Use of a substance that binds to igf2bp1 or its target in the manufacture of a diagnostic or therapeutic product for multiple myeloma
By detecting and inhibiting the IGF2BP1-CDC5L axis, the problem of unclear prognosis in 1q+ multiple myeloma has been resolved, providing new diagnostic and treatment methods and enabling targeted therapy and prognostic prediction for 1q+ MM patients.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHONGSHAN HOSPITAL FUDAN UNIV
- Filing Date
- 2022-12-07
- Publication Date
- 2026-05-15
AI Technical Summary
In the current technology, the prognostic value of chromosome 1q copy number amplification (1q+) in multiple myeloma is unclear, and there is a lack of effective therapeutic targets and methods, which leads to difficulties in clinical treatment.
By utilizing the RNA m6A reader protein IGF2BP1 and its target CDC5L, we can develop diagnostic and therapeutic products for multiple myeloma by detecting the expression levels of IGF2BP1 and CDC5L. These products include interfering nucleic acid constructs, lentiviral vectors, cell modifications, and small molecule chemical drugs to inhibit the expression or activity of IGF2BP1 or CDC5L and regulate tumor cell proliferation and cell cycle.
This study provides new prognostic indicators and targets for developing targeted therapies for 1q+ MM patients by inhibiting the IGF2BP1-CDC5L axis, predicting patient prognosis and inhibiting the growth and proliferation of multiple myeloma.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the pharmaceutical field, and in particular to the use of substances that bind to IGF2BP1 or its target in the preparation of diagnostic or therapeutic products for multiple myeloma. Background Technology
[0002] Chromosomal 1q copy number amplification (1q+) is one of the most common molecular genetic abnormalities in multiple myeloma, occurring in approximately 30-50% of newly diagnosed MM (NDMM) patients and approximately 70% of relapsed and refractory MM (RRMM) patients. However, despite this high positivity rate, the prognostic value of 1q+ in MM remains controversial and inconclusive, indicating significant clinical and biological heterogeneity among MM patients with 1q+. To better guide clinical treatment, there is an urgent need to identify more robust prognostic factors and targets to further stratify and treat this subgroup of patients. Summary of the Invention
[0003] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide the use of RNA m6A reader protein IGF2BP1 in the preparation of diagnostic or therapeutic products for multiple myeloma, in order to solve the problems in the prior art where the prognostic value of chromosome 1q copy number amplification (1q+) in multiple myeloma is unclear and there are no effective products for treating the chromosome 1q copy number amplification subgroup of multiple myeloma.
[0004] To achieve the above and other related objectives, the present invention provides the use of substances that bind to IGF2BP1 or its target in the preparation of diagnostic or therapeutic products for multiple myeloma.
[0005] Preferably, the multiple myeloma has one or more of the following characteristics: chromosome 1q copy number amplification, chromosome 17p deletion, chromosome 13q deletion, balanced translocation of chromosome 4 and chromosome 16, balanced translocation of chromosome 4 and chromosome 14, or balanced translocation of chromosome 11 and chromosome 14.
[0006] Preferably, the mRNA of the CDC5L gene is a target of the RNA m6A reader protein IGF2BP1.
[0007] The present invention also provides a method of using the aforementioned multiple myeloma tumor diagnostic product, wherein the method of use involves detecting the expression levels of IGF2BP1 and CDC5L genes in CD138+ plasma cells.
[0008] The present invention also provides an interfering nucleic acid construct of the IGF2BP1 gene or its target, wherein the construct is a lentiviral vector and the construct contains one or more of the following nucleotide sequences: SEQ ID NO.1~SEQ ID NO.3 or SEQ ID NO.11.
[0009] The present invention also provides a gene interference lentivirus targeting the IGF2BP1 gene or its target, wherein the lentivirus is prepared by transfecting host cells with the above-described construct.
[0010] The present invention also provides a cell in which the IGF2BP1 gene or its target is modified, said cell being obtained by infecting a gene-interfering lentivirus.
[0011] The present invention also provides the use of the described construct, the described lentivirus, or any of the described cells in the preparation or screening of multiple myeloma treatment products.
[0012] The present invention also provides a composition for treating multiple myeloma. The composition comprises one or more of the following characteristics and a pharmaceutically acceptable carrier or excipient:
[0013] 1) The aforementioned construct;
[0014] 2) The aforementioned lentiviruses;
[0015] 3) The cells mentioned above;
[0016] 4) Small molecule chemical drugs, wherein the small molecule chemical drugs are selected from one or more of BTYNB, AVJ16 or cucurbitacin B;
[0017] 5) Protein, wherein the protein is selected from anti-IGF2BP1 antibody or antibody that specifically binds to the IGF2BP1 target; preferably, the antibody that specifically binds to the IGF2BP1 target is anti-CDC5L antibody.
[0018] The present invention also provides a product for diagnosing the prognosis of multiple myeloma. The product comprises primers with nucleotide sequences as shown in SEQ ID No. 7-10.
[0019] As described above, the use of substances of the present invention that bind to IGF2BP1 or its target in the preparation of diagnostic or therapeutic products for multiple myeloma has the following beneficial effects:
[0020] 1. The use of the RNA m6A reader protein IGF2BP1 in the preparation of diagnostic or therapeutic products for multiple myeloma identifies a novel IGF2BP1-CDC5L axis in the 1q+ MM subgroup, providing new insights for the development of targeted therapies for 1q+ MM patients;
[0021] 2. This invention detects the expression levels of IGF2BP1-CDC5L mRNA and protein in CD138+ plasma cells, which can predict the prognosis of 1q+ MM patients, providing a new method for developing 1q+ MM detection products;
[0022] The use of the RNA m6A reader protein IGF2BP1 in the preparation of diagnostic or therapeutic products for multiple myeloma also provides a new target and novel inhibitor for the clinical treatment of a subgroup of patients with 1q+ MM. Attached Figure Description
[0023] Figure 1-1 A. IGF2BP1 mRNA expression levels in multiple myeloma of different molecular subtypes.
[0024] Figure 1-2 To assess the impact of B. IGF2BP1 mRNA on overall survival (OS) in MM patients with 1q+, del17p, or t(4;14).
[0025] Figure 1-3 C. IGF2BP1 expression level in the GSE24080 dataset; D. IGF2BP1 expression level in MM patients or MGUS patients in the local dataset.
[0026] Figure 1-4 qRT-PCR validation of E. IGF2BP1 mRNA levels; WB validation of F. IGF2BP1 protein expression levels.
[0027] Figure 2-1 The proportion of EDU-positive cells (green) in the A. NCI-H929-IGF2BP1-OE group was significantly higher than that in the control group (p = 0.049).
[0028] Figure 2-2 The proportion of EDU-positive cells (red) in the B. RPMI-8226-IGF2BP1-KD group was significantly lower than that in the control group (p = 0.002).
[0029] Figure 2-3 IGF2BP1 can promote cell cycle progression in NCI-H929 cells by increasing the proportion of cells in the S phase.
[0030] Figure 2-4 D. Knockout of IGF2BP1 inhibited RPMI-8226 cell cycle progression by reducing the proportion of cells in the S phase.
[0031] Figure 2-5E. IGF2BP1 overexpression stimulated the proliferation of NCI-H929 cells (p < 0.001), while IGF2BP1 knockout inhibited the proliferation of RPMI-8226 cells (p < 0.001); F. The multinucleation rate of NCI-H929-IGF2BP1-KD cells was significantly higher than that of control cells (p < 0.001); G. The in vivo growth difference of IGF2BP1-OE and IGF2BP1-NC cells after subcutaneous inoculation into B-NDG mice.
[0032] Figure 3-1 A. The number of m6A site classifications predicted based on reliability.
[0033] Figure 3-2 The results of B. KEGG analysis are shown. In the right column, the opposite side of HD, from top to bottom, are: Viralmyocarditis, Viral carcinogenesis, Systemic lupus erythematosus, Proteoglycansin cancer, Parkinson's disease, Non-alcoholic fatty liver disease (NAFLD), Human T-cell leukemia virus 1 infection, Human paplillomavirus infection, Hepatocellular carcinoma, Gastric cancer, Epstein-Barr virus infection, Cushing syndrome, Chagas disease (American trypanosomiasis), Breast cancer, and Alcoholism.
[0034] Figure 3-3 These are differentially expressed genes downregulated in the C. IGF2BP1-KD group.
[0035] Figure 3-4 The top 20 KEGG pathways that are significantly enriched in DEGs upregulated by D.
[0036] Figure 3-5 The top 10 significantly enriched KEGG pathways for E. IGF2BP1 target genes were identified as endocytosis, spliceosomes, and AMPK signaling pathways.
[0037] Figure 3-6Venn diagram showing the overlap of differentially expressed genes / RNAs obtained from F. m6A-seq, IGF2BP1-KD RNA-seq, and IGF2BP1 CLIP-seq analyses.
[0038] Figure 3-7 The expression level of CDC5L mRNA in G.MM patients.
[0039] Figure 3-8 To assess the survival of MM patients without 1q+ by evaluating the expression level of H. IGF2BP1 mRNA.
[0040] Figure 4-1 A. Results of CDC5L protein expression in different cell lines; B. Results of CDC5L mRNA stability assay; C. Results of NCI-H929-CDC5L-KD cell cycle assay; E. Expression of IGF2BP1 and CDC5L in IGF2BP1 OE-CDC5L KD recovery cell lines.
[0041] Figure 4-2 Analysis of the differences in cell proliferation capacity between the D. RPMI-8226-CDC5L-KD group and the CDC5L-NC group; F. Knockdown of CDC5L attenuated the proliferative effect of IGF2BP1 overexpression in NCI-H929 cells.
[0042] Figure 5-1 Visualization of CDC5L mRNA generated by A. IGF2BP1 Clip-seq.
[0043] Figure 5-2 For A1. Figure 5-1 Statistical results.
[0044] Figure 5-3 The distribution of MeRIP-seq reads of CDC5L mRNA in B. NCI-H929 cells.
[0045] Figure 5-4 For B1. Figure 5-3 The statistical results.
[0046] Figure 5-5 The C. SRAMP database was used to predict the m6A modification site of CDC5L mRNA.
[0047] Figure 5-6 The mutation site in D. CDC5L that removes the m6A modification.
[0048] Figure 5-7This study validates how E. IGF2BP1 regulates CDC5L expression in NCI-H929 cells via mRNA modification in an m6A-dependent manner.
[0049] Figure 5-8 The results of F. RIP-qPCR detection of the interaction between CDC5L-WT / CDC5L-MUT and IGF2BP1 in NCI-H929 cells.
[0050] Figure 5-9 Verification of the affinity of G. IGF2BP1 with CDC5L-WT and CDC5L-MUT.
[0051] Figure 6 This invention presents the results of IGF2BP1 inhibitor downregulating CDC5L expression and inhibiting MM cell proliferation. AC. Results of the effect of IGF2BP1 inhibitor on CDC5L expression levels in NCI-H929, RPMI-8226, and MMIS cells; D. Dosage-effect of IGF2BP1 inhibitor in NCI-H929, RPMI-8226, and MMIS cells; E. Results of IGF2BP1 inhibitor inhibiting MM cell growth in an allogeneic mouse model. Detailed Implementation
[0052] This invention provides the use of substances that bind to IGF2BP1 or its target in the preparation of diagnostic or therapeutic products for multiple myeloma.
[0053] The multiple myeloma has one or more of the following characteristics: chromosome 1q copy number amplification, chromosome 17p deletion, chromosome 13q deletion, balanced translocation of chromosome 4 and chromosome 16, balanced translocation of chromosome 4 and chromosome 14, or balanced translocation of chromosome 11 and chromosome 14.
[0054] Preferably, the target of IGF2BP1 is CDC5L.
[0055] Furthermore, the mRNA of the CDC5L gene is a target of the RNA m6A reader protein IGF2BP1.
[0056] Furthermore, the RNA m6A reader protein IGF2BP1 acts on the m6A site of the CDC5L gene mRNA. This action increases the protein abundance of CDC5L.
[0057] The substance that binds to IGF2BP1 or its target is selected from one or more of nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, peptides, proteins, or viruses.
[0058] The nucleic acid molecule is selected from one or more of primers, probes, siRNA, shRNA, or sgRNA. Preferably, the nucleic acid molecule is a primer or shRNA.
[0059] Further, the primer comprises one or more of the following: nucleotide sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO.7: 5'-CAGGAGATGGTGCAGGTGTTTATCC-3'; SEQ ID NO.8: 5'-GTTTGCCATAGATTCTTCCCTGAGC-3'; SEQ ID NO.9: 5'-AAGGCCCAGGATGTTTTGGTG-3'; SEQ ID NO.10: 5'-CCTGGTTATAAGCTTCACTTGAGA-3'.
[0060] Further, the shRNA comprises one or more of the following: nucleotide sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO.4: 5'-CAGGGAAGAAUCUAUGGCAAA-3'; SEQ ID NO.5: 5'-ACAGUAGAGAACUGUGAGCAA-3'; SEQ ID NO.6: 5'-UGCCAAGACCAUCAGAAGUAA-3'.
[0061] The percentage (%) of sequence identity mentioned above refers to the degree to which two sequences (nucleotides) have the same nucleotides at the same positions in the alignment. For example, "nucleotide sequence is X% identical to SEQ ID NO:Y" means that the nucleotide sequence is identical to SEQ ID NO:Y by a percentage, and is stated as X% of the nucleotides in the nucleotide sequence being identical to the nucleotides of the sequence disclosed in SEQ ID NO:Y. Typically, such calculations are performed using computer programs. Exemplary programs for comparing and aligning sequence pairs include ALIGN (Myers and Miller, 1988), FASTA (Pearson and Lipman, 1988; Pearson, 1990), and gapped BLAST (Altschul et al., 1997), BLASTP, BLASTN, or GCG (Devereux et al., 1984).
[0062] Furthermore, the small molecule chemical is selected from one or more of BTYNB, AVJ16, or cucurbitacin B.
[0063] The virus is selected from one or more of lentiviruses, adenoviruses, or adeno-associated viruses.
[0064] The protein is selected from anti-IGF2BP1 antibody or antibody that specifically binds to the IGF2BP1 target; preferably, the antibody that specifically binds to the IGF2BP1 target is anti-CDC5L antibody.
[0065] The term "antibody" should be understood in its broadest sense and includes monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, antibody fragments, and multispecific antibodies (e.g., bispecific antibodies) containing at least two distinct antigen-binding regions. Antibodies may contain additional modifications, such as non-naturally occurring amino acids, mutations in the Fc region, and mutations at glycosylation sites. Antibodies also include post-translational modified antibodies, fusion proteins containing antibody antigenic determinants, and immunoglobulin molecules containing any other modifications to antigen recognition sites, provided that these antibodies exhibit the desired biological activity.
[0066] Furthermore, the multiple myeloma treatment product treats multiple myeloma by inhibiting the expression or activity of IGF2BP1 or its targets.
[0067] Inhibiting the expression or activity of IGF2BP1 or its target refers to reducing the expression activity of IGF2BP1 or its target. Preferably, compared with before inhibition, the expression activity of IGF2BP1 or its target is reduced by at least 10%, more preferably by at least 30%, even more preferably by at least 50%, more preferably by at least 70%, and most preferably by at least 90%.
[0068] Inhibiting the expression of IGF2BP1 or its target genes can specifically mean inhibiting the transcription or translation of IGF2BP1 or its target genes. Specifically, it can mean preventing the transcription of IGF2BP1 or its target genes, reducing the transcriptional activity of IGF2BP1 or its target genes, preventing the translation of IGF2BP1 or its target genes, or reducing the translation level of IGF2BP1 or its target genes.
[0069] Those skilled in the art can use conventional methods to regulate gene expression of IGF2BP1 or its targets, such as gene knockout, homologous recombination, and interfering RNA.
[0070] The inhibition of gene expression of IGF2BP1 or its targets can be verified by detecting expression levels using PCR and Western Blot.
[0071] Preferably, compared with the wild type, the gene expression of IGF2BP1 or its target is reduced by at least 10%, more preferably by at least 30%, even more preferably by at least 50%, more preferably by at least 70%, even more preferably by at least 90%, and most preferably by no expression of IGF2BP1 or its target gene.
[0072] Specifically, the multiple myeloma treatment product treats multiple myeloma through one or more of the following methods: by inhibiting the expression of IGF2BP1 or its targets to regulate tumor cell proliferation, inhibit cell cycle transition, or regulate the translation process of CDC5L gene mRNA.
[0073] Furthermore, the aforementioned regulation of tumor cell proliferation is to promote tumor cell proliferation; the aforementioned cell cycle is to transition from the G1 phase to the S phase in the cell cycle.
[0074] The present invention also provides a method of using the aforementioned multiple myeloma tumor diagnostic product, wherein the method of use involves detecting the expression levels of IGF2BP1 and CDC5L genes in isolated CD138+ plasma cells.
[0075] The present invention also provides a gene interference nucleic acid construct of the IGF2BP1 gene or its target, wherein the construct is a viral vector.
[0076] The vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is attached. In some embodiments, the vector is also selected from one or more of the following: (1) plasmids; (2) phage particles; (3) granules; (4) artificial chromosomes, such as yeast artificial chromosomes, bacterial artificial chromosomes, or artificial chromosomes derived from P1; (5) bacteriophages, such as λ phage or M13 phage; (6) animal viruses, such as retroviruses, adenoviruses, adeno-associated viruses, sporangioviruses, poxviruses, and baculoviruses.
[0077] Further, the viral vector comprises one or more of the following nucleotide sequences: IGF2BP1 knockdown shRNA target sequence 1 (SEQ ID NO.1), IGF2BP1 knockdown shRNA target sequence 2 (SEQ ID NO.2), CDC5L knockdown shRNA target sequence (SEQ ID NO.3), or CDC5L m6A mutant (SEQ ID NO.11).
[0078] Furthermore, the viral vector is selected from pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, and pLKO. One or more of the following: 1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP / VSV-G, pENTR / U6, pLenti6 / BLOCK-iT-DEST, pLenti6-GW / U6-laminshrna, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, pGCSIL-GFP, or pLenti6.2 / N-Lumio / V5-GW / lacZ.
[0079] The present invention also provides a gene-interfering lentivirus of the IGF2BP1 gene or its target, wherein the lentivirus is obtained by transfecting the above-described construct into host cells.
[0080] The host cell is selected from any one of mammalian cells (such as CHO, COS, and N2A), plant cells, human cells (human cervical cancer cells such as HELA and human embryonic kidney cells such as HEK293T), bacterial cells (such as Escherichia coli, Streptomyces, and Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). Preferably, the host cell is an animal cell, and more preferably a human cell. The host cell is a passaged cell or a primary cell, i.e., a cell directly isolated from an organism (such as a human). The host cell is an adhesive cell or a suspended cell, i.e., a cell growing in suspension.
[0081] The present invention also provides a cell in which the IGF2BP1 gene or its target is modified, the cell containing the above-described construct or obtained by infecting the above-described lentivirus.
[0082] Furthermore, the cells are selected from one or more of NCI-H929, RPMI-8226, or MM1S.
[0083] The present invention also provides the use of the described construct, the described lentivirus, or any of the described cells in the preparation or screening of diagnostic or therapeutic products for multiple myeloma.
[0084] The present invention also provides a product for diagnosing the prognosis of multiple myeloma, characterized in that the product comprises primers with nucleotide sequences as shown in SEQ ID No. 7-10.
[0085] The present invention also provides a composition for the prevention or treatment of multiple myeloma, wherein the active ingredient comprises:
[0086] The aforementioned shRNA, the aforementioned construct, the aforementioned virus, the aforementioned small molecule chemical drug or protein, and pharmaceutically acceptable vectors, diluents or excipients.
[0087] Preferably, the small molecule chemical is selected from one or more of BTYNB, AVJ16, or cucurbitacin B.
[0088] Preferably, the protein is selected from anti-IGF2BP1 antibody or antibody that specifically binds to the IGF2BP1 target; the antibody that specifically binds to the IGF2BP1 target is anti-CDC5L antibody.
[0089] The composition may be a pharmaceutical composition.
[0090] When the composition is used for the prevention or treatment of multiple myeloma in a subject, an effective dose of the composition needs to be administered to the subject. Using this method, the growth, proliferation, and recurrence of the multiple myeloma are inhibited. Furthermore, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the growth, proliferation, and recurrence of the multiple myeloma are inhibited.
[0091] The composition is not particularly limited in form and can be in various forms such as solid, liquid, gel, semi-fluid, or aerosol.
[0092] The composition is primarily intended for use with mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans.
[0093] "Pharmaceutical acceptable" means that when the molecular basis and the composition are properly administered to animals or humans, they do not produce adverse, allergic, or other adverse reactions.
[0094] A "pharmaceutically acceptable carrier or excipient" should be compatible with the active ingredient, meaning it can be miscible with it without significantly reducing the drug's efficacy under normal circumstances. Specific examples of substances that can serve as pharmaceutically acceptable carriers or excipients include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethylcellulose, and methylcellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers, etc. These substances are used as needed to help stabilize the formulation or to improve its activity or bioavailability or to produce an acceptable taste or smell when taken orally.
[0095] In this invention, unless otherwise specified, the drug dosage form is not particularly limited and can be formulated as injections, oral liquids, tablets, capsules, pellets, sprays, etc., and can be prepared by conventional methods. The choice of drug dosage form should be matched with the route of administration.
[0096] The aforementioned treatment involves the administration of a drug or the performance of a procedure to achieve an effect. Such treatment may include treating a disease or condition (e.g., cancer) in mammals, particularly in humans, including: (a) preventing the onset of a disease or disease symptoms (e.g., including diseases that may be related to or caused by a primary disease) in subjects susceptible to the disease but not yet diagnosed with it; (b) suppressing the disease, i.e., halting its progression; and (c) alleviating the disease, i.e., causing its regression. Treatment may refer to any indicator of success in the treatment, improvement, or prevention of cancer, including any objective or subjective parameter such as elimination; relief; reduction of symptoms or making the disease condition more tolerable for the patient; slowing the rate of deterioration or decline; or weakening the endpoint of deterioration. Treatment or improvement of symptoms is based on one or more objective or subjective parameters; including the results of a physician's examination.
[0097] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0098] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.
[0099] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.
[0100] Example 1: Acquisition of Multiple Myeloma Samples
[0101] From December 2017 to December 2020, the Department of Hematology at Zhongshan Hospital, Fudan University (Shanghai, China) collected bone marrow samples from 16 patients with undetermined significance monoclonal globulinemia (MGUS) and 30 patients with nonspecific myeloma (NDMM) (Table 1). This study was approved by the Ethics Committee of Zhongshan Hospital (Approval No. B2017-031R), and all enrolled patients gave written informed consent. The diagnosis of MGUS and MM was determined according to the 2018 criteria of the International Myeloma Working Group (IMWG). The collection of bone marrow mononuclear cells (BMMCs) and the sorting of CD138+ / CD138- plasma cells (PCs) were performed as follows: First, the bone marrow specimens were centrifuged at 3,000 rpm for 10 minutes. The supernatant was collected as plasma. An equal volume of PBS was added to the precipitate and mixed thoroughly (Solution A). Second, Solution A was slowly added to the human lymphocyte separation medium in a new tube, ensuring an optimal interface between the two. The middle white suspension layer and mononuclear cell layer were carefully transferred into a new tube and centrifuged at 3,000 rpm for 15 minutes, followed by washing three times with PBS. The supernatant was discarded after centrifuging the mononuclear cells. Next, 80 L of Magnetic Activated Cell Separation (MACS) buffer and 20 L of CD138-coated magnetic beads (Miltenyi Biotec, MB17-R0009) were added to the cell pellet and thoroughly mixed. After incubation at 4°C for 15 minutes, the pellet was centrifuged at 1,000 rpm for 10 minutes. A MACS sorting column was applied to the resuspended cells. Finally, flow cytometry was used to assess the purity of the PC separation. The usable purity was above 90%. The CD138+ PCs collected from these patients were stored in liquid nitrogen for subsequent analysis.
[0102] The CoMMpass study (NCT01454297) was a prospective, investigational clinical trial that assessed the transcriptomic characteristics of patients with multiple myeloma (NDMM). This study used the dataset from interim analysis (IA)15 of the CoMMpass study.
[0103]
[0104] MGUS, monoclonal gammopathy of undetermined significance; NDMM, newly diagnosed multiple myeloma
[0105] Example 2: Western Blot and Real-Time Quantitative PCR (RT-qPCR) of IGF2BP1 and CDC5L
[0106] Perform Western blotting and RT-qPCR according to the experimental procedures detailed in previous studies. Each experiment was repeated at least three times, with representative results from one of the repetitions shown.
[0107] For Western blotting (WB), the major antibodies were: anti-IGF2BP1 (Novus, NBP1-79024, 1:1000 dilution), anti-CDC5L (Abcam, EPR7658, 1:1000 dilution), and anti-β-actin (Proteintech, 600004-1-lg, 1:2000 dilution). Antibodies binding to secondary horseradish peroxidase (HRP) were: goat anti-mouse IgG H&L (Abcam, ab205719, 1:2000 dilution) and goat anti-rabbit IgG H&L (Abcam, ab205718, 1:2000 dilution). Image quantification was performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA). For qPCR, primers were synthesized by Generay Biotechnology (Shanghai, China), and their sequences are listed in Supplementary Table 1. Experiments were performed in triplicate. Relative expression levels were calculated using the 2-ΔΔCT method.
[0108] Example 3: Culture of Multiple Myeloma Cells
[0109] Three human MM cell lines (HMCLs), including NCI-H929, RPMI-8226, and MM1S, were purchased from ATCC. All cells were cultured in RPMI-1640 medium (HyClone, SH30809.01) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific, 10099141) at 37°C and 5% CO2.
[0110] Example 4: Transfection with IGF2BP1 and CDC5L-associated lentiviruses and generation of transfected cell lines
[0111] The vector for IGF2BP1 overexpression (OE) lentivirus was constructed using the GV341 (Genechem product number) vector (Ubi-MCS-3FLAG-SV40-puromycin). The vector backbone for IGF2BP1 knockout (KD) shRNA was 'GV112 (Genechem product number), hU6-MCS-CMV-PUromycin', with the target sequences of IGF2BP1 KD shRNA being 5'-CAGGGAAGAATCTATGGCAAA-3' (SEQ ID NO.1) and 5'-ACAGTAGAGAACTGTGAGCAA-3' (SEQ ID NO.2).
[0112] In addition, the vector backbone of CDC5L knockout (KD) shRNA is 'GV654 (Genechem product number), hU6-MCS-Ubiquitin-mCherry-IRES-Neomycin', 5'-tgCCAAGACCATCAGAAGTAA-3' (SEQ ID NO.3).
[0113] Vectors for CDC5L m6A-mutation (MUT) (SEQ ID NO.11) OE lentivirus and CDC5L wild-type (WT) OE lentivirus were constructed using the CV557 (Genechem catalog number) vector (Ubi-MCS-3FLAG-SV40-Cherry-IRES-neomycin). The construction of the lentiviral vectors and the packaging of the lentiviruses were performed by Genechem. NCI-H929 and MM1S cells were transduced with the lentiviruses at infection folds of 5-10, and stable transfectants were selected using puromycin or neomycin.
[0114] The nucleotide sequence of CDC5L m6A-mutation (SEQ ID NO.11) is as follows:
[0115] AGAAGAGAACTTCGAGCAGCTGGGAGTGAAATTGCTGCTCAAAAAATATGAAAATCTTTAGACTATGAATGTGTATTTCTAACTTCTCTTTGGGAAGAGATGCACCAATATACTTTTTCATTACCAGTGCAGCAGACTGTCCATTTTTTGCAGCCTTGCCGTTAAAACAAAACAAAAAACTGAATGGTGTTAATTAGATATGCACAAATGG TACTTGTTAATTTAATTTGTGATTCTTTAATTGTTAAATAAAACTTTTGTCATTTTAGTTACCTGCATTTTTTGCTTTGTGAATTGTTTCCTTTTGCTCTTTTTACACCCTTTGAGTGCATTAAAAAAAAAAAAACTTTGCTTAGACTGTTTATATTTAACCATCATACTAGTTGCAAATATTTTTTCCTACTATTTGCCTTTTAATTTC ATTTATAAATTTTCATAGTGTTACAGTTAGAAGTTTTATATCTCAAAGCTATTCAATGTATAGATGAGTGGATTAAAAGGAAAAAAAAGCTGTTGATTTTTTTCATTTGCCATTTATTTAATTTATATTTAGTAAGTACATTTCCATCCAGAGATAAGATATGTATTTACTTGTAGTTCCTTTTGGTTTTTCTTTTTGCCTTATTATGTGTATGTGTGTGTGTGCACCTTTAAATTAAAACTAGGATTTGTTTTGGTGAATGGTGTGAGGTAAGGATTTAAATAACTATTTCTTCCCCAAATAAATAGATACTTTTTTTTTAACTGTATGGGATAATTTATCCCTGTCACATGGCATATGATTTTCAAAGTGATTTTGCATTCTTTTCAGACGTCTTGCTGCCCTCCAAAAAAagaagagtacttcg t gc tgctggCATAGAAATTCAGAAGAAAAGAAAAAGGAAGAGAGGAGTTGATTATAATGCCGAAATCCCATTTGAAAAAAAGCCTGCCCTTGGTTTTTATGATACTTCTGAGGAAAACTACCAAGCTCTTGACGCAGATTTCAGGAAATTAAGACAACAGGATCTTGATGGGGAGCTAAGATCGTAAGTTGCCTTTCTGATTTTGGA AATGGAAAGGAATAGTAGGAGGAGTCTTACGAAGGGCCAAGTATTATCCTTGTCAGAGCCAGATTTTTATTATTTATTTTACATTTTTTAAAATCAATTTTTTTTTTGAGACAGGGTCTTGCTGTGTTGCCCAGGCTGGAGTACAGTGGCACAAACACGGCTTACTGAAGCCTTGACCTCCTGGGCTCAAGCAATCCTCC CACCTCAGCCTCCTGAGTAGCTAGGCCTTCAGGTGCACACCACCACACCTAGCTAATTTTTTTTATTGTTTTGTAGGGTGGGATCTCCTTTTGTTGTGCAGACTGGTCTCAAACTCCTGGGCTCAAGCGATCCTTCTTAAAGTGTTGGGATTATAGGCATCAGTTACTGTGCCTGGCCTAGATTTTTATTAGTACAATGTGGC CTACATATGGTTTTATTTATTTAATGGATTCATCTTTCTGAGAAAATCAGGGACTGTGGCTATCACGTTTTTAGCACAGAATGCTGTTTATGGCTCTTGAGTTGAAATGCATGGCTCTCAATTGACTGTTTACTCTTTGAATCACATCTTAACTTTTATGTACATTTATGAGTAGATTAGTTTTACTAGTGGCTGAGGAATCTG
[0116] The lowercase part represents the target binding site (i.e., the location where IGF2BP1 and CDC5L bind). The lowercase italicized and bold part represents the target mutation site 44403838, and the mutation method is to mutate the nucleotide at the corresponding position of wild-type CDC5L from a to t. In addition to the target site mutation, there is also a lowercase bold underlined part representing a synonymous mutation of the target sequence, and the mutation method is to mutate the nucleotide at the corresponding position of wild-type CDC5L from a to t.
[0117] Example 5: Analysis of Multiple Myeloma Cell Proliferation and Cell Cycle
[0118] Cell proliferation analysis was performed using the Cell Counting Kit-8 (CCK-8) (Dojindo, Kumamoto, Japan) according to the kit instructions. Cell cycle analysis was performed using the Cell Cycle Detection Kit-PI / RNase Staining (Dojindo, Kumamoto, Japan). Harvested cells were collected, fixed with 70% cold ethanol, and stained with propidium iodide (PI) in 1× working solution. Subsequently, cells were differentiated using flow cytometry (BD Biosciences, San Diego, CA, USA) according to the instructions.
[0119] Example 6: 5-ethynyl-2'-deoxyuridine (EdU) cell proliferation binding assay in multiple myeloma cells, and observation of cell multinucleation.
[0120] EdU staining of cell slides was performed using the EdU kit (RiboBio, Guangzhou, China) according to the instructions. Slides were examined under an Olympus BX53 microscope (Olympus, Shinjuku City, Tokyo, Japan) with excitation / emission wavelengths of 450-480 nm / 515 nm (green light) and 330-385 nm / 420 nm (ultraviolet light). EdU binding rate was calculated as follows: EdU binding rate (%) = EdU-positive cells (green / red) / 4',6-diamidinyl-2-phenylindole (DAPI)-positive cells (blue) × 100. The percentage of EdU-positive cells was calculated from five randomly selected viewing areas on each slide. DAPI staining was used to observe multinucleated cells. The percentage was calculated from five randomly selected viewing areas on each slide.
[0121] Example 7: RNA extraction, library construction, and RNA sequencing (RNA-seq)
[0122] Total RNA was extracted from human myeloma cell lines or CD138+ PCs from patients using the EZ-press RNA Purification Kit (Yize Biotechnology Co., Ltd., Shanghai, China), and RNA purification was performed according to the instructions. RNA purity was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific). An Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) was used to assess RNA integrity. Libraries were constructed using the VAHTS Stranded mRNA-seq Library Prep Kit for Illumina V2. The corresponding libraries were sequenced using an Illumina sequencing platform (HiSeq™ 2500 or Illumina HiSeq X Ten). RNA-seq and data analysis were performed by OE Biotechnology Co., Ltd. Raw data in Fastq format were first processed using Trimmomatic to remove low-quality reads (Q20 > 99%, Q30 > 99.9%), retaining clean reads, and mapped to the human genome (GRCh38) using HISAT2. The FPKM of transcript fragments per kilobyte (FPKM) per million mapped reads was calculated for each gene using Cufflinks, and reads were obtained via HTSeq-count.
[0123] Example 8: Methylated RNA Immunoprecipitation Sequence (MeRIP-seq) and MeRIP-qPCR
[0124] Total RNA was isolated from NCI-H929 cells using TRIzol reagent. RNA was lysed using lysis buffer (10 mM ZnCl2, 10 mM Tris-HCl pH 7.0), incubated with anti-m6A antibody (Synaptic Systems, 202 003), and conjugated at room temperature using a Dynabeads antibody conjugation kit while rotating at 7 rpm (tail higher than head) for 1 hour. The sample was then placed on a magnet to aggregate the bead complex until the solution became clear. The supernatant (containing m6A-negative fragments not captured by the anti-m6A antibody) was then discarded. m6A-positive mRNA was then eluted from the beads using elution buffer (0.02 M DTT, 0.150 M NaCl, 0.05 M Tris-HCl pH 7.5, 0.001 M EDTA, 0.10% SDS, supplemented with the manufacturer's recommended concentration of RNase inhibitor). After RIP extraction and cleaning, an m6a-RIP library was constructed. The library was sequenced at single ends using an Illumina HiSeq 4000 system. For validation, the input RNA and eluted poly(A) RNA were reverse transcribed, and their abundance was tested by real-time PCR. The relative abundance between the input and IP products was calculated using the 2-ΔΔCT method. Peak analysis was performed using MeTDiff software (p ≤ 0.05; fold change ≥ 1.5), and related genes were screened for peaks.
[0125] Example 9: Cross-linked immunoprecipitation sequence (CLIP-seq)
[0126] Crosslinking of NCI-NCI-H929 cells was achieved by irradiation on ice with UVC (254 nm) at 400 mJ / cm², in cold phosphate-buffered saline (PBS). Cells were lysed for 30 min in cold wash buffer [50 mM Tris 7.4, 150 mM NaCl, 2 mM EDTA, 0.1% SDS, 0.5% NP-40, and 0.5% deoxycholate; supplemented with a 1% RNase inhibitor (Takara) and a 2% protease inhibitor cocktail (Roche)]. RQ I (Promega, M6101) was added to the lysis buffer to a final concentration of 1 U / μL, and the lysis buffer was incubated at 37°C for 30 min. Stop solution was added to the lysis buffer to quench DNase. The mixture was centrifuged at 13,000 × g for 20 min at 4°C to remove cell debris.
[0127] For immunoprecipitation, the supernatant was incubated overnight at 4°C with IGF2BP1 antibody (Novus, NBP1-79024) and control IgG antibody (Sigma, I5006). Protein A / G Dynabeads (Thermo Scientific, 26162) were used, and the supernatant was then removed using a magnet. The sample was washed twice sequentially with lysis buffer, high-salt buffer (250 mM Tris 7.4, 750 mM NaCl, 10 mM EDTA, 0.1% SDS, 0.5% NP-40, and 0.5% deoxycholate), and PNK buffer (50 mM Tris, 20 mM EGTA, and 0.5% NP-40). Beads were resuspended in elution buffer (50 nM Tris 8.0, 10 mM EDTA, and 1% SDS), and the suspension was incubated at 70°C for 20 minutes to release the immunoprecipitated RNA-binding protein and cross-linked RNA. The immunoprecipitated protein-RNA complex was analyzed on a Novex 4-12% Bis-Tris pre-prepared polyacrylamide gel (Invitrogen). The protein-RNA complex was cleaved from the gel, and RNA was extracted with Trizol (proteinase K, Sangon Biotech, B600169) after protein digestion. A cDNA library was prepared using the KAPA RNA HyperPrep Kit (KAPA, KK8541) according to the manufacturer's procedure. For high-throughput sequencing, the library was prepared according to the manufacturer's instructions and sequenced at 150 nt paired ends using an Illumina NovaSeq 6000 system.
[0128] Example 10: Detection of CDC5L mRNA Stability
[0129] In short, the mRNA stability assay involves seeding NCI-H929 cells transfected with either CDC5L-WT or CDC5L-MUT plasmids into 6-well plates, with the same number of cells per well. 24 hours later, 5 μg / mL actinomycin D (Act-D) is added to the cell culture at 0, 2, and 6 hours prior to collection.
[0130] Example 11: In vivo xenograft mouse model of multiple myeloma
[0131] B-NDG mice (NOD.CB17-PrkdcscidIl2rgtm1 / Bcgen, male, 6 weeks old) were purchased from Beijing Biological Products Co., Ltd. (Beijing, China). Mice were first subcutaneously injected with NCI-H929 cells (n = 4) and NCI-H929-IGF2BP1-OE (n = 4) (7.5 × 10⁻⁶ cells per mouse).6 Tumor volume was analyzed in both groups. Following tumor formation after xenograft subcutaneous implantation of MM, mice were orally administered an IGF2BP1 inhibitor (BTYNB, MCE, HY-124447; soluble in corn oil) at a dose of 10 mg / kg body weight (n = 5), based on initial experimental results (5 mg / kg, 10 mg / kg, 20 mg / kg). The placebo group (n = 5) received the same dose of corn oil. Tumor size was measured weekly, and tumor volume was calculated using the following formula: Tumor volume = (length × width) 2 (2) / 2. Tumor burden was quantified by tumor weight and estimated tumor size after euthanasia of mice. All animal experiments were conducted in accordance with the guidelines of the Fudan University Animal Care and Use Committee.
[0132] Example 12 Survival Analysis and LASSO Regression
[0133] The R package `survival` (version 3.5.1) was used for univariate Cox regression analysis, where "P < 0.05" was considered statistically significant. To minimize the risk of overfitting, the Least Absolute Shrinkage and Selection Operator (LASSO) algorithm from the `glmnet` R package was used for variable selection and shrinkage. Multivariate Cox regression analysis was then performed to identify independent prognostic biomarkers. Kaplan-Meier (KM) survival curves were used to compare prognostic outcomes between different subgroups.
[0134] Example 13: The guiding role of IGF2BP1 in the prognosis of patients with chromosome 1q+ MM.
[0135] To clarify the relationship between IGF2BP1 expression and molecular genetic abnormalities, including chromosome 1q+, 17p deletion (del17p), 13q deletion (del13q), t(4;16), t(4;14), and t(11;14), RNA-seq data from the MMRFCoMMpass dataset were first analyzed. As shown in Figure 1A, the results revealed significantly higher IGF2BP1 mRNA levels in MM patients with 1q+ (n = 178, p = 0.014), del17p (n = 71, p = 0.004), and t(4;14) (n = 71, p < 0.001). Based on the median IGF2BP1 mRNA expression level, the impact of IGF2BP1 mRNA on overall survival (OS) in MM patients with 1q+, del17p, or t(4;14) was assessed using Kaplan-Meier survival analysis (log-rank). In MM patients with 1q+ (Fig. 1B[1]) or t(4;14) (Fig. 1B[3]), patients with higher IGF2BP1 mRNA expression levels had a worse prognosis in terms of OS compared to patients with lower IGF2BP1 mRNA levels (1q21+: p = 0.038, t(4;14)+: p = 0.022). IGF2BP1 expression level was not found to have prognostic significance in the survival of MM patients with del17p (Fig. 1B[2], p = 0.067). Furthermore, IGF2BP1 mRNA expression level had no prognostic significance in the survival of OS in MM patients without 1q+, del17p, or t(4;14). The GSE24080 dataset was used to compare IGF2BP1 expression levels among healthy donors (HD) (n = 8), MGUS (n = 10), smoking MM (SMM) (n = 10), and MM (n = 24). The expression levels of IGF2BP1 were similar in the HD and MGUS groups. Compared with the MGUS group, the IGF2BP1 expression level was significantly increased in the SMM group (p = 0.045, Figure 1C). Furthermore, CD138 expression was also significantly increased in the SMM group compared with that in the MGUS group (n=16). + The expression level of IGF2BP1 in the RNA-seq data of PC was observed to be significantly elevated in MM patients (p = 0.017, Figure 1D). qRT-PCR validation showed that 1q+ MM patients had significantly higher IGF2BP1 mRNA levels (Figure 1E, p = 0.045), while t(4;14) MM patients did not reach statistical significance. Finally, Western blot analysis confirmed the presence of IGF2BP1 in CD138. +In PCs, the expression level of IGF2BP1 protein was higher in PCs from 1q+ MM patients (n=5) compared to PCs from MM patients without 1q+ (n=4) or MGUS patients (n=3) (Figure 1F). These results suggest that IGF2BP1 expression in PCs has prognostic value for 1q+ MM patients.
[0136] HMCLs, including NCI-H929, RPMI-8226, and MM1S, were confirmed to have 1q+ via fluorescence in situ hybridization (FISH). Therefore, transfected cell lines NCI-H929-IGF2BP1-OE, NCI-H929-IGF2BP1-KD, and RPMI-8226-IGF2BP1-KD could be constructed. In the EDU assay, by analyzing the differences in cell proliferation capacity among the NCI-H929-IGF2BP1-OE group, the RPMI-8226-IGF2BP1-KD group, and the IGF2BP1 negative control (IGF2BP1-NC) group, it was found that the proportion of EDU-positive cells (green) in the NCI-H929-IGF2BP1-OE group was significantly higher than that in the control group (p = 0.049, Figure 2A), suggesting that this group of cells proliferates more readily. The proportion of EDU-positive cells (red) in the RPMI-8226-IGF2BP1-KD group was significantly lower than that in the control group (p = 0.002, Figure 2B), indicating significantly poorer proliferation capacity. Furthermore, cell cycle analysis showed that overexpression of IGF2BP1 promoted cell cycle progression in NCI-H929 cells by increasing the proportion of cells in the S phase (repeated 3 times, S phase: p = 0.017, Figure 2C). Knockout of IGF2BP1 inhibited cell cycle progression in RPMI-8226 cells by reducing the proportion of cells in the S phase (repeated 3 times, S phase: p = 0.044, Figure 2D).
[0137] Subsequently, CCK-8 assay results further supported that IGF2BP1 overexpression stimulated the proliferation of NCI-H929 cells (p < 0.001), while IGF2BP1 knockout inhibited the proliferation of RPMI-8226 cells (p < 0.001, Figure 2E). DAPI staining showed that the multinucleation rate of NCI-H929-IGF2BP1-KD cells was significantly higher than that of control cells (p < 0.001, Figure 2F), indicating that NCI-H929-IGF2BP1-KD cells exhibited erroneously separated uncondensed chromosomes, cell cycle arrest in pre-S phase, and induced cell death.
[0138] Subsequently, the differences in in vivo growth of IGF2BP1-OE and IGF2BP1-NC cells after subcutaneous inoculation into B-NDG mice were further examined. Compared with IGF2BP1-NC cells (813.2±171.7 mm3), IGF2BP1-O2E NCI-H929 cells (1731.0±535.1 mm3) showed an approximately 2.13-fold increase in tumor volume (D14, p = 0.036; D17, p = 0.002; D19, p = 0.036; D21, p = 0.017, Figure 2G). In conclusion, IGF2BP1 promotes the proliferation and cell cycle progression of HMCLs.
[0139] Example 15: Combined analysis of MeRIP-seq, RNA-seq, CLIP-seq, and patient survival data
[0140] Transcriptome analysis of RNA M6A in NCI-H929 was performed using MeRIP-seq. A sequence-based RNA adenosine methylation site prediction tool (SRAMP) was used to identify potential m6A sites among the aforementioned peaks. The number of reliable predicted m6A site classifications in NCI-H929 is shown in Figure 3A. KEGG analysis revealed that 2608 genes associated with the peaks were enriched across 300 KEGG pathways. A scatter plot shows the top 30 significantly enriched KEGG pathways, including the Spliceosome, Hippo signaling pathway, Wnt signaling pathway, and cancer-related pathways (Figure 3B).
[0141] When IGF2BP1 acts as an m6A reader, it is a regulator of post-transcriptional or protein translation. Therefore, genes affected by changes in IGF2BP1 protein at the transcriptional level should be excluded. RNA-seq was performed using IGF2BP1-KD NCI-H929 cells and control cells. Figures 3C and 3D summarize the top 20 significantly enriched KEGG pathways among the downregulated differentially expressed genes (DEGs) (n = 230) and upregulated DEGs (n = 504) in the IGF2BP1-KD group. In NCI-H929 IGF2BP1-KD cells, the cancer progression pathway was most significantly enriched with IGF2BP1 downregulation (p < 0.001, q < 0.001), suggesting that IGF2BP1 may play an important role in the development and progression of multiple myeloma (MM).
[0142] Furthermore, Clip-seq analysis using an anti-IGF2BP1 antibody in NCI-H929 cells identified a total of 6,676 peak-related genes. GO enrichment suggests close association with biological processes (BP) involved in mitotic cell cycle, DNA repair, and RNA splicing. The top 10 significantly enriched KEGG pathways among IGF2BP1 target genes were identified as endocytosis, spliceosomes, and the AMPK signaling pathway (Figure 3E).
[0143] The overlap of differentially expressed genes / RNAs obtained from m6A-seq, IGF2BP1-KD RNA-seq, and IGF2BP1 CLIP-seq analyses is illustrated using a Venn diagram (Figure 3F). Since IGF2BP1 is an m6A reader, after excluding DEGs (downregulated and upregulated) from RNA-seq, genes with overlapping peaks from IGF2BP1 Clip-seq and MeRIP-seq (459 genes) were screened. Because these 459 mRNAs are simultaneously occupied by IGF2BP1 protein and modified by m6A, further survival analysis can be performed on them. Multivariate Cox regression analysis, using p<0.05 as the screening criterion, identified eight prognostic-related genes (GNB1L, SH3PXD2A, CDC5L, NR2F6, LINC00963, VPS25, PEX3, CPQ) from the MMRF dataset (Table 2). To prevent overfitting of the model, LASSO regression analysis was used to test these genes to determine if they were not overfitting. A hazard ratio (HR) greater than 1 indicates that the exposure factor was a contributing factor to a positive event (such as death). The results showed that independent adverse factors affecting overall survival (OS) in 1q+ MM patients were GNB1L (p < 0.001, HR 95% CI: 1.2, 1.1–1.4) and CDC5L (p = 0.0045, HR 95% CI: 1.1, 1–1.2). Since CDC5L protein has been shown to be a positive regulator of G2 / M cell cycle progression, the relationship between CDC5L expression levels and six molecular genetic markers was compared, and the impact of CDC5L expression on MM patient survival in the MMRF dataset was assessed. 1q+ (p = 0.002) and 13q deletion (p < 0.001) MM patients had significantly higher CDC5L mRNA levels (Figure 3G). In 1q+ MM patients, patients with higher CDC5L mRNA expression levels had poorer prognoses in terms of PFS (p = 0.001) and OS (p = 0.004) compared to those with lower CDC5L mRNA levels. IGF2BP1 mRNA expression levels did not have a significant prognostic effect on assessing survival in MM patients without 1q+ (Figure 3H). These results are consistent with observations that IGF2BP1 promotes the proliferation and cell cycle of NCI-H929 cells. Therefore, further analysis is needed to elucidate the relationship between IGF2BP1 and CDC5L.
[0144]
[0145] Example 16: Mechanism of Action and Site of Action of IGF2BP1
[0146] Compared to NCI-H929-IGF2BP1-NC cells, NCI-H929-IGF2BP1-OE cells showed higher expression of CDC5L protein (p = 0.021). Compared to RPMI-8226-IGF2BP1-NC cells, RPMI-8226-IGF2BP1-KD cells showed significantly reduced CDC5L protein expression (KD1: p = 0.004, KD2: p = 0.002) (Figure 4A). Subsequent mRNA stability assays using the transcriptional repressor actinomycin D over the effective time period indicated that IGF2BP1 did not affect CDC5L mRNA stability (Figure 4B), suggesting that the increase in CDC5L protein levels may not be due to increased mRNA stability. Cell cycle assays for NCI-H929-CDC5L-KD cells showed that knockout of CDC5L led to S-phase arrest (from 27.11% to 62.06%) (Figure 4C). To analyze the difference in cell proliferation between the RPMI-8226-CDC5L-KD group and the CDC5L-NC group, an EDU assay was performed. The proportion of EDU-positive cells (green) in the RPMI-8226-CDC5L-KD group was significantly lower than that in the control group, indicating significantly lower proliferation capacity (p < 0.001, Figure 4D). Furthermore, to confirm whether CDC5L mediates the proliferation of IGF2BP1 in NCI-H929 cells, an IGF2BP1 OE-CDC5L KD reversion cell line was constructed (Figure 4E). As shown in Figure 4F, CDC5L knockdown attenuated the proliferation effect of IGF2BP1 overexpression in NCI-H929 cells (p < 0.001). These findings suggest that the proliferation effect of IGF2BP1 on NCI-H929 cells may be mediated by CDC5L.
[0147] Based on the above results, to clarify the correlation between IGF2BP1 protein and CDC5L mRNA, the Bam files (two replicates, IP-1 vs Input-1, IP-2 vs Input-2) of CDC5L mRNA generated by IGF2BP1 Clip-seq were first visualized using Integrative Genomics Viewer (IGV). Blue shading corresponds to the RNA-seq mapping distribution of the Input, while red signals correspond to the IGF2BP1 Clip-seq peaks on CDC5L mRNA. The Y-axis in the bar chart represents the readings per million mappings (RPM), indicating the abundance of readings. After validation with qRT-PCR (p = 0.002) on immunoprecipitation samples of NCI-H929 (p = 0.002) and RPMI-8226 (p < 0.001) (anti-IGF2BP1 and IgG), the positive interaction between IGF2BP1 protein and CDC5L mRNA was confirmed (Figure 5A).
[0148] IGV trajectories show the MeRIP-seq read distribution of CDC5L mRNA in NCI-H929 cells. Blue shading corresponds to the total RNA-seq mapping distribution (Input), and red signals correspond to MeRIP-seq peaks on CDC5L mRNA (Fig. 5B). RT-qPCR was performed on the MeRIP products to validate m6A modification sites on CDC5L mRNA in NCI-H929 and RPMI-8226 cells (Fig. 5B). Simultaneously, the SRAMP database was used to predict m6A modification sites on CDC5L mRNA, including one very high-confidence site, two high-confidence sites, and two intermediate-confidence sites (Fig. 5C and Table 3). Considering the combined sites between CDC5L and IGF2BP1 derived from the Clip-seq peak data, 44403838 (high confidence) was selected as the mutation site (gaact to gTact) to remove m6A modification (Fig. 5D). The binding site of IGF2BP1 protein on CDC5L mRNA is 'AGAAGAGAACTTCGAGCAGC'. This site is consistent with the 'RRACH' consensus pattern (R, purine; H, non-guanine base) and is the most common m6A methylation modification site.
[0149] To confirm whether IGF2BP1 regulates CDC5L expression in NCI-H929 cells via mRNA modification in an m6A-dependent manner, a CDC5L-m6A mutant (MUT) cell line was constructed. Compared with the CDC5L-wild-type (WT) cell line, the proliferation rate of the CDC5L-m6A mutant (MUT) cell line was significantly reduced (72 hours, p < 0.01, Fig. 5E). Furthermore, the interaction between CDC5L-WT / CDC5L-MUT and IGF2BP1 in NCI-H929 cells was detected using RIP-qPCR, and both groups achieved good IP efficiency (Fig. 5F). IGF2BP1 showed abundant binding with CDC5L-WT mRNA, while binding with CDC5L-MUT mRNA was significantly reduced (Fig. 5G). These results indicate that CDC5L mRNA is a target of the m6A reading protein IGF2BP1, which recognizes and binds to the CDC5L RNA m6A site to increase CDC5L protein abundance.
[0150]
[0151] Example 17 Functional Validation of IGF2BP1 Inhibitor
[0152] The efficacy of IGF2BP1 inhibitors can be validated by evaluating the therapeutic potential of the IGF2BP1 inhibitor BTYNB in vitro and in vivo for the treatment of MM. Figure 6 As shown in A-6C, the expression level of CDC5L in NCI-H929, RPMI-8226, and MMIS cells gradually decreased with increasing BTYNB treatment time during the 24-hour treatment period. Furthermore, the viability of NCI-H929, RPMI-8226, and MMIS cells gradually decreased as the BTYNB concentration increased from 0 to 30 μM. Figure 6 D). To investigate the biological function of BTYNB on 1q+ MM cells in vivo, B-NDG mice were subcutaneously injected with NCI-H929 cells. After subcutaneous tumor establishment, BTYNB or placebo was administered once daily. Notably, on day 23, the tumor volume in the BTYNB group was significantly smaller than that in the placebo group (p = 0.036). Figure 6 The results (E) indicate that BTYNB effectively inhibits the growth of MM cells in an allogeneic mouse model. Therefore, inhibiting IGF2BP1 is a promising approach for treating 1q+ MM.
[0153] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.
Claims
1. The use of a substance that binds to IGF2BP1 or its target in the preparation of a therapeutic product for 1q+ multiple myeloma, characterized in that, The target of IGF2BP1 is CDC5L, and the substance that binds to IGF2BP1 or its target is a nucleic acid molecule or a small molecule chemical drug. The nucleic acid molecule is shRNA, and the shRNA is any of the nucleotide sequences shown in SEQ ID NO. 5-6. The small molecule chemical drug is BTYNB.
2. The use according to claim 1, characterized in that, The target of IGF2BP1 is the m6A site of the CDC5L gene mRNA.
3. The use according to claim 1, characterized in that, The multiple myeloma treatment product treats multiple myeloma by inhibiting the expression or activity of IGF2BP1 or its targets.
4. The use according to claim 1, characterized in that, Multiple myeloma can be treated by one or more of the following methods: inhibiting the expression of IGF2BP1 or its targets to inhibit tumor cell proliferation, inhibiting cell cycle transition, or reducing the process by which IGF2BP1 regulates the translation of CDC5L gene mRNA.
5. A gene interference nucleic acid construct containing the IGF2BP1 gene or its target, characterized in that, The construct is a lentiviral vector, and the nucleic acid construct contains shRNA, the nucleotide sequence of which is any one of SEQ ID NO.5~6.
6. Use of the construct according to claim 5 in the preparation of a 1q+ multiple myeloma treatment product.
7. A composition for treating 1q+ multiple myeloma, characterized in that, The composition comprises the construct of claim 5 and a pharmaceutically acceptable carrier or excipient.