A single-base localization analysis method for 5-methylcytosine in DNA mediated by DNA methyltransferase combined with cytosine deaminase

Abstract

The present invention provides a single-base positioning analysis method and kit of 5-methylcytosine in DNA mediated by a DNA methyltransferase combined with a cytosine deaminase, the method comprising: using DNA methyltransferase to perform a carboxymethylation labeling reaction on the DNA to be tested, and then denaturing the DNA to inactivate the DNA methyltransferase and terminate the reaction to obtain a carboxymethylation-labeled DNA; using cytosine deaminase to perform a deamination reaction on the carboxymethylation-labeled DNA, and then performing a high-temperature inactivation treatment to inactivate the cytosine deaminase and terminate the reaction to obtain a deaminated DNA sample; the deaminated DNA sample is subjected to a PCR reaction to obtain an amplified product; the amplified product is sequenced to obtain the site information of 5-methylcytosine. The method is independent of bisulfite treatment, and has high selectivity, is simple to operate, and can directly obtain the single-base resolution positioning information of 5-methylcytosine in DNA.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a single base positioning analysis method and a kit for 5-methylcytosine in DNA mediated by DNA methyltransferase combined with cytosine deaminase. Background Art

[0002] 5-Methylcytosine (5mC) is the most prevalent epigenetic modification in mammals. 5mC plays an important role in regulating gene expression. Alterations in DNA methylation profiles at the local or global level are associated with a variety of biological and pathological processes, such as embryonic development, X chromosome inactivation, and tumorigenesis. In the mammalian genome, 5mC is mainly present in CG dinucleotide sequences and is catalyzed by DNA methyltransferases (DNMTs) using S-adenosyl-L-methionine (SAM) as a methyl donor.

[0003] In mammalian genomes, approximately 70-80% of cytosine in CG dinucleotides is methylated, and accurate detection of 5mC has far-reaching significance for disease diagnosis. At present, the detection of 5mC is divided into two categories, including overall 5mC content detection and sequencing analysis. Existing methods for detecting the overall content of 5mC in DNA mainly include liquid chromatography / mass spectrometry (LC / MS), thin layer chromatography (TLC), and electrochemical detection. These methods generally require hydrolysis and digestion of DNA and cannot provide positional information of 5mC in the DNA sequence. Among the sequencing methods of 5mC, immunoprecipitation-based sequencing methods have been used for the localization analysis of 5mC in DNA, such as methylated DNA immunoprecipitation sequencing (MeDIP-seq) and methyl CpG binding domain sequencing (MBD-seq). However, these immunoaffinity enrichment-based methods cannot detect 5mC at single-base resolution and are more inclined to enrich highly methylated regions. Restriction enzyme-based methods (such as MRE-seq and Methyl-MAPS) are capable of analyzing 5mC with single-base resolution, but their reliance on sequence-specific endonucleases limits CG coverage, and incomplete enzyme digestion may lead to high false-positive results.

[0004] Bisulfite sequencing (BS-seq) has been widely used for the localization analysis of 5mC. In BS-seq, cytosine is deaminated to uracil after bisulfite treatment, but 5mC resists deamination and does not undergo conversion. C and 5mC can be distinguished by sequencing because they are read as thymine and cytosine, respectively. However, BS-seq requires harsh chemical deamination conditions, which leads to up to 99.9% DNA degradation. Subsequently, TET-assisted pyridine borane sequencing (TAPS) was developed for the sequencing of 5mC. In TAPS, 5mC is oxidized to 5-carboxycytosine (5caC) by TET proteins, and then 5caC is reduced to dihydrouracil by pyridine borane. Dihydrouracil pairs with adenine in subsequent PCR amplification, thus achieving the conversion of 5mC to thymine, thereby achieving the sequencing of 5mC. Recently, an EM-seq method has been developed to map 5mC. In EM-seq, human apolipoprotein B mRNA editing catalytic subunit 3A (APOBEC3A, A3A) deaminase is used to deaminate cytosine to form uracil; while 5mC is oxidized to 5caC by TET proteins, and the converted 5caC is resistant to A3A deamination. This technology relies on enzymatic deamination of DNA, so bisulfite treatment is not required. However, EM-seq involves the preparation of three enzymes and two different sequencing libraries, and the method is complicated. In addition, both TAPS sequencing and EM-seq sequencing involve TET proteins oxidizing 5mC to 5caC. However, TET proteins cannot completely oxidize 5-mC to 5caC, resulting in false negative results.

[0005] Therefore, it is necessary to develop a method for detecting 5mC with single-base resolution and quantification without the need for bisulfite treatment. Summary of the invention

[0006] In order to solve the technical problem, the present invention provides a single-base positioning analysis method of 5-methylcytosine in DNA mediated by DNA methyltransferase combined with cytosine deaminase, which is independent of bisulfite treatment, has high selectivity and is simple to operate.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] In a first aspect of the present invention, a single base location analysis method of 5-methylcytosine in DNA mediated by DNA methyltransferase combined with cytosine deaminase is provided, the method comprising:

[0009] Carboxyl methylation labeling reaction is performed on the DNA to be tested by using DNA methyltransferase, followed by denaturation treatment to inactivate the DNA methyltransferase and terminate the reaction, thereby obtaining carboxyl methylation labeled DNA;

[0010] Using cytosine deaminase to deaminate the carboxymethylated labeled DNA, and then performing a high temperature inactivation treatment to inactivate the cytosine deaminase to terminate the reaction, thereby obtaining a deaminated DNA sample;

[0011] The deaminated DNA sample is subjected to PCR reaction to obtain an amplified product;

[0012] The amplified product is sequenced to obtain the site information of 5-methylcytosine.

[0013] Furthermore, the conditions of the carboxymethylation labeling reaction are as follows: double-stranded DNA is reacted at 30-45° C. for 0.5-6 hours in a reaction system containing Tris-HCl 5-20 mM, pH 7.0-8.5, NaCl 20-100 mM, dithiothreitol 0.2-2 mM, EDTA 0.2-2 mM, carboxyl-S-adenosyl-L-methionine 80-640 mM, and M.MpeI-N374K protein 1-10 μM.

[0014] Furthermore, the denaturation treatment method is: incubating the DNA at a high temperature of 90 to 98° C. for 2 to 30 minutes in the presence of 0 to 60% DMSO.

[0015] Furthermore, the conditions of the deamination reaction are: DNA is reacted at 30-45° C. for 0.5-4 hours in a reaction system containing 10-30 mM 2-(N-morpholino)ethanesulfonic acid, 0.05-0.5% Triton X-100, pH 5.5-7.5, and 1-10 μM A3A protein.

[0016] Furthermore, the conditions of the high temperature inactivation treatment include: incubating in a 92-98° C. water bath for 5-20 min.

[0017] In a second aspect of the present invention, there is provided a use of a combination of a DNA methyltransferase and a cytosine deaminase in an analytical method for single-base resolution positioning of 5-methylcytosine in DNA.

[0018] In a third aspect of the present invention, a kit for single-base resolution positioning of 5-methylcytosine in DNA is provided, the kit comprising DNA methyltransferase and cytosine deaminase.

[0019] Furthermore, the kit also includes:

[0020] The reaction system for carboxymethylation using DNA methyltransferase: Tris-HCl 5-20 mM, pH 7.0-8.5, NaCl 20-100 mM, dithiothreitol 0.2-2 mM, EDTA 0.2-2 mM, carboxyl-S-adenosyl-L-methionine 80-640 mM, M.MpeI-N374K protein 1-10 μM;

[0021] Reaction system for deamination using cytosine deaminase: DNA is reacted at 30-45° C. for 0.5-4 hours in a reaction system containing 10-30 mM 2-(N-morpholino)ethanesulfonic acid, 0.05-0.5% Triton X-100, pH 5.5-7.5, and 1-10 μM A3A protein.

[0022] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0023] The present invention provides a single base location analysis method for 5-methylcytosine in DNA mediated by DNA methyltransferase combined with cytosine deaminase, the principle of which is shown in Figure 1 , the mutant of DNA methyltransferase M.MpeI-N374K, with carboxy-S-adenosyl-L-methionine as a cofactor, selectively transfers the carboxyl methyl group to the C5 position of cytosine in the CG dinucleotide to form 5-carboxymethylcytosine. After treatment with cytosine deaminase A3A protein, 5-carboxymethylcytosine can resist deamination and is therefore amplified as cytosine in the subsequent polymerase chain reaction amplification, while the target analyte 5mC cannot be labeled by DNA methyltransferase and can be completely deaminated by A3A and amplified as thymine in the subsequent polymerase chain reaction. Therefore, only 5-methylcytosine can be read as thymine in the final sequencing. It has the following advantages:

[0024] (1) The method of the present invention is simple to operate and does not require complicated sample pretreatment;

[0025] (2) There is no need to treat the DNA sample with bisulfite. The reaction conditions are mild and will not cause a large amount of DNA degradation. Single-base resolution positioning information of 5-methylcytosine in DNA can be directly obtained.

[0026] (3) The method of the present invention requires a small amount of DNA, and only 100 ng of genomic DNA is required to perform positioning analysis on 5mC.

[0027] (4) The present invention does not require TET protein to oxidize 5mC, thus avoiding the problem of false negative results caused by incomplete TET oxidation.

[0028] (5) The DNA methyltransferase of the present invention has a high efficiency (>90%) in transferring carboxymethyl groups, which is beneficial for the accurate analysis of 5mC.

[0029] (6) The cytosine deaminase 5mC involved in the present invention has a high deamination efficiency (97%), while the deamination efficiency of 5camC is very low (<0.1%), which is conducive to the localization analysis of 5mC with high accuracy.

[0030] (7) The method of the present invention can be widely applied to the study of the localization and quantification of 5mC modification in DNA, and is helpful for a more in-depth study of the biological function of 5mC. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0032] Figure 1 Schematic diagram of the present invention. In the present invention, C is labeled with a carboxymethyl group by M.MpeI-N374K to generate 5camC, which can resist the deamination of A3A protein, while 5mC is not labeled and can be converted to T by A3A. Therefore, during sequencing, only 5mC can be read as T.

[0033] Figure 2 In the present invention, denaturing polyacrylamide gel electrophoresis is used to detect the efficiency of artificially synthesized DNA chains (49-CG-FAM) labeled by DNA methyltransferase M.MpeI wild type (WT) and mutant type (N374K).

[0034] Figure 3 A is a comparison chart of 5camC content before and after deamination treatment of the artificially synthesized DNA chain detected by LC-MS / MS in the present invention after carboxymethylation labeling.

[0035] Figure 3 B is a comparison chart of 5mC content before and after deamination treatment of the artificially synthesized 5mC-modified DNA chain detected by LC-MS / MS in the present invention after carboxymethylation labeling.

[0036] Figure 4 A is the readout result of Sanger sequencing of the artificially synthesized DNA chain without 5mC modification (DNA-C) and the DNA chain modified with 5mC (DNA-5mC) in the present invention after carboxymethylation labeling with M.MpeI-N374K and treatment with A3A protein, wherein the C in DNA-C is not mutated after carboxymethylation labeling and treatment with A3A protein and is still read as C; the 5mC in DNA-5mC is mutated to T after carboxymethylation labeling and A3A deamination.

[0037] Figure 4 B is the correlation between the T / (C+T) peak height ratio at the TCG site and the theoretical 5mC content measured by the method of the present invention after mixing different proportions of artificially synthesized DNA chains without 5mC modification (DNA-C) and 5mC modified DNA chains (DNA-5mC).

[0038] Figure 4 C is the correlation between the T / (C+T) peak height ratio at the CCG site measured by the method of the present invention and the theoretical 5mC content after mixing different proportions of artificially synthesized DNA chains without 5mC modification (DNA-C) and 5mC modified DNA chains (DNA-5mC).

[0039] Figure 4 D is the correlation between the T / (C+T) peak height ratio at the GCG site measured by the method of the present invention and the theoretical 5mC content after mixing different proportions of artificially synthesized DNA chains without 5mC modification (DNA-C) and 5mC modified DNA chains (DNA-5mC).

[0040] Figure 4 E is the correlation between the T / (C+T) peak height ratio at the ACG site measured by the method of the present invention and the theoretical 5mC content after mixing different proportions of artificially synthesized DNA chains without 5mC modification (DNA-C) and 5mC modified DNA chains (DNA-5mC).

[0041] Figure 5 A is the single-base resolution detection of 5mC in the promoter of RARB gene in DNA of human lung cancer and adjacent tissues by the method of the present invention. The negative control is the result of direct deamination of genomic DNA by A3A protein.

[0042] Figure 5 B is the quantitative result of 5mC content of 9 CG sites in the promoter region of RARB gene in lung cancer para-tumor and lung cancer tissue DNA by the method of the present invention. um, unmethylated. ns, no significant difference; *p<0.05 (n=3); **p<0.01 (n=3); ***p<0.001 (n=3).

[0043] Figure 5 C is a correlation analysis of the 5mC content in the promoter region of the RARB gene of lung cancer para-tissue DNA by the method of the present invention and bisulfite sequencing. The results show that the two have a good correlation, with a Pearson correlation coefficient of 0.937.

[0044] Figure 5D is a correlation analysis of the 5mC content in the promoter region of the RARB gene of lung cancer tissue DNA by the method of the present invention and the bisulfite sequencing method. The results show that the two have a good correlation, and the Pearson correlation coefficient is 0.916.

[0045] Figure 6 To evaluate the degradation of DNA in the method of the present invention and the bisulfite sequencing method, different starting amounts of DNA were treated with the method of the present invention and the commercial bisulfite method (QIAGEN), and then PCR amplified, and the amplified products were separated and detected on 1.5% agarose gel. DETAILED DESCRIPTION

[0046] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0047] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0048] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0049] The technical solution provided by the embodiment of the present invention is to solve the above technical problems, and the overall idea is as follows:

[0050] According to a typical embodiment of the present invention, a single base location analysis method of 5-methylcytosine in DNA mediated by DNA methyltransferase combined with cytosine deaminase is provided, the method comprising:

[0051] S1. Carboxymethylation labeling reaction is performed on the DNA to be tested by using DNA methyltransferase, followed by denaturation treatment to inactivate the DNA methyltransferase and terminate the reaction, thereby obtaining carboxymethylation-labeled DNA;

[0052] In the step S1,

[0053] The conditions of the carboxymethylation labeling reaction are: double-stranded DNA is reacted at 30-45°C for 0.5-6 hours in a reaction system containing Tris-HCl 5-20mM, pH 7.0-8.5, NaCl 20-100mM, dithiothreitol 0.2-2mM, EDTA 0.2-2mM, carboxyl-S-adenosyl-L-methionine 80-640mM, and DNA methyltransferase (M.MpeI-N374K protein) 1-10μM. In a specific embodiment, the concentration of M.MpeI-N374K protein is determined specifically according to the activity of the actual protein. The conditions of the carboxymethylation labeling reaction are conducive to ensuring the activity of DNA methyltransferase and the efficiency of the carboxymethylation labeling reaction.

[0054] The denaturation treatment method is: incubating the DNA at a high temperature of 90 to 98° C. for 2 to 30 minutes in the presence of 0 to 60% DMSO. The denaturation treatment is beneficial to the subsequent deamination reaction.

[0055] Preferably, the DNA methyltransferase is the M.MpeI-N374K protein having an amino acid sequence as shown in SEQ ID NO.1.

[0056] A CG-specific methyltransferase, M.MpeI, was discovered in Mycoplasma penetrans. The study found that a mutant of M.MpeI (M.MpeI-N374K protein) can transfer a carboxylmethyl group from carboxy-S-adenosyl-L-methionine (caSAM) to cytosine at the CG to form 5-carboxymethylcytosine (5camC). With the unique properties of 5camC, we proposed a method for the quantitative detection of 5mC without bisulfite treatment, with single-base resolution, to sequence 5mC in DNA by combining methyltransferase labeling with A3A deamination.

[0057] S2, using cytosine deaminase to perform a deamination reaction on the carboxymethylated labeled DNA, and then performing a high temperature inactivation treatment to inactivate the cytosine deaminase to terminate the reaction, thereby obtaining a deaminated DNA sample;

[0058] In the step S2,

[0059] The conditions of the deamination reaction are as follows: DNA is reacted at 30-45° C. for 0.5-4 hours in a reaction system containing 10-30 mM 2-(N-morpholino)ethanesulfonic acid, 0.05-0.5% Triton X-100, pH 5.5-7.5, and 1-10 μM A3A protein. The reason for selecting the buffer composed of the above components is to ensure the activity of the deaminase and the efficiency of the deamination reaction.

[0060] The conditions for the high temperature inactivation treatment include: incubating in a water bath at 92-98° C. for 5-20 minutes. This reaction condition is conducive to the inactivation of cytosine deaminase, thereby facilitating the subsequent PCR amplification process.

[0061] As a preferred embodiment, the cytosine deaminase is the A3A protein having an amino acid sequence as shown in SEQ ID NO.2.

[0062] S3, subjecting the deaminated DNA sample to a PCR reaction to obtain an amplified product;

[0063] In the PCR reaction, specific primers are used to amplify the carboxymethyl protected and deaminated DNA. The amplified product is subjected to agarose gel electrophoresis, gel excision and purification, and Sanger sequencing. Corresponding primers need to be designed for different DNA to be tested.

[0064] S4. Sequence the amplified product to obtain the site information of 5-methylcytosine.

[0065] If PCR amplification obtains a DNA fragment of a specific sequence, the amplified product can be directly subjected to Sanger sequencing; if PCR amplification forms a DNA library, the amplified product will be subjected to high-throughput sequencing.

[0066] As a specific implementation, the specific operation steps of the method are:

[0067] (1) Synthesis of carboxy-S-adenosyl-L-methionine.

[0068] (2) Prepare a high concentration storage solution of M.MpeI-N374K reaction buffer: Tris-HCl 100 mM, pH 7.0-8.5, NaCl 500 mM, dithiothreitol 10 mM, EDTA 10 mM.

[0069] (3) Prepare a high concentration stock solution of A3A reaction buffer: 200 mM 2-(N-morpholino)ethanesulfonic acid (MES), 1% triton X-100, pH 5.5-7.5.

[0070] (4) Express and purify M.MpeI-N374K protein.

[0071] (5) Express and purify A3A protein.

[0072] (6) Extract DNA from biological samples and remove RNA from the DNA using RNase A enzyme.

[0073] (7) Take 100 ng of the extracted DNA and fragment it by ultrasonication to a fragment size of 300-500 bp.

[0074] (8) The DNA fragmented in step (7) was freeze-dried and spin-dried, and 2 μL of water, 0.5 μL of carboxy-S-adenosyl-L-methionine synthesized in step (1) (final concentration 80-640 mM), 0.5 μL of M.MpeI-N374K reaction buffer prepared in step 2, and 2 μL of M.MpeI-N374K protein were added, and the mixture was reacted at 30-45° C. for 0.5-6 hours. After the reaction, the sample was heated to 75-98° C. for denaturation for 2-30 minutes to inactivate the protein.

[0075] (9) Add 2 to 12 μL of DMSO to the DNA in step (8), add water to 16 μL, incubate in a 90 to 98°C water bath for 2 to 30 minutes, and then immediately transfer to an ice water bath for quenching. Add 2 μL of the A3A reaction buffer prepared in step (1), add 2 μL of A3A protein (final concentration 1 to 10 μM), and react at 30 to 45°C for 0.5 to 4 hours. After the reaction is completed, heat the sample to 75 to 98°C for denaturation for 2 to 30 minutes to inactivate the protein.

[0076] (8) PCR reaction to obtain amplified products, followed by sequencing and analysis.

[0077] According to another typical implementation of the present invention, there is provided an application of a combination of a DNA methyltransferase and a cytosine deaminase in an analytical method for single-base resolution positioning of 5-methylcytosine in DNA.

[0078] According to another typical implementation of the present invention, a kit for single-base resolution positioning of 5-methylcytosine in DNA is provided, the kit comprising: DNA methyltransferase and cytosine deaminase.

[0079] The kit also includes:

[0080] The reaction system for carboxymethylation using DNA methyltransferase: Tris-HCl 5-20 mM, pH 7.0-8.5, NaCl 20-100 mM, dithiothreitol 0.2-2 mM, EDTA 0.2-2 mM, carboxy-S-adenosyl-L-methionine 80-640 mM, M.MpeI-N374K protein 1-10 μM;

[0081] Reaction system for deamination using cytosine deaminase: DNA is reacted at 30-45° C. for 0.5-4 hours in a reaction system containing 10-30 mM 2-(N-morpholino)ethanesulfonic acid, 0.05-0.5% Triton X-100, pH 5.5-7.5, and 1-10 μM A3A protein.

[0082] The effects of the present application will be described in detail below in conjunction with the examples and experimental data. Unless otherwise specified, the technical means used in the examples include nucleic acid extraction, enzymatic hydrolysis and polymerase chain reaction, which are conventional means well known to those skilled in the art.

[0083] Example 1. Using artificially synthesized DNA chains to distinguish between cytosine and 5-methylcytosine

[0084] A. Synthesis of Carboxy-S-adenosyl-L-methionine

[0085] In order to use DNA methyltransferase M.MpeI-N374K for carboxymethylation labeling, the carboxymethyl donor carboxy-S-adenosyl-L-methionine (caSAM) was first synthesized. The synthesis method is as follows: 10 mg of S-adenosyl-L-homocysteine ​​was dissolved in 1.7 mL of 150 mM ammonium bicarbonate aqueous solution, 340 mg of iodoacetic acid was added after mixing, and the mixture was reacted at 37°C for 24 hours. Then, 12 mL of ice methanol was added, and the mixture was allowed to stand at -80°C for 12 hours, centrifuged at 2000 rpm for 30 minutes at 4°C, washed twice with ice methanol, and the precipitate was separated by centrifugation. Finally, it was purified by liquid chromatography to obtain pure caSAM.

[0086] B. Carboxymethylation labeling verification

[0087] In order to verify the carboxylmethylation efficiency of the DNA methyltransferase M.MpeI-N374K in the present invention, a FAM-labeled 49 bp DNA chain was selected to react with the M.MpeI-N374K protein and caSAM, and the reaction efficiency was verified by restriction enzyme digestion combined with polyacrylamide gel electrophoresis.

[0088] (1) 49 bp DNA chain sequence

[0089] 5′-AATTATTAAAAATATATAAAAC C GGATTAAATATAATATAAATATAATT-FAM-3′

[0090] 3′-TTAATAATTTTTATATATTTTGG C CTAATTTATATTATATTTATATTAA-5′

[0091] (2) Carboxylation labeling of 49 bp DNA strand

[0092] The total reaction volume was 5 μL, including 2 μL of 1 μM 49 bp DNA chain, 0.5 μL of caSAM synthesized in step (1) (final concentration 320 mM), 0.5 μL of M.MpeI-N374K reaction buffer (Tris-HCl 100 mM, pH 8.0, NaCl 500 mM, dithiothreitol 10 mM, EDTA 10 mM) and 2 μL of M.MpeI-N374K protein (final concentration 3.2 μM), and the reaction was carried out at 37°C for 4 hours. After the reaction, the sample was heated to 95°C for denaturation for 5 minutes to inactivate the protein.

[0093] (3) Restriction enzyme digestion combined with polyacrylamide gel electrophoresis to verify the carboxymethylation efficiency

[0094] HpaII (NEB) is a restriction endonuclease that is sensitive to 5mC and can specifically recognize and cleave the CCGG sequence. When the second C in CCGG is replaced by 5mC, HpaII cannot cleave. Similarly, when the second C in CCGG is replaced by 5-carboxymethylcytosine (5camC), HpaII cannot cleave. Therefore, the carboxylation efficiency can be evaluated by detecting whether the DNA chain is protected from cleavage by HpaII ( Figure 2 ).

[0095] After the DNA reacted in step (2) above was slowly annealed to restore the double strand, 2 μL HpaII reaction buffer (NEB) and 1 μL HpaII (NEB) were added, and water was added to 20 μL, and the reaction was carried out at 37°C for 1 hour. After the reaction was completed, the sample was heated to 95°C for 5 minutes to denature the protein. The reaction products were separated and detected by 20% denaturing polyacrylamide gel electrophoresis. The results are shown in Figure 2 As shown, when caSAM was used as the carboxymethyl donor, the wild-type M.MpeI had no carboxymethyl transfer activity, while its mutant M.MpeI-N374K had a high methylation efficiency (>91%).

[0096] C. Analysis of deamination efficiency of 5-carboxymethylcytosine and 5-methylcytosine by liquid chromatography-tandem mass spectrometry

[0097] According to previous studies, cytosine deaminase A3A can efficiently deaminate C and 5mC, while the oxidation products of 5mC, such as 5caC, can strongly inhibit deamination. Based on this, the present invention verifies the deamination activity of 5-carboxymethylcytosine (5camC).

[0098] (1) Carboxymethylation labeling

[0099] The DNA templates required for the reaction are unmodified and 49 bp DNA containing 5mC modification.

[0100] Unmodified 49bp DNA:

[0101] 5′-AATTATTAAAAATATATAAAACCGGATTAAATATAATATAAATATAATT-3′ / 3′-TTAATAATTTTTATATATTTTGGCCTAATTTATATTATATTTATATTAA-5′.

[0102] 5mC modified 49bp DNA:

[0103] 5′-AATTATTAAAAATATATAAAAC 5m CGGATTAAATATAATATAAATATAATT-3′ / 3′-TTAATAATTTTTATATATTTTGG 5m CCTAATTTATATTATATTTATATTAA-5′.

[0104] The total reaction volume was 5 μL, including 1 μL 1 μM unmodified 49 bp DNA, 1 μL 1 μM 5mC modified 49 bp DNA, 0.5 μL caSAM (final concentration 320 mM), 0.5 μL M.MpeI-N374K reaction buffer (Tris-HCl 100 mM, pH 8.0, NaCl 500 mM, dithiothreitol 10 mM, EDTA 10 mM) and 2 μL M.MpeI-N374K protein (final concentration 3.2 μM), and the reaction was carried out at 37°C for 4 hours. After the reaction, the sample was heated to 95°C for 5 minutes to denature and inactivate the protein.

[0105] (2) DNA chain undergoes deamination reaction

[0106] Add 2 μL of DMSO to the DNA strand, add water to 16 μL, incubate in a 95°C water bath for 10 minutes, and then immediately transfer to an ice water bath for quenching. Add 2 μL of A3A reaction buffer (200 mM MES, 1% Triton X-100, pH 6.5), add 2 μL of A3A protein (final concentration 6 μM), and react at 37°C for 2 hours. After the reaction is completed, heat the sample to 95°C for 5 minutes to denature and inactivate the protein.

[0107] (3) Analysis of deamination efficiency of 5camC and 5mC by liquid chromatography-tandem mass spectrometry

[0108] The DNA treated with A3A was enzymatically hydrolyzed into nucleosides, and the changes in 5camC and 5mC contents before and after A3A treatment were analyzed by liquid chromatography-tandem mass spectrometry. Figure 3As shown in A-3B, the 5camC content did not decrease significantly after A3A treatment, and 99.9% of 5camC was still retained; while the 5mC content decreased significantly after A3A treatment, and the deamination efficiency reached 97%. This result shows that the A3A protein can deaminize 5mC efficiently, but cannot deaminize 5camC.

[0109] D. Sanger sequencing verifies that the method of the present invention can be used to distinguish C and 5mC

[0110] The differential deamination of 5mC and 5camC by A3A protein provided us with an opportunity to perform single-base resolution analysis of 5mC in DNA. We investigated the method of the present invention using Sanger sequencing.

[0111] (1) Synthesis of 216 bp DNA chain

[0112] In order to perform Sanger sequencing, a 216 bp DNA chain without modification and with 5mC modification (named DNA-C and DNA-5mC, respectively) was first synthesized and reacted with A3A protein, and the deamination rate was verified by mass spectrometry and Sanger sequencing.

[0113] In a 50 μL reaction system, add 0.5 ng pUC19 plasmid DNA (containing the target amplification sequence, purchased from Qingke Company), 5 μL 10× reaction buffer, 2.5 U Taq DNA polymerase (Takara), 2 μL 10 μM forward primer (sequence 5′-AGTGACGCTGAGCTTGACGTCGCGC-3′), 2 μL 10 μM reverse primer (sequence 5′-CCAACATTCCACTAACAATTACTCTCT-3′), 1 μL dATP, dGTP, TTP and dCTP (all at 2.5 mM). When synthesizing 5mC-modified DNA chains, 5mdCTP can be used instead of dCTP.

[0114] The polymerase chain reaction (PCR) program was as follows: (1) denaturation at 95°C for 2 min; (2) denaturation at 95°C for 15 s; (3) annealing at 52°C for 20 s; (4) extension at 72°C for 30 s; steps (2) to (4) were repeated 35 times; and extension at 72°C for 5 min. The PCR product was recovered and purified using a kit (Omega Bio-Tek Inc., Norcross, GA, USA). The concentration of the synthesized DNA was quantified using a micro-spectrophotometer.

[0115] The synthetic 216 bp DNA-C sequence is shown in SEQ ID NO.3; the synthetic 216 bp DNA-5mC sequence is shown in SEQ ID NO.4.

[0116] AGTGACGCTGAGCTTGACGTCGCCGATGAGAGGTGATTATGAGTATGTATAGTGTTAGGAAGAGTGTAGTAATAGGATGAAGATGATTATATGATCGATGGTCCGTATGCGTAGAATACGTTGTTGTAGTGATTATAATGGAGTGAGAATGTAGATGAGTGGAGTAGGTAGTAAGATGTAGTGGTGACAGAGAGTAATTGTTAGTGGAATGTTGG (SEQ ID NO. 3);

[0117] AGTGACGCTGAGCTTGACGTCGCGCGATGAGAGGTGATTATGAGTATGTATAGTGTTAGGAAGAGTGTAGTAATAGGATGAAGATGATTATATGAT 5m C GATGGT 5m C 5m C GTATG 5m C GTAGAATA 5m C GTTGTTGTAGTGATTATAATGGAGTGAGAATGTAGATGAGTGGAGTAGGTAGTAAGATGTAGTGGTGA 5m CAGAGAGTAATTGTTAGTGGAATGTTGG (SEQ ID NO. 4).

[0118] (2) Carboxymethylation and deamination of synthetic DNA chains

[0119] Take 10 ng of DNA-C or DNA-5mC and perform carboxymethylation reaction under the same conditions as step B (2). Then perform A3A deamination under the same conditions as step C (2).

[0120] (3) Sanger sequencing analysis

[0121] After carboxylation labeling and A3A treatment of the two synthetic DNA chains, PCR amplification was performed using specific primers (forward primer: 5'-AGTGACGTTGAGTTTGACGTC-3'; reverse primer: 5'-CCAACATTCCACTAACAATTACTCTCTA-3'). The amplification program was: denaturation at 95°C for 30s; 35 cycles including denaturation at 95°C for 30s, annealing at 52°C for 30s, extension at 68°C for 1min; extension at 68°C for 5min. The amplified products were directly sequenced by Sanger sequencing.

[0122] Figure 4The results of A show that after treatment with M.MpeI-N374K and A3A, all 5mC in DNA-5mC are read as T. In contrast, all C in CG sites in DNA-C are read as C after treatment with M.MpeI-N374K and A3A. Since only C in CG sites is carboxymethylated by M.MpeI-N374K, C in non-CG sites (the first cytosine in CCGG sites) is also deaminated and read as T. These results show that in the method of the present invention, C and 5mC in CG sites are read as C and T, respectively, indicating that the method of the present invention can well distinguish C and 5mC in CG sites in DNA.

[0123] Next, we used the method of the present invention to quantitatively evaluate the 5mC level of a single CG site. We prepared various mixtures of DNA-C and DNA-5mC in different ratios, with the molar percentages of DNA-5mC / (DNA-C+DNA-5mC) being 0%, 33%, 66% and 100%. In the present invention, the C and T generated in the sequence represent the original C and 5mC. Therefore, the measured T / (C+T) ratio can show the 5mC level of individual CG sites. Figure 4 As shown in B-4E, the Sanger sequencing results show that the 5mC levels measured from the original TCG, CCG, GCG, and ACG sequences are proportional to the theoretical 5mC percentage (TCG: slope = 0.85, R 2 =0.96; CCG: slope = 0.95, R 2 =0.95; GCG: slope = 0.77, R 2 =0.98; ACG: slope = 0.88, R 2 =0.95), indicating that the method of the present invention can quantitatively detect 5mC at a single CG site.

[0124] Example 2. Quantitative analysis of 5mC in specific sites of human genomic DNA

[0125] We then applied the method of the present invention to quantify the 5mC levels at specific sites in genomic DNA. We analyzed the 5mC levels in the promoter region of the retinoic acid receptor β (RARB) gene, which is a tumor suppressor gene known to regulate many biological processes. Hypermethylation of the RARB gene promoter is considered to be an important factor in predicting early recurrence of non-small cell lung cancer (NSCLC). The application of the method of the present invention to perform 5mC localization analysis in the genome specifically includes the following steps:

[0126] A. A pair of NSCLC paracrine and lung cancer tissues were collected and genomic DNA was extracted using a tissue DNA kit (Omega) according to the manufacturer's recommended procedures.

[0127] B. Genomic DNA was fragmented into fragments with an average size of 300-500 bp using an ultrasonic homogenizer (Scientz).

[0128] C. Then, 100 ng of the fragmented DNA was subjected to carboxymethylation labeling and A3A deamination using M.MpeI-N374K according to the method in Example 1. As a control, 100 ng of the fragmented DNA was directly subjected to A3A deamination.

[0129] D. The deaminated DNA is amplified by PCR, and the amplification system includes:

[0130] Table 1

[0131]

[0132]

[0133] RARB-F: 5'-GGTTAGGAGGGTTTATTTTTTGTTAA-3';

[0134] RARB-R: 5'-AATCATTTACCATTTTCCAAACTTACT-3'.

[0135] The amplification procedure is:

[0136] Table 2

[0137]

[0138] E. The amplified product was directly subjected to Sanger sequencing.

[0139] F. To compare the bisulfite sequencing method, bisulfite deamination treatment was performed using a commercial kit (QIAGEN), followed by PCR amplification using primers RARB-F and RARB-R, and the amplified products were subjected to Sanger sequencing.

[0140] We used the method of the present invention to analyze the 5mC level of the CG site in the Chr3:25,428,373-25,428,436 region of the RARB gene promoter ( Figure 5 A). The present invention uses M.MpeI-N374K and caSAM as auxiliary factors to carboxymethylate genomic DNA from tumor or tumor-adjacent lung tissue, and then performs A3A treatment and Sanger sequencing. In order to exclude the interference of other DNA cytosine modifications (such as 5caC), genomic DNA that has not been treated with M.MpeI-N374K is used as a control. The results show that after A3A treatment, C / 5mC at all CG sites is read as T ( Figure 5Next, we used the method of the present invention to quantify the 5mC level at CG sites ( Figure 5 B). Quantitative results showed that among the 9 CG sites in the RARB gene promoter, the 5mC levels of 7 sites were significantly increased in lung tumor DNA (P<0.05, Figure 5 B). These results were further confirmed by conventional bisulfite sequencing ( Figure 5 C-5D). The 5mC levels obtained using the method of the present invention were comparable to those obtained using bisulfite sequencing (Pearson's r = 0.94 and 0.92, Figure 5 C-5D).

[0141] Since conventional bisulfite treatment may cause severe degradation of genomic DNA, this application example compares the degradation of genomic DNA using the method of the present invention or bisulfite sequencing. The fragmented genomic DNA (300-500 bp) was subjected to the method of the present invention or bisulfite sequencing analysis. After deamination, the 247 bp region of the RARB gene promoter was amplified by PCR. Figure 6 In the bisulfite sequencing method, at least 10 ng of starting genomic DNA is required to detect the 247 bp amplification product. However, using the method of the present invention, only 0.1 ng of starting genomic DNA is required to clearly detect the amplification product. This result shows that the method of the present invention is superior to the bisulfite sequencing method when there is only a limited DNA sample.

[0142] In summary, the method of the present invention can quantify and detect 5mC at CG sites in regional DNA in limited DNA samples with single-base resolution. Combined with high-throughput sequencing, the method of the present invention should be able to achieve whole-genome sequencing of 5mC at CG sites.

[0143] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0144] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0145] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A kit for locating 5-methylcytosine in DNA at single base resolution, characterized in that: The kit comprises: DNA methyltransferase and cytosine deaminase, wherein the DNA methyltransferase is the M.MpeI-N374K protein with an amino acid sequence as shown in SEQ ID NO.1, and the cytosine deaminase is the A3A protein with an amino acid sequence as shown in SEQ ID NO.

2.

2. A kit for performing single-base resolution positioning sequencing analysis of 5-methylcytosine in DNA according to claim 1, characterized in that: The kit also includes: Reaction components for carboxymethylation using DNA methyltransferase: Tris-HCl pH 7.0-8.5, NaCl, dithiothreitol, EDTA, carboxy-S-adenosyl-L-methionine; Reaction components for deamination using cytosine deaminase: 2-(N-morpholino)ethanesulfonic acid, Triton X-100.

Images