simplex virus ("HSV-1") based OVs are the most advanced, e.g., the FDA in the United States has approved a herpes virus-based OV (T-Vec) for the treatment of melanoma. Representative examples of HSV vectors include those described in U.S. Patent Nos. 7,223,593; 7,537,924; 7,063,835; 7,063,851; 7,118,755; 8,277,818; and 8,680,068.

[0005] The present application overcomes the shortcomings of current commercialized oncolytic viruses and further provides additional unexpected benefits. SUMMARY

[0006] Briefly, the present application provides HSV vectors with enhanced replication in cancer cells. In one embodiment, the HSV vectors provided comprise an NF-κΒ responsive element in the regulatory region of a viral gene that affects viral replication efficiency. Other claims relate to HSV vectors comprising an Oct3 / 4-SOX2 responsive element in the regulatory region of a viral gene that affects viral replication efficiency. Viral genes with one or both of these responsive elements include US11 and genes encoding ICP4, ICP27, and ICP8.

[0007] Other claims are directed to vectors wherein the NF-κΒ response element comprises 1-15 tandem sequences of GGGAATTTCC (SEQ ID NO: 1) or a variant thereof, wherein the variant has at least one nucleotide difference from the sequence. The tandem sequences can be identical, or a mixture of identical and different sequences or all different sequences. Other claims are directed to vectors wherein the OCT3 / 4-SOX2 response element comprises CTACAGAGGTGCATATTAACAGAGCTTTTGTCCTGGAGA (SEQ ID NO: 2) or a variant thereof, wherein the variant has at least 90% identical nucleotides.

[0008] In other claims, the HSV vector can further comprise a sequence encoding a therapeutic substance for cancer treatment. The therapeutic substance can be IL12, IL15, OX40L, a PDL-1 blocker, or a PD-1 blocker. One example of a suitable blocker is described in U.S. Patent Application No. 15 / 374,893, filed December 9, 2016, which is incorporated by reference herein in its entirety.

[0009] Other claims are directed to methods of treating cancer, comprising administering to a patient having cancer or suspected of having cancer an HSV vector described herein. In other claims, methods of treating cancer stem cells and treating refractory cancer are provided, comprising administering to a patient having refractory cancer or cancer having cancer stem cells an HSV vector described herein. In other claims, the cancer is colon cancer, lung cancer, breast cancer, prostate cancer, brain cancer, or bladder cancer.

[0010] Certain concepts have been presented in the Summary section in brief, which will be further described below in the DETAILED DESCRIPTION section. The Summary section is neither intended to identify key or essential features of the claimed subject matter, nor is it intended to limit the scope of the claimed subject matter.

[0011] The details of one or more implementations are set forth in the description below. Features illustrated and described in connection with one exemplary implementation can be combined with features of other implementations. Thus, any combination of the various implementations described herein is contemplated. Modifications to the implementations described in this disclosure will be apparent to those of ordinary skill in the art based upon this description. Other features, objects, and advantages of the implementations described in this disclosure will be apparent from the description and drawings. The description and drawings are illustrative of the implementations and are not intended to limit the scope of the subject matter claimed. BRIEF DESCRIPTION OF DRAWINGS

[0012] The exemplary features of the disclosure, its nature, and various advantages will become apparent from the following detailed description of the drawings and the various embodiments as illustrated in the drawings. The non-limiting and non-exhaustive embodiments are described with reference to the following drawings wherein like references or identification numbers refer to like parts, unless otherwise indicated. The sizes and relative positions of elements in the drawings attached hereto are not necessarily drawn to scale. For example, the shapes of various elements can have been selected for improved drawing legibility. Certain shapes can have been selected to more clearly and lucidly illustrate the features of the application. One or more embodiments are described below with reference to the accompanying drawings, in which:

[0013] Figures 1A-1B is a schematic of an exemplary oHSV vector.

[0014] Figure 2 is a graphical representation showing enhanced virus production of an exemplary oHSV-1 vector carrying NF-κΒ response elements in the regulatory region of ICP4 in the presence of TNFα.

[0015] Figures 3A-3B is a schematic and sequence (SEQ ID NO: 3) of OS-ICP27.

[0016] Figures 4A-4B is a schematic and sequence (SEQ ID NO: 4) of NO-ICP27-145.

[0017] Figures 5A-5B is a schematic and sequence (SEQ ID NO: 5) of NO-ICP27-99.

[0018] Figure 6 is a schematic showing the modified ICP34.5 region of virus hVG161 (SEQ ID NO: 6).

[0019] Figure 7 is a schematic showing the modified UL54 promoter region of virus hVG161 (SEQ ID NO: 7).

[0020] Figure 8 is a schematic showing the hVG161 viral genome with insertion of a PD-L1 blocker (SEQ ID NO: 8).

[0021] Figure 9 is a schematic of hVG161 (SEQ ID NO: 9) showing the modified TR region.

[0022] Figures 10A-10K shows assay results of viruses comprising mutations in the ICP27 promoter / regulatory region.

[0023] Figures 11A-11C ELISA and Western blot data for IL-12 expression following hVG161 infection of cells are shown.

[0024] Figures 12A-12C ELISA and Western blot data for IL-15 expression following hVG161 infection of cells are shown.

[0025] Figures 13A-13C ELISA and Western blot data for IgG4 expression following hVG161 infection of cells are shown.

[0026] Figures 14A-14E Results for cells infected with VG161-PLBh and VG161-15h are shown.

[0027] Figures 15A-15D Results of r in vitro assays for various constructs are shown. Figures 15A-15B Results of cell transfection with IL-TF-Fc plasmids carrying IL-12, IL-15, and PD-L1 blockers are shown. Figures 15C-15D Results for cells infected with various mutant viruses, including hVG161, are shown.

[0028] Figures 16A-16E Results of cell viability assays for hVG161 and HSV-345 on human tumor cell lines and Vero cell lines are shown.

[0029] Figures 17A-17J Results of in vitro assays for various constructs are shown. Figures 17A-17E Results of cell viability assays for mVG161 and HSV-345 are shown above; Figures 17F-17J Characterization of transgene expression following infection of CT26 mouse tumor cells with mVG161 or VG001 is shown.

[0030] Figures 18A-18E Results of in vitro characterization of transgene expression following infection of various cell lines with hVG161 or VG001 are shown.

[0031] Figures 19A-19G Results of assays to evaluate the ability of hVG161 to kill various human cancer cells in vitro are shown.

[0032] Figures 20A-20G Results of in vivo assays for mVG161 and hVG161 constructs are shown.

[0033] Figures 21A-21C Growth curves for different viruses on three different human cell lines are shown.

[0034] Figures 22A-22D Growth curves of mVG161 and HSV-345 on mouse tumor cell lines and Vero cell lines are shown.

[0035] Figures 23A-23E Growth curves of hVG161 and HSV-345 on human tumor cell lines and Vero cell lines are shown.

[0036] Figures 24A-24D Growth curves of NO-ICP27 and HSV-345 on various cell lines are shown. DETAILED DESCRIPTION

[0037] The present application can be more easily understood in view of the following detailed description of the preferred embodiments and the examples included therein. Briefly stated, the present disclosure provides compositions and methods for treating cancer using HSV vectors comprising sequences responsive to NF-κΒ or Oct-3 / 4-SOX2 or both transcriptional activators.

[0038] In certain embodiments of the present application, the present disclosure provides methods and compositions for providing to a cancer cell, typically in vivo, to a subject in need of cancer treatment. The term "cancer" as used herein refers to cancer of any kind and origin, including refractory cancers (e.g., cancers resistant to conventional irradiation and / or chemotherapy); cancer stem cells, tumor forming cells, blood cancers, and transformed cells. The term "cancer cell" as used herein includes a cancer cell or tumor forming cell, a transformed cell, or a cell susceptible to becoming a cancer cell or tumor forming cell. Representative forms of cancer include carcinomas, sarcomas, myelomas, leukemias, lymphomas, and mixed types of the above. Other examples include, but are not limited to, those discussed in detail below.

[0039] Some cancer cells, particularly cancer stem cells, are often resistant to the oncolytic effects induced by oncolytic HSV-1 viruses. To increase the therapeutic effect of oHSV-1, the viral genes that regulate viral replication can be modified in their regulatory regions to insert an NFkB responsive element or an Oct3 / 4-SOX2 responsive element or both to enable the expression of the gene in infected cells, particularly in response to activation of NFkB. Since the NFkB pathway is often upregulated in cancer cells cancer stem cells, such modification will enhance the virus production and oncolytic activity of oHSV for more effective cell killing.

[0040] A. NF-κB and Oct-3 / 4-SOX2 response elements

[0041] Oct-3 / 4-SOX2 complex (also known as Oct-3, Oct4, and Pou5fl) and NF-κΒ are expressed in many different tumors. Oct4 and SOX2 are transcription factors expressed in stem cells. These two proteins form a complex to bind to regulatory regions of genes involved in maintaining stem and pluripotent cells. In cancer stem cells, they maintain a "stemness" state. Cancer stem cells have been identified in many solid malignancies. They are a small population of tumor cells with stem cell characteristics that are a possible cause of relapse in cancer patients. NF-κΒ (nuclear factor-κΒ) is a group of transcription factors. In essentially all unstimulated nucleated cells, the NFκΒ complex is bound to an inhibitor of NFκΒ (IκΒ) protein. When dissociated from this inhibitor, NF-κΒ translocates into the nucleus and targets sequences of enhancer elements that activate or increase gene transcription. NF-κΒ is activated in many cancer types, including hepatocellular carcinoma, lymphoma, leukemia, colon cancer, lung cancer, breast cancer, prostate cancer, brain cancer, and bladder cancer. It is also activated in cancer stem cells.

[0042] The response element for NFκΒ includes a decamer binding sequence. The most common sequence is GGGAATTTCC (SEQ ID NO: 1), but variants can also be targets. Typically, the variants will have one or two differences from the most common sequence.

[0043] Some inhibited NFκΒ binding sequence variants include:

[0044] Table 1

[0045]

[0046] The NF-κΒ response element contains at least one binding sequence and can contain 2 up to 15 binding sequences arranged in tandem. When there is more than one sequence, the more than one sequence can be the same or different. For example, a response element containing five binding sequences can have all five sequences the same, or four sequences the same and one different, or three sequences the same and two different, or two sequences the same and three different, or five different sequences. Also, the tandem response element can have nucleotides between the elements. There can be one to about ten additional nucleotides.

[0047] Oct-3 / 4 binds the octamer sequence ATTTGCAT. Sox2 binds to the octamer sequence CTTTTGTC. The Oct4 / Sox2 heterodimer has been found to bind to CTACAGAGGTGCATATTAACAGAGCTTTTGTCC-TGGAGA [SEQ ID No. 2] or variants of this sequence. (Wang et al. J Biol Chem 282: 12822, 2007). Variants are typically at least 90% identical, or at least 95% identical, or at least 98% identical to this sequence.

[0048] Oct-3 / 4-Sox2 response elements comprise at least one of the binding sequences and can comprise from two up to as many as 15 binding sequences arranged in tandem. Where there is more than one sequence, the sequences can be identical or different. For example, a response element comprising five binding sequences can have all five identical sequences, or four identical sequences and one different sequence, or three identical sequences and two different sequences, or two identical sequences and three different sequences, or five different sequences. Also, the tandem response element can have nucleotides between the elements. There can be one to about ten additional nucleotides.

[0049] Some possible variants of sequences for binding the Oct4 / Sox2 complex can be found in MOLECULAR AND CELLULAR BIOLOGY (July 2005, p. 6031-6046) and include:

[0050] CTTTGTTATGCATCT SEQ ID NO. 35

[0051] CATTGTGATGCATAT SEQ ID NO. 36

[0052] CATTGTAATGCAAAA SEQ ID NO. 37

[0053] CATTGTTATGCTAGT SEQ ID NO. 38

[0054] CATTGTTATGATAAA SEQ ID NO. 39

[0055] CTTTGTTTGGATGCTAAT SEQ ID NO. 40.

[0056] The vector can contain a mixture of NF-κΒ and Oct-3 / 4-Sox 2 response elements. When each is present, the response elements are typically arranged in tandem, as seen in the construct of Example 2. The order of the response elements can be 5' of either element. It is also contemplated that more than one NF-κΒ or more than one Oct-3 / 4-Sox 2 response element or more than one of each response element can be present. Where more than one of each element is present, they can be in any order. Moreover, additional nucleotides can be present between the response elements.

[0057] B. HSV vector constructs

[0058] Oncolytic viruses are viruses that lyse cancer cells (oncolytic effect), preferably in a selective manner. Viruses that replicate selectively in differentiated cells are typically oncolytic.

[0059] Herpes simplex (HSV) 1 and 2 are members of the Herpesviridae family that infect humans. The HSV genome contains two distinct regions, known as the long unique (UL) region and the short unique (US) region. Each of these regions has a pair of terminal inverted repeats on the side. There are approximately 75 known open reading frames. The viral genome is designed to develop an oncolytic virus for use in, for example, cancer therapy. Mutation of the HSV ICP34.5 (also known as γ34.5) gene brings about tumor-selective replication of HSV. HSV contains two copies of ICP34.5. Mutants are known that inactivate one or both copies of the ICP34.5 gene, thereby lacking neurovirulence, i.e., nonpathogenic / non-neurovirulent and oncolytic.

[0060] Suitable oncolytic HSVs can be derived from HSV-1 or HSV-2, including any laboratory strain or clinical isolate. In some embodiments, the oHSV can be or can be derived from one of the laboratory virus strains HSV-1 strain 17, HSV-1 strain F, or HSV-2 strain HG52. In other embodiments, it can be or can be derived from the non-laboratory strain JS-1. Other suitable HSV-1 viruses are in Table 2 below.

[0061] Table 2

[0062]

[0063] In some embodiments, the oHSV has one or both of the g34.5 genes modified so that it does not express a functional ICP34.5 protein. The gene can be modified by one or more nucleotide insertions, deletions, substitutions, etc. The change can be in the coding sequence, non-coding sequence (e.g., promoter), or both. In some embodiments, both copies of the g34.5 gene are mutated.

[0064] The oHSV can have additional mutations, which can include disabling mutations (e.g., deletions, substitutions, insertions) that affect the virulence of the virus or its ability to replicate. For example, mutations can be made in any one or more of ICP6, ICPO, ICP4, ICP27, ICP47, ICP 24, ICP56. Preferably, the mutation in one of these genes, if appropriate, optionally in both copies of the gene, results in the HSV being unable to (or having a reduced ability to) express the corresponding functional polypeptide. In some embodiments, the promoter of a viral gene is replaced with a promoter that is selectively activated or inducible in the target cell.

[0065] The oHSV can also have genes and nucleotide sequences that are not of HSV origin. For example, sequences encoding prodrugs, sequences encoding cytokines or other immunostimulatory factors, tumor-specific promoters, inducible promoters, enhancers, sequences homologous to host cells, and others can be present in the oHSV genome. Exemplary sequences encode IL12, IL15, OX40L, PDL-1 blockers, or PD-1 blockers.

[0066] The regulatory regions of viral genes encoding US11, ICP4, ICP27, and ICP can be modified to contain a response element (RS1 encodes ICP4; US11 encodes US11; UL54 encodes ICP27; UL29 encodes ICP8) that is responsive to NF-κΒ or Oct-3 / 4-SOX2 or both NF-κΒ and Oct-3 / 4-SOX2. The HSV-1 vector can have one viral gene containing one or both response elements. Alternatively, the vector can have more than one viral gene containing one or both response elements. Typically, the response element will be in the viral gene enhancer region. The response element can replace the viral enhancer or contain the response element in addition to the viral enhancer. The viral promoter can be replaced, typically with a tumor-specific promoter, such as a survivin promoter. Other tumor-specific promoters are known in the art. Other genetic elements can also be modified. For example, the 5' UTR of a viral gene can be replaced with an exogenous UTR.

[0067] C.Therapeutic compositions

[0068] Therapeutic compositions useful for preventing, treating, or mitigating the effects of cancer are provided. More specifically, some therapeutic compositions comprise an oncolytic virus as described herein. In preferred embodiments, the therapeutic composition can comprise an oncolytic virus as described herein.

[0069] In certain embodiments, the composition further comprises a pharmaceutically acceptable carrier. The phrase "pharmaceutically acceptable carrier" is intended to include any and all carriers, diluents, or excipients that do not interfere with the biological activity of the oncolytic virus and are nontoxic to the subject to whom the composition is administered (see generally, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st edition (May 1, 2005) and The United States Pharmacopeia: The National Formulary (USP 40-NF 35 and Supplements)).

[0070] Non-limiting examples of suitable pharmaceutical carriers in the context of the oncolytic viruses described herein include phosphate buffered saline solutions, water, emulsions (such as oil / water emulsions), various types of wetting agents, sterile solutions, and the like. Additional pharmaceutically acceptable carriers include gels, bioabsorbable matrix materials, implantable elements containing the oncolytic virus, or any other suitable vehicle, delivery or dispensing device or material. Such carriers can be formulated by conventional methods and administered to a subject in effective amounts. Additional pharmaceutically acceptable excipients include, but are not limited to, water, saline, polyethylene glycol, hyaluronic acid, and ethanol. Pharmaceutically acceptable salts can also be included here, such as salts of inorganic acids (e.g., hydrochloric, hydrobromic, phosphoric, sulfuric, and the like) and salts of organic acids (e.g., acetic, propionic, benzoic, and the like). Such pharmaceutically acceptable (pharmaceutical grade) carriers, diluents, and excipients useful for delivering oHSV to target cells will preferably not elicit an immune response in the individual (subject) receiving the composition (and are preferably administered without undue toxicity).

[0071] The compositions provided herein can be provided in a variety of concentrations. For example, the oncolytic virus can be provided in a range of about 10 6 to about 10 9 pfu. In further embodiments, the dosage form can range from about 10 6 to about 10 8pfu / ml, up to 4 ml injected into a patient every 2-3 weeks for treatment of patients with large lesions (e.g., >5 cm), and smaller amounts (e.g., 0.1 ml) injected in patients with small lesions (e.g., <0.5 cm).

[0072] In certain embodiments of the application, lower doses less than the standard dose can be used. Thus, in certain embodiments, less than about 10 6 pfu / ml (up to 4 ml injected into a patient every 2-3 weeks).

[0073] Compositions can be stored at temperatures suitable for stable shelf life, and include room temperature (about 20°C), 4°C, -20°C, -80°C, and in liquid N2. Since compositions intended for in vivo administration typically do not have preservatives, they are often stored at colder temperatures. Compositions can be stored in dry form (e.g., lyophilized) or in liquid form.

[0074] D. Administration

[0075] In addition to the compositions described herein, various methods are provided for treating or ameliorating cancer using such compositions, which include the step of administering to a subject an effective dose or amount of an HSV vector described herein.

[0076] The terms "effective dose" and "effective amount" refer to an amount of oncolytic virus sufficient to effectively treat a target cancer, e.g., an amount effective to reduce the size or load of a target tumor, or to impede the growth rate of a target tumor cell. More specifically, such terms refer to an amount of oncolytic virus effective to achieve the desired result at the necessary dose and duration of treatment. For example, in the context of treating cancer, an effective amount of a composition described herein is an amount that induces remission, reduces tumor load, and / or prevents the spread or growth of a tumor of a cancer. Effective amounts can vary depending on factors such as the disease state, age, sex, and weight of the subject, as well as the drug formulation, route of administration, and the like, but can be routinely determined by one of skill in the art.

[0077] A subject diagnosed with or suspected of having cancer is administered the therapeutic composition. The subject can be a human or a non-human animal.

[0078] The compositions can be used to treat cancer, the term "treatment" or "treating" as used herein means the process by which an advantageous or desired result (including clinical results) is obtained. The advantageous or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, reduction in severity of disease, stabilized state of disease (i.e., not worsening), prevention of disease spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of disease reoccurrence, and remission, whether partial or total, whether detectable or undetectable. The term "treatment" or "treating" also means prolonging survival as compared to expected survival if not receiving the treatment / treating.

[0079] Representative forms of cancer include carcinomas, leukemias, lymphomas, myelomas, and sarcomas. Other examples include, but are not limited to, bile duct cancer, brain cancer (e.g., glioblastoma), breast cancer, cervical cancer, colorectal cancer, CNS (e.g., acoustic neuroma, astrocytoma, craniopharyogioma, ependymoma, glioblastoma, hemangioblastoma, medulloblastoma, menangioma, neuroblastoma, oligodendroglioma, pinealoma, and retinoblastoma), endometrial intraepithelial carcinoma, hematopoietic cell cancer (e.g., leukemia and lymphoma), kidney cancer, laryngeal cancer, lung cancer, liver cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer (e.g., melanoma and squamous cell carcinoma), and thyroid. Cancer can include solid tumors (e.g., sarcomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, and osteosarcoma), have spread (e.g., leukemia), or a combination of these (e.g., metastatic cancer with both solid tumors and disseminated or spread cancer cells).

[0080] Benign tumors and other conditions of unwanted cell proliferation can also be treated.

[0081] The oHSV described herein can be administered by, for example, oral, topical, parenteral, systemic, intravenous, intramuscular, intraocular, intrathecal, intratumoral, subcutaneous, or transdermal routes. In certain embodiments, the oncolytic virus can be delivered by cannulation, through a catheter, or by direct injection. The site of administration can be intratumoral or a site remote from the tumor. The route of administration often depends on the cancer being targeted.

[0082] Optimal or suitable dosage regimens of the oncolytic virus are readily determined by those of skill in the art, by the attending physician, based on patient data, patient observations, and various clinical factors, including, for example, the subject's body weight, body surface area, age, sex, and the particular oncolytic virus being administered, the time and route of administration, the type of cancer to be treated, the patient's general health status, and other medications that the patient is undergoing. According to certain embodiments, treatment of a subject with the oncolytic viruses described herein can be combined with other types of treatment, for example, with chemotherapy, e.g., with a chemotherapeutic agent, such as etoposide, ifosfamide, doxorubicin, vincristine, doxycycline, and the like.

[0083] The oHSV can be formulated into pharmaceuticals and pharmaceutical compositions for clinical use, and can be combined with a pharmaceutically acceptable carrier, diluent, excipient, or adjuvant. The formulation will depend at least in part on the route of administration. Suitable formulations can include the virus and inhibitors in a sterile medium. The formulation can be in fluid, gel, paste, or solid form. The formulation can be provided to the subject or to a professional medical facility.

[0084] A therapeutically effective amount is preferably administered. It is an amount sufficient to show benefit to the subject. The actual amount administered, and rate and time of administration, will depend on the nature of the cancer, the condition of the subject, the delivery site, and other factors.

[0085] In still other embodiments of the application, the oncolytic virus is capable of intratumoral administration, or administration following surgical resection of the tumor.

[0086] The following examples are offered by way of illustration and not by way of limitation.

[0087] Example

[0088] Example 1

[0089] Enhancement of virus production

[0090] In this example, virus production was measured in the presence of an activator of NF-κB, TNFα. The virus has an NF-κB response element in the regulatory region of ICP4. Virus production was significantly enhanced in the presence of TNFα, which activates NF-κB. Figure 1A Figure 2

[0091] Example 2

[0092] Exemplary constructs

[0093] In this example, various sequences are shown.

[0094] ​​OS-ICP27 comprises a ZTP206 BS1 (Oct4 / Sox2 binding site) and a survivin promoter replacing the natural intergenic region between UL53 (glycoprotein K) and UL54 (ICP27) (Figure 3).

[0095] NO-ICP27-145 comprises a NF-kB response element and an Oct4 / Sox2 binding site (ZTP206 BS1) inserted into the intergenic region between UL53 (glycoprotein K) and UL54 (ICP27) at a position downstream of the UL53 (glycoprotein K) poly(A) and upstream of the UL54 (ICP27) TATA box (Figure 4).

[0096] NO-ICP27-99 comprises a NF-kB response element and an Oct4 / Sox2 binding site (ZTP206 BS1) inserted into the intergenic region between UL53 (glycoprotein K) and UL54 (ICP27) at a position downstream of the UL53 (glycoprotein K) poly(A) and upstream of the UL54 (ICP27) TATA box (Figure 5).

[0097] hVG161 comprises a modified ICP34.5 region Figure 6 ; SEQ ID NO. 6), a modified UL54 promoter-regulatory region Figure 7 ; SEQ ID NO. 7), a PD-L1 blocker Figure 8 ; SEQ ID No. 8) inserted into the intergenic region between UL3 and UL4, and a modified terminal repeat (TR) region Figure 9 ; SEQ ID NO. 9) carrying expression cassettes for IL-12, IL-15 and IL-15 receptor a subunit. The four viruses also have a modified and partially deleted ICP 34.5 region.

[0098] The mouse version of mVG161 is functionally identical to hVG161 except that mVG161 carries IL-12 and the mouse version of hVG161 carries a mouse PD-L1 blocker in the same position on the viral genome as the human PD-L1 blocker in hVG161.

[0099] Example 3

[0100] Abbreviations used in the subsequent examples

[0101] TF-Fc: PD-L1 blocking peptide (TF) fused to Fc and used to construct VG161.

[0102] IL-TF-Fc: Plasmid carrying IL-12, IL-15 and PD-L1 blocker.

[0103] HSV-345: ICP34.5-deleted virus.

[0104] OS-ICP27 2-11: ICP34.5-deleted virus with Oct4 / Sox2 binding sites and surviving promoter (OS) inserted into the promoter-regulatory region of ICP27 (OS-ICP27) that was not used to construct VG161.

[0105] OS-ICP27 5-7: ICP34.5-deleted virus with OS-ICP27 mutations that were not used to construct VG161.

[0106] NO-ICP27 1-4-4 (also referred to as NO-ICP27-145): ICP34.5-deleted virus with NF-kB response elements and Oct4 / Sox2 binding sites (NO) inserted into the promoter-regulatory region of ICP27 (NO-ICP27) at the 145 bp position upstream of the transcription start site of ICP27 and used to construct VG161.

[0107] NO-ICP27 5-2-2 (also referred to as NO-ICP27-99): ICP34.5-deleted virus with NF-kB response elements and Oct4 / Sox2 binding sites (NO) inserted into the promoter-regulatory region of ICP27 (NO-ICP27) at the 99 bp position upstream of the transcription start site of ICP27 and not used to construct VG161.

[0108] VG001 (also referred to as VG160): Backbone virus used to construct VG161 (NO-ICP27 1-4-4 mutant carrying heterologous promoters and poly(A) with empty MCS in the terminal repeat region despite the deletion of the viral genome for insertion of the IL-12 / IL-15 expression cassette, poly(A) side chain).

[0109] VG001-15h (also referred to as VG161-15h): VG001 carrying human IL-15.

[0110] VG001-1215h (also referred to as VG161-1215h): VG001 carrying human IL-12 and human IL-15.

[0111] VG001-PLBh (also referred to as VG161-PLBh): VG001 carrying human PD-L1 blocker inserted into the intergenic region between UL3 and UL4.

[0112] 8-8-15 RA1-PDL1b: VG001 carrying human IL-15 and human PD-L1 blocker.

[0113] VG161-1215PLBm (also referred to as mVG161): VG001 carrying mouse IL-12, human IL-15 and mouse PD-L1 blocker.

[0114] VG161-1215PLBh (also referred to as hVG161 or VG161): VG001 carrying human IL-12, human IL-15 and human PD-L1 blocker.

[0115] Example 4

[0116] Results of exemplary constructs comprising mutations in the ICP27 promoter / regulatory region.

[0117] In this example, cells were infected with viruses having mutations in the ICP27 promoter-regulatory region.

[0118] In Example 4, Vero, LS174T, 293FT, H460, U87wt and LNCaP cells were infected with the HSV-1 mutants at MOI 0.01, 0.1 and 1. Cell viability was quantitatively analyzed 72 hours post-infection using the MTT assay. Figures 10A-10G

[0119] In Example 4, Vero, LS174T, 293FT, H460, U87wt and LNCaP cells were infected with the HSV-1 mutants at MOI 0.01, 0.1 and 1. Cell viability was quantitatively analyzed 72 hours post-infection using the MTT assay. Figures 10H-10I Figure 10H In Example 4, Vero, 293FT, LS174T, H460 and LNCaP cells were infected with HSV-1 mutants NO-ICP27 1-4-4 and NO-ICP27 5-2-2 with or without induction with 20 ng / mL of TNFalpha at MOI 1. Infected cells were harvested 5 hours post-infection and cell lysates were probed with anti-ICP27 and anti-actin antibodies to detect ICP27 and actin expression, respectively. For the protein blot, actin was used as a loading control. Band intensity was quantitatively analyzed and used to evaluate ICP27 expression normalized to actin. Figure 10I

[0120] In Example 4, Vero, 293FT, LS174T, H460 and LNCaP cells were infected with HSV-1 mutants NO-ICP27 1-4-4 and NO-ICP27 5-2-2 with or without induction with 20 ng / mL of TNFalpha at MOI 1. Infected cells were harvested 5 hours post-infection and cell lysates were probed with anti-ICP27 and anti-actin antibodies to detect ICP27 and actin expression, respectively. For the protein blot, actin was used as a loading control. Band intensity was quantitatively analyzed and used to evaluate ICP27 expression normalized to actin. Figures 10J-10K ​​​Vero, U87 and LS174T cells were infected with HSV-1 mutants NO-ICP27 1-4-4 and NO-ICP27 5-2-2 at MOI of 1 with or without 20 ng / mL of TNFa induction. Cells were harvested 24 hours post-infection and subjected to one freeze / thaw cycle to complete the split of infected cells, after which they were titrated on Vero cells. Figure 10J The raw titration data are shown, while Figure 10K are shown in the graphs of data. The NO-ICP27 mutants exhibited enhanced replication in Vero, U87 and LS174T cells following TNFa induction. The NO-ICP27 1-4-4 mutant was ultimately selected as the backbone for insertion of the PD-L1 blocking and IL-12 / IL-15 expression cassettes to generate the final VG161 mutant virus. Figure 10J

[0121] Example 5

[0122] Expression of IL-12 following infection of cells with hVG161

[0123] In this example, Western blot and ELISA data for IL-12 expression are shown.

[0124] Figure 11A Western blot results following infection of VG161-1215PLBh virus are shown. H460 tumor cells were infected with VG161-1215PLB or VG001 virus (MOI = 1) for 24 hours. Cell lysates were prepared, loaded on 12% SDS-PAGE gels, and transferred to PVDF membranes. The membranes were analyzed by Western blot using anti-human IL-12 antibody followed by HRP-conjugated anti-mouse IgG secondary antibody, and images were detected and analyzed using the Bio-Rad ImageLab system.

[0125] Figures 11B-11C ​Protein blotting and ELISA data showing upregulation of IL-15 expression following infection of cells with hVG161.

[0126] Example 6

[0127] Expression of IL-15 following infection of cells with hVG161

[0128] In this example, protein blotting and ELISA data showing upregulation of IL-15 expression following infection of cells with hVG161.

[0129] Figure 12A Protein blotting results showing upregulation of IL-15 expression following infection of cells with hVG161-1215PLBh virus. H460 tumor cells were infected with VG161-1215PLB or VG001 virus (MOI = 1) for 24 hours. Cell lysates were prepared, loaded on a 12% SDS-PAGE gel, and transferred to a PVDF membrane. The membrane was probed with anti-human IL-15 antibody followed by HRP-conjugated anti-mouse IgG secondary antibody, and images were detected and analyzed using the Bio-Rad ImageLab system.

[0130] Figures 12B-12C Protein blotting results showing upregulation of IL-15 expression following infection of cells with hVG161-1215PLBh virus. H460 tumor cells were infected with VG161-1215PLB or VG001 virus (MOI = 1) for 24 hours. Cell lysates were prepared, loaded on a 12% SDS-PAGE gel, and transferred to a PVDF membrane. The membrane was probed with anti-human IL-15 antibody followed by HRP-conjugated anti-mouse IgG secondary antibody, and images were detected and analyzed using the Bio-Rad ImageLab system.

[0131] Example 7

[0132] IgG4 expression after infection of cells with hVG161

[0133] In this example, Western blot and ELISA data showing IgG4 expression are shown.

[0134] Figure 13A Western blot results after infection with VG161-1215PLBh virus are shown. H460 tumor cells were infected with VG161-1215PLB or VG001 virus (MOI = 1) for 24 hours. Cell lysates were prepared, loaded on 12% SDS-PAGE gels, and transferred to PVDF membranes. The membranes were blotted with HRP-conjugated anti-human IgG antibodies, and images were detected and analyzed with the Bio-Rad ImageLab system.

[0135] Figures 13B-13C Production of human PD-L1 blocker (fused to human Fc domain) is upregulated after infection with VG161-1215PLBh virus is shown. LS174T or H460 tumor cells were infected with VG161-1215PLB or VG001 virus (MOI = 1) for 48 hours. Infected cell supernatants were harvested and bound to 96-well ImmunoMaxisorp flat bottom plates coated with anti-human IgG4 capture antibody. Binding was detected via biotinylated anti-human IgG4 antibody, avidin-horseradish peroxidase (HRP), and 3,3',5,5'-tetramethylbenzidine (TMB) substrate. Absorbance measurements were collected at 450 nm via a plate reader. Concentrations of human IgG4 in the cultured supernatants were calculated based on a human IgG4 standard curve.

[0136] Example 8

[0137] In vitro potency of viruses VG161-pLBh and VG161-15h

[0138] In this example, 3 x 10 4 H460 or LS174T tumor cells were seeded into each well of a 96-well plate and incubated overnight at 37°C. The next day, the seeded cells were infected with VG001 backbone, VG161-PLBh, or VG161-15h virus (MOI = 1) for 24 hours, and production of human IL-12, human IL-15, and human IgG4 was evaluated Figure 14A - Figure 14C ) Subsequently, 3 x 10 5 human PBMCs were added to the cultures and co-incubated for 24 hours to evaluate cytotoxicity by LDH assay Figure 14DAlternatively, co-culture for 48 hours to evaluate human IFNg production via ELISA. Figure 14E For cytotoxicity assays, the percentage of cytotoxicity is calculated based on the following formula: [(actual reading – minimum release) / (maximum release – minimum release)] × 100%. The supernatant harvested from tumor cells incubated only with the culture medium is used as the minimum release, while the supernatant harvested from tumor cells incubated with lysis buffer is used as the maximum release.

[0139] Example 9

[0140] In vitro efficacy of various constructs

[0141] Figures 15A-15D The results of in vitro measurements for various constructs are shown.

[0142] Figures 15A-15B The results of cell transfection using the IL-TF-Fc plasmid carrying IL-12, IL-15, and PD-L1 inhibitors are shown. Figures 15A-15B In this study, different tumor cell lines were transfected with IL-TF-Fc plasmid DNA for 24 hours, and then human PBMCs were added to the culture. Cytotoxicity was quantitatively analyzed 24 hours after LDH assay. Figure 15A ), and 48 hours after the detection of human IFNg production using ELISA assay. Figure 15B Harvest the cell supernatant.

[0143] Figures 15C-15D Results of cell infection with various mutant viruses, including hVG161, are shown. Virus-encoded IL12, IL15, and PD-L1 inhibitors synergistically enhanced IFNg production and cytotoxicity. H460 tumor cells were seeded into each well of a 96-well plate and incubated overnight at 37°C. The next day, the seeded cells were infected with the described virus at MOI=1 for 24 hours. Human PBMCs were then added to the culture and co-cultured for 24 hours to evaluate cytotoxicity by LDH assay. Figure 15C Alternatively, after 48 hours of co-culturing, ELISA results can be generated using the IFNg assay performed by the ELISA evaluator. Figure 15D For cytotoxicity assays, the percentage of cytotoxicity is calculated based on the following formula: [(actual reading – minimum release) / (maximum release – minimum release)] × 100%. The supernatant harvested from tumor cells incubated only with the culture medium is used as the minimum release, while the supernatant harvested from tumor cells incubated with lysis buffer is used as the maximum release.

[0144] exist Figures 16A-16EIn vitro, a panel of 9 different human tumor cell lines (+ Vero cells) was infected with VG161-1212PLBh (VG161h) and HSV-345 viruses at MOI of 0, 0.04, 0.2, 1 and 5. Cell viability was quantitatively analyzed 48 hours post-infection using MTT assay.

[0145] Figures 17A-17J Results of in vitro assays of various constructs are shown. Figures 17A-17E Results of cell viability assays against mVG161 and HSV-345 on mouse tumor cell lines and Vero cell line are shown. Figures 17F-17J Results of transgene expression characterization after infection of CT26 mouse tumor cells with mVG161 or VG001 are shown.

[0146] In Figures 17A-17E , a panel of 6 different mouse tumor cell lines (+ Vero cells) was infected with VG161m and HSV-345 viruses at MOI of 0, 0.04, 0.2, 1 and 5. Cell viability was quantitatively analyzed 48 hours post-infection using MTT assay.

[0147] In Figures 17F-17J , 3x10 4 CT26 tumor cells were seeded in each well of a 96-well plate and incubated overnight at 37°C. The next day, cells were infected with VG001 backbone or VG161-1215PLBm viruses (MOI=1) for 24 hours and production of mouse IL-12, human IL-15 and mouse IgG was evaluated Figure 17F , Figure 17G , Figure 17H . Subsequently, 3x10 5 spleen cells from Balb / c mice were added to the cultures and co-cultured for 24 hours to evaluate cytotoxicity by LDH Figure 17J or for 48 hours to evaluate mouse IFNg production by ELISA Figure 17I . For cytotoxicity assays, the percentage of cytotoxicity was calculated based on the following formula: [(actual reading - minimal release) / (maximal release - minimal release)]x100%. Supernatants harvested from tumor cells incubated with media only were used as minimal release, while supernatants harvested from tumor cells incubated with lysis buffer were used as maximal release.

[0148] In Figures 18A-18E , 3x10 4H460, LS174T or UMUC3 tumor cells were seeded into each well of a 96-well plate and incubated at 37°C overnight. The next day, the seeded cells were infected with VG001 backbone and VG161-1215h virus (MOI = 1) for 24 hours, and human IL-12, human IL-15 and human IgG4 production was evaluated (18R). Subsequently, 3 x 10 5 PBMCs were added to the cultures and co-cultured for 24 hours to evaluate human IFNy production by LDH cytotoxicity (18S) or co-cultured for 48 hours to evaluate human IFNy production by ELISA (18T). For the cytotoxicity assay, the percentage of cytotoxicity was calculated based on the following formula: [(actual reading - minimal release) / (maximum release - minimal release)] x 100%. Supernatant from tumor cells incubated with media only was used as the minimal release, while supernatant from tumor cells incubated with lysis buffer was used as the maximum release.

[0149] In Figures 19A-19G In

[0150] Example 11

[0151] In vivo efficacy of VG161 virus constructs

[0152] In Figures 20A-20B In

[0153] In Figures 20C-20D In 6 ​VG161-1215PLBm(mVG161) virus at 5 x 105PFU / mouse or VG001 backbone virus or PBS (vehicle control). Tumor size measurements were taken at the indicated times post-injection. VG161-1215PLBm treated mice exhibited a significant (P < 0.05) reduction in tumor volume compared to PBS treated mice.

[0154] In Figures 20E-20G , oHSV treatment of xenograft human prostate tumors in mice was evaluated. Twelve mice were implanted with LNCaP human prostate tumor cells in the right lower abdomen. Thirty-five days post-implantation, 6 animals were randomly selected as a group and injected intratumorally five times with 5 x 105PFU / mouse of VG161-1215PLBm (mVG161) virus, and the remaining 6 animals served as vehicle controls and were injected twice with an equal volume of PBS. Tumor size measurements were taken using two different methods. Caliper measurements were expressed as a fold change in tumor volume at a given time point compared to tumor volume at the time of virus or PBS injection (Fig. 2A). Whole animal bioluminescent imaging was also used to monitor tumor growth. Signal intensity was quantitatively analyzed as the sum of photons detected per second (Fig. 2B). Quantitative imaging of tumor growth using the IVIS system showed even more reduction in tumor size in oHSV treated animals compared to PBS treated controls, with fluorescence dropping to undetectable levels 50 days post-tumor implantation (Fig. 2B). 7 VG161-1215PLBh (hVG161) virus at 5 x 105PFU / mouse, and the remaining 6 animals served as vehicle controls and were injected twice with an equal volume of PBS. Tumor size measurements were taken using two different methods. Caliper measurements were expressed as a fold change in tumor volume at a given time point compared to tumor volume at the time of virus or PBS injection (Fig. 3A). Whole animal bioluminescent imaging was also used to monitor tumor growth. Signal intensity was quantitatively analyzed as the sum of photons detected per second (Fig. 3B). Quantitative imaging of tumor growth using the IVIS system showed even more reduction in tumor size in oHSV treated animals compared to PBS treated controls, with fluorescence dropping to undetectable levels 50 days post-tumor implantation (Fig. 3B). Figure 20E ) at the end of 15 days, while the vehicle treated mice showed an approximately 3-fold increase in tumor volume over the same time interval. Tumor growth was also monitored using a whole animal bioluminescent imaging system (IVIS Imaging System; Xenogen, Mountain View, CA). Signal intensity was quantitatively analyzed as the sum of photons detected per second (Fig. 4B). Quantitative imaging of tumor growth using the IVIS system showed even more reduction in tumor size in oHSV treated animals compared to PBS treated controls, with fluorescence dropping to undetectable levels 50 days post-tumor implantation (Fig. 4B). Figure 20F ) at the end of 15 days, while the vehicle treated mice showed an approximately 3-fold increase in tumor volume over the same time interval. Tumor growth was also monitored using a whole animal bioluminescent imaging system (IVIS Imaging System; Xenogen, Mountain View, CA). Signal intensity was quantitatively analyzed as the sum of photons detected per second (Fig. 4B). Quantitative imaging of tumor growth using the IVIS system showed even more reduction in tumor size in oHSV treated animals compared to PBS treated controls, with fluorescence dropping to undetectable levels 50 days post-tumor implantation (Fig. 4B). Figure 20G ) at the end of 15 days, while the vehicle treated mice showed an approximately 3-fold increase in tumor volume over the same time interval. Tumor growth was also monitored using a whole animal bioluminescent imaging system (IVIS Imaging System; Xenogen, Mountain View, CA). Signal intensity was quantitatively analyzed as the sum of photons detected per second (Fig. 4B). Quantitative imaging of tumor growth using the IVIS system showed even more reduction in tumor size in oHSV treated animals compared to PBS treated controls, with fluorescence dropping to undetectable levels 50 days post-tumor implantation (Fig. 4B).

[0155] Example 12

[0156] hVG161 replication in cell lines

[0157] The growth curves in Figs. 21-24 combined with the cytotoxicity data show hVG161 virus replication and parental HSV-345 virus. These data also show that the virus does not grow in mouse tumor cell lines compared to human cell lines, but HSV-1 is known to grow poorly in mouse cells.

[0158] The following are additional exemplary embodiments disclosed herein:

[0159] 1) An HSV vector comprising a NF-κΒ responsive element in a regulatory region of a viral gene that affects viral replication efficiency.

[0160] 2) An HSV vector comprising an Oct-3 / 4-SOX2 responsive element in a regulatory region of a viral gene that affects viral replication efficiency.

[0161] 3) The vector of embodiment 1 or 2, wherein the viral gene encodes ICP4, ICP27, US11 or ICP8. In other aspects of embodiments 1 and / or 2, the HSV vector is an HSV-1 vector.

[0162] 4) The vector of any one of embodiments 1 to 3, wherein the NF-κΒ responsive element comprises 1-15 tandem sequences of GGGAATTTCC or variants in Table 1.

[0163] 5) The vector of embodiment 4, wherein the tandem sequences are identical, or a mixture of identical and different sequences or all different sequences.

[0164] 6) The vector of embodiment 4, wherein the NF-κΒ responsive element has the sequence GGGAATTTCCGGGGACTTTCCGGGAATTTCCGGGGACTTTCCGGGAATTTCC.

[0165] 7) The vector of embodiment 2, wherein the OCT-3 / 4-SOX2 complex responsive element comprises SEQ ID NO: 2 or a variant thereof, wherein the variant has at least 90% identical nucleotides.

[0166] 8) The vector of any one of embodiments 1-7, further comprising a sequence encoding a therapeutic substance for cancer treatment.

[0167] 9) The HSV vector of embodiment 8, wherein the therapeutic substance is IL12, IL15, OX40L, PDL-1 blocker and / or PD-1 blocker.

[0168] 10) A method of treating cancer, comprising administering to a patient in need thereof an HSV-1 vector according to any one of embodiments 1-9.

[0169] 11) A method of treating cancer stem cells and refractory cancer, comprising administering to a patient having refractory cancer or cancer with cancer stem cells an HSV vector according to any one of embodiments 1-9.

[0170] 12) The method of embodiments 10-11, wherein the cancer is colon cancer, lung cancer, breast cancer, prostate cancer, brain cancer, or bladder cancer.

[0171] It will be understood that, while the present application has been described in connection with specific embodiments thereof, various modifications can be made therein without departing from the spirit and scope of the application. Therefore, the present application should not be limited to the specific embodiments described herein.

[0172] All of the U.S. patents, U.S. patent application publications, U.S. patent publications, foreign patents, foreign patent applications, and non-patent publications referred to in this specification and / or listed in the Application Data Sheet are hereby incorporated by reference in their entirety for all purposes. The references cited in this specification are incorporated by reference herein for the purpose of describing and disclosing, for example, the materials and methodologies described in the publications that might be used in connection with the presently described application. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such publications by virtue of prior application.

[0173] All patents, publications, scientific articles, web sites, and other documents and materials referenced in this specification are hereby incorporated by reference in their entirety for all purposes. To the extent that any publication, document, or other reference is cited in this specification, the citation is not an admission that the application is not entitled to antedate such publication, document, or reference.

[0174] In general, the terms used in the following claims should not be construed to limit the claims to the specific embodiments disclosed in the specification and claims herein, but should be construed to include all possible embodiments and equivalents thereof falling within the scope of the claims. Accordingly, the claims are not limited to the disclosure.

[0175] Furthermore, the written description portion of this patent document includes all the claims. Moreover, the claims as filed are included in the written description portion of this patent document and applicant reserves the right to amend the claims to affirmatively set forth such claims in the written description portion of this patent document. Therefore, the patent should not be construed as admitting that the patent does not provide a written description of the exact language of the claims.

[0176] Other non-limiting embodiments are contained in the following claims. This patent shall not be construed as limited to the specific examples or non-limiting embodiments or methods described herein. If the applicant has not expressly recited in the written description that a specific embodiment or non-limiting embodiment or method is adopted, the patent shall not be construed as being limited in any way to any statement or recitation by any examiner or any other official or employee of the Patent and Trademark Office.

[0177] References

[0178] 1. Goldsten DJ and Weller SK, Herpes simplex virus type 1 -induced ribonucleotide reductase activity is dispensable for virus growth and DNA synthesis: isolation and characterization of an ICP6 lacZ insertion mutant. J. Virol. 62, 196-205, 1988

[0179] 2. Mineta T, Rabkin SD, Yazaki T, Hunter WD and Martuza RL. Attenuated multi- mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nature medicine. 1995; 1(9):938-943.

[0180] 3. Kooby DA, Carew JF, Halterman MW, Mack JE, Bertino JR, Blumgart LH, Federoff HJ and Fong Y. Oncolytic viral therapy for human colorectal cancer and liver metastases using a multi-mutated herpes simplex virus type-1 (G207). The FASEB journal. 1999; 13(11): 1325-1334.

[0181] 4. Todo T, Martuza RL, Rabkin SD and Johnson PA. Oncolytic herpes simplex virus vector with enhanced MHC class I presentation and tumor cell killing. Proceedings of the National Academy of Sciences. 2001; 98(11): 6396-6401.

[0182] 5. Mace A, Ganly I, Soutar DS and Brown SM. Potential for efficacy of the oncolytic Herpes simplex virus 1716 in patients with oral squamous cell carcinoma. Head & neck. 2008; 30(8): 1045-1051.

[0183] 6. Harrow S, Papanastassiou V, Harland J, Mabbs R, Petty R, Fraser M, Hadley D, Patterson J, Brown S and Rampling R. HSV1716 injection into the brain adjacent to tumour following surgical resection of high-grade glioma: safety data and long-term survival. Gene therapy. 2004; 11(22): 1648-1658.

[0184] 7. Nakao A, Kasuya H, Sahin T, Nomura N, Kanzaki A, Misawa M, Shirota T, Yamada S, Fujii T and Sugimoto H. A phase I dose-escalation clinical trial of intraoperative direct intratumoral injection of HF10 oncolytic virus in non-resectable patients with advanced pancreatic cancer. Cancer gene therapy. 2011; 18(3): 167-175.

[0185] 8. Fong Y, Kim T, Bhargava A, Schwartz L, Brown K, Brody L, Covey A, Karrasch M, Getrajdman G and Mescheder A. A herpes oncolytic virus can be delivered via the vasculature to produce biologic changes in human colorectal cancer. Molecular Therapy. 2009; 17(2): 389-394.

[0186] 9. Andtbacka RH, Kaufman HL, Collichio F, Amatruda T, Senzer N, Chesney J, Delman KA, Spitler LE, Puzanov I and Agarwala SS. Talimogene laherparepvec improves durable response rate in patients with advanced melanoma. Journal of Clinical Oncology. 2015: JCO.2014.2058.3377.

[0187] 10. Gaston DC, Odom CI, Li L, Markert JM, Roth JC, Cassady KA, Whitley RJ and Parker JN. Production of bioactive soluble interleukin-15 in complex with interleukin-15 receptor alpha from a conditionally-replicating oncolytic HSV-1. PloS one. 2013; 8(11): e81768.

[0188] 11. Parker JN, Gillespie GY, Love CE, Randall S, Whitley RJ and Markert JM. Engineered herpes simplex virus expressing IL-12 in the treatment of experimental murine brain tumors. Proceedings of the National Academy of Sciences. 2000; 97(5): 2208-2213.

[0189] 12. Passer BJ, Cheema T, Wu S, Wu C, Rabkin SD and Martuza RL. Combination of vinblastine and oncolytic herpes simplex virus vector expressing IL-12 therapy increases antitumor and antiangiogenic effects in prostate cancer models. Cancer gene therapy. 2013; 20(1): 17-24.

[0190] 13. Carew JF, Kooby DA, Halterman MW, Kim S-H, Federoff HJ and Fong Y. A novel approach to cancer therapy using an oncolytic herpes virus to package amplicons containing cytokine genes. Molecular Therapy. 2001; 4(3): 250-256.

[0191] 14. Kambara H, Okano H, Chiocca EA and Saeki Y. An oncolytic HSV-1 mutant expressing ICP34.5 under control of a nestin promoter increases survival of animals even when symptomatic from a brain tumor. Cancer Research. 2005; 65(7): 2832-2839.

[0192] 15. Fukuhara H, Ino Y, Kuroda T, Martuza RL and Todo T. Triple Gene-Deleted Oncolytic Herpes Simplex Virus Vector Double-Armed with Interleukin 18 and Soluble B7-1 Constructed by Bacterial Artificial Chromosome–Mediated System. Cancer research. 2005; 65(23): 10663-10668.

Claims

1. An HSV vector comprising an NF-κB response element in the regulatory region of a viral gene that affects the efficiency of viral replication, wherein, The HSV is HSV-1, the NF-κB response element comprises 1-5 tandem sequences selected from SEQ ID NO. 1, 10-34, and the viral gene encodes ICP4, ICP27, US11 or ICP8.

2. The vector of claim 1, wherein, The tandem sequences are completely identical, or a mixture of identical and different sequences or all different sequences.

3. The vector of claim 1, wherein, The NF-κB response element sequence is GGGAATTTCCGGGGACTTTCCGGGAATTTCCGGGGACTTTCCGGGAATTTCC.

4. The vector of any one of claims 1-3, further comprising a sequence encoding IL12, IL15, OX40L, PDL-1 blocker or PD-1 blocker for cancer treatment.

5. Use of the HSV vector of any one of claims 1-4 in the preparation of a medicament for treating cancer, which is colon cancer, lung cancer, breast cancer, prostate cancer, brain cancer or bladder cancer.

Citation Information

Patent Citations

  • Compositions and methods for inhibiting CD279 interactions

    US20180141975A1

  • Virus strains

    US7063835B2

  • Herpes viruses for immune modulation

    US7063851B2

  • Herpes viruses for immune modulation

    US7118755B2

  • Herpes virus strains for gene therapy

    US7223593B2