A degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration and its application

By isolating and expressing the degradation fragment PvHMCs27 from the hemocyanin of Penaeus vannamei, the antioxidant system and metabolic function of the shrimp were enhanced, the adverse effects of ammonia nitrogen accumulation on shrimp in aquaculture were solved, the survival rate was improved and the blood ammonia toxicity was reduced.

CN115974994BActive Publication Date: 2025-09-05SHANTOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211228394.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-08
Publication Date
2025-09-05
Estimated Expiration
2042-10-08

AI Technical Summary

Technical Problem

The accumulation of ammonia nitrogen in aquaculture environments has adverse effects on shrimp, affecting their survival and the sustainable development of the aquaculture industry.

Method used

By isolating and identifying the degradation fragment PvHMCs27 from the hemocyanin of Penaeus vannamei, a recombinant vector was constructed and expressed in Escherichia coli. The recombinant protein PvHMCs27 was purified and injected into the shrimp to enhance its antioxidant system and metabolic function, and reduce blood ammonia toxicity and concentration.

Benefits of technology

It improves the survival rate of shrimp under ammonia nitrogen stress, reduces the toxicity and concentration of blood ammonia, enhances the adaptability of shrimp, and reduces the oxidative damage of ammonia nitrogen to the hepatopancreas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115974994B_ABST
    Figure CN115974994B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biotechnology and relates to a degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin that reduces blood ammonia toxicity and concentration. The amino acid sequence of the degradation fragment PvHMCs27 is shown in SEQ ID NO: 1, and the encoding gene is shown in SEQ ID NO: 2. Under high-concentration ammonia nitrogen stress (150 mg / L), the hemocyanin degradation fragment PvHMCs27 of the present invention can not only enhance the TCA cycle, generate more carbon dioxide, lower the pH value in the body, neutralize more NH3 in the body, and reduce blood ammonia content, but also improve the shrimp antioxidant system and enhance the activity of tissue repair-related enzymes to reduce the degree of oxidative damage in the hepatopancreas, thereby improving the survival rate of shrimp under ammonia nitrogen stress. The degradation fragment PvHMCs27 of the present invention that reduces blood ammonia toxicity and concentration can be used as a preparation for reducing blood ammonia toxicity and concentration, thereby improving the adaptability of shrimp under ammonia nitrogen stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration and an application thereof. Background Art

[0002] Ammonia nitrogen, nitrite and nitrate are the most common inorganic nitrogen in water. These inorganic nitrogen are very important to aquatic organisms, but they may also be highly toxic. Ammonia nitrogen, in particular, as a nutrient in water, is not only one of the important indicators for monitoring environmental pollution, but also can reflect the living conditions of organisms. Ammonia nitrogen exists in two forms: NH4 + and NH3, of which NH3 is the more toxic. Ammonia nitrogen excretion by aquatic organisms is primarily determined by its environmental levels. In shrimp, ammonia nitrogen is primarily excreted into the surrounding environment via a concentration gradient, either from the body or through the hemolymph (which is usually higher). However, during aquaculture, ammonia nitrogen is generated through numerous pathways, including nitrogen-containing exogenous substances, feed, feces, dead individuals, algae, ammonia metabolism, and ammonia nitrogen exchange between aquatic organisms and the surrounding water. Consequently, ammonia nitrogen in the aquaculture environment gradually accumulates due to these pathways, leading to increasing ammonia nitrogen levels in the water. Ultimately, this leads to excessive blood ammonia levels in aquatic organisms, adversely affecting shrimp and even seriously impacting the sustainable development of the shrimp aquaculture industry. Recently, it has been discovered that under ammonia nitrogen stress, shrimp can reduce plasma oxyhemocyanin levels, resulting in oxygen depletion and impaired aerobic respiration. This may be an adaptive mechanism by which hemocyanin suppresses the respiratory burst in response to ammonia nitrogen stress. Therefore, researchers believe that elucidating the mechanisms by which shrimp respond to ammonia nitrogen is an effective strategy to address this issue. Summary of the Invention

[0003] The purpose of the present invention is to solve the problem of adverse effects of ammonia nitrogen accumulation on shrimp in an aquaculture environment.

[0004] Research has revealed that shrimp hemocyanin may interact with transglutaminase and influence ROS levels by regulating the antioxidant system in the hepatopancreas of Penaeus vannamei. These findings suggest that shrimp hemocyanin may respond to ammonia nitrogen stress. Given that shrimp hemocyanin can exert diverse biological functions through genetic polymorphism, post-translational modification, and degradation to form immunologically active fragments, the search for a hemocyanin degradation fragment, PvHMCs27, that reduces ammonia toxicity and concentration in shrimp blood could improve shrimp resistance to ammonia nitrogen and effectively address the adverse effects of ammonia nitrogen accumulation on shrimp in aquaculture environments.

[0005] The invention relates to a degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration, and the amino acid sequence thereof is shown in SEQ ID NO: 1.

[0006] The present invention also provides a gene encoding the degradation fragment PvHMCs27 derived from the vannamei hemocyanin for reducing blood ammonia toxicity and concentration, as shown in SEQ ID NO: 2.

[0007] The present invention also provides an expression cassette of the above encoding gene.

[0008] The present invention also provides a recombinant bacterium encoding the gene.

[0009] At present, there is no cell line level for arthropods, especially shrimp. Therefore, in order to obtain the protein fragment, the present invention screened and constructed a prokaryotic expression strain of HMCs27 by purifying the PCR product of the degradation fragment PvHMCs27 and transforming it into Escherichia coli for cultivation.

[0010] The present invention also provides a recombinant vector of the above encoding gene.

[0011] The present invention also provides the use of the degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration, the encoding gene or the recombinant vector in preparing a product for reducing blood ammonia toxicity and concentration.

[0012] The present invention also provides a product for reducing blood ammonia toxicity and concentration, comprising the degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration, the encoding gene or one or more of the recombinant vectors.

[0013] Furthermore, the above products include injections, which can be used for immune conditioning or enhancement of shrimps and crabs, especially shrimps.

[0014] The blood ammonia toxicity and concentration-reducing degradation fragment PvHMCs27 of the present invention can be expressed and purified in prokaryotes using methods known to those skilled in the art.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention isolated and identified a hemocyanin-derived degradation fragment (PvHMCs27) of approximately 13.70 kDa from the plasma of Penaeus vannamei subjected to ammonia nitrogen stress for 12 hours using two-dimensional electrophoresis combined with mass spectrometry. The complete amino acid sequence of PvHMCs27 was obtained using de novo mass spectrometry sequencing and other methods. Primers were designed based on the nucleotides corresponding to the PvHMCs27 amino acid sequence to clone the PvHMCs27 nucleotide sequence. The nucleotide sequence was then constructed into a prokaryotic expression vector, transformed into Escherichia coli, and recombinant PvHMCs27 was obtained through induced expression and purification. Further analysis of the effects of PvHMCs27 injection and combined ammonia nitrogen stress on the shrimp revealed that the degradation fragment could, on the one hand, reduce the degree of oxidative damage to the hepatopancreas caused by blood ammonia by enhancing the shrimp's antioxidant system and the expression of enzymes related to tissue repair, thereby improving the survival rate of the shrimp under ammonia nitrogen stress. On the other hand, it can promote the TCA cycle, produce more carbon dioxide, lower the body's pH, and neutralize excess NH3 in the body, thereby reducing the toxicity and concentration of blood ammonia. This may be the mechanism of action of PvHMCs27. The degradation fragment PvHMCs27 of the present invention, which reduces blood ammonia toxicity and concentration, can be used as a preparation to reduce blood ammonia toxicity and concentration, thereby improving the adaptability of shrimp to ammonia nitrogen stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a 2-DE diagram of the hemocyanin degradation fragment PvHMCs27 that reduces blood ammonia toxicity and concentration, which was separated and obtained in Example 1;

[0018] Figure 2 The figure is an SDS-PAGE image of the degradation fragment PvHMCs27 for reducing blood ammonia toxicity and concentration and the control GST;

[0019] Figure 3 This is a graph analyzing the survival of Penaeus vannamei after being injected with the degradation fragment PvHMCs27 of the present invention that reduces blood ammonia toxicity and concentration and combined with ammonia nitrogen stress;

[0020] Figure 4 This is a GO annotation analysis diagram of differentially expressed genes in the hepatopancreas transcriptome of shrimp injected with the degradation fragment PvHMCs27 of the present invention that reduces blood ammonia toxicity and concentration and combined with ammonia nitrogen stress;

[0021] Figure 5 This is a KEGG annotation analysis diagram of differentially expressed genes in the hepatopancreas transcriptome of shrimp injected with the degradation fragment PvHMCs27 of the present invention that reduces blood ammonia toxicity and concentration and combined with ammonia nitrogen stress;

[0022] Figure 6This is a qPCR analysis of antioxidant, metabolism, and hydrolysis-related genes such as Cu-Zn SOD (superoxide dismutase [Cu-Zn]-like), CAT (catalase-like), GPX (glutathione peroxidase-like), GST (glutathione S-transferase), Cyt C (cytochrome c), IDH (isocitrate dehydrogenase), trypsin, and chymotrypsin after the degradation fragment PvHMCs27 of the present invention, which reduces blood ammonia toxicity and concentration, was injected into shrimp and combined with ammonia nitrogen stress;

[0023] Figure 7 This is an analysis chart showing the effect of the degradation fragment PvHMCs27, which reduces blood ammonia toxicity and concentration, injected into shrimp under ammonia nitrogen stress on the activities of enzymes such as CAT (catalase), SOD (superoxide dismutase), and T-AOC (total antioxidant capacity);

[0024] Figure 8 This is an analysis chart showing the effect of injecting the degradation fragment PvHMCs27, which reduces blood ammonia toxicity and concentration, into shrimp and combining it with ammonia nitrogen stress on changes in blood ammonia content and plasma pH;

[0025] Figure 9 This is an analysis chart showing the effect of injecting the degradation fragment PvHMCs27 for reducing blood ammonia toxicity and concentration into shrimp and combining it with ammonia nitrogen stress on the changes in plasma ALT and GST levels. DETAILED DESCRIPTION

[0026] In order to better understand the present invention, the present invention is further described in detail below with reference to the embodiments and drawings. However, those skilled in the art will understand that the following embodiments are not limitations on the scope of protection of the present invention, and any changes and modifications made on the basis of the present invention are within the scope of protection of the present invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0029] Example 1: Isolation and Identification of Shrimp Hemocyanin Degradation Peptides Related to Reducing Blood Ammonia Toxicity and Concentration

[0030] (1) Add ammonium chloride to 10‰ seawater and prepare it to a final ammonia nitrogen concentration of 150 mg / L. The control group uses 10‰ seawater without any treatment. After 12 hours of shrimp culture under ammonia nitrogen stress, extract the shrimp hemolymph. Wipe the posterior edge of the shrimp cephalothorax with a 75% alcohol cotton ball, extract the hemolymph from the shrimp heart with a disposable syringe and mix it with an anticoagulant (1:1). Centrifuge at 800g for 10 minutes at 4℃ to remove blood cells and take the supernatant. Ultracentrifuge at 32000rpm at 4℃ for 10 hours to remove most of the intact hemocyanin and take the supernatant. Pre-cool acetone precipitation to remove insoluble proteins, dissolve with loading buffer, and store at -20℃ for later use.

[0031] (2) Determine protein concentration using the BCA method. First, add 20 μl of BSA Protein Standard of different concentrations, the sample to be tested, and the blank control to each well of a 96-well plate. Then, add 200 μl of BCA working solution to each well in turn and mix well. Place the plate at 37°C for 30 minutes and cool naturally to room temperature. Use a microplate reader to measure the absorbance at a wavelength of 562 nm (or 540-590 nm). Prepare a protein concentration standard curve based on the concentration and absorbance of the protein standard. Finally, calculate the protein concentration of the sample based on the protein concentration standard curve and the sample dilution factor.

[0032] (3) Isoelectric focusing in the first dimension of two-dimensional electrophoresis. Take 150 μl of hydration loading buffer (add 0.01g DTT and 5μl Bio-Lyte 3-10 before use), add 200μg of protein sample and mix thoroughly. Centrifuge to remove bubbles. Add sample linearly from left to right along the edge of the focusing disk or hydration disk. Do not add sample about 1 cm at both ends of the groove. The sample liquid in the middle must be continuous. Place the IPG strip with the gel surface facing down on the sample solution in the focusing disk or hydration disk, ensuring that the strip is in close contact with the electrode. Cover each strip with 1ml of mineral oil to prevent evaporation of the liquid during the hydration process of the strip. Align the positive and negative electrodes and cover with a lid. Set the isoelectric focusing program: 50V active hydration for 12h, 250V slow desalting for 1h, 1000V slow desalting for 2h, 4000V linear boost for 2h, 4000V rapid focusing to 32000Vh, and 500V for 24h. After focusing, immediately perform equilibration and second-dimension Tricine-SDS-PAGE electrophoresis on the strips, or place the strips in a sample hydration tray and store them in a -20°C refrigerator for later use.

[0033] (4) Tricine-SDS-PAGE in the second dimension of two-dimensional electrophoresis. (2006) were used. The gel concentrations used in this experiment were: 4% T, 3% C stacking gel, 10% T, 3% C interlayer gel, and 16.5% T, 3% C separating gel. After electrophoresis began, maintain a constant voltage of 30V for the stacking and interlayer gels, and 120V for the separating gel. When the bromophenol blue reached 2 cm from the bottom of the gel, the voltage was increased to 160V until all the bromophenol blue had escaped from the gel. After electrophoresis, gently pry apart the two glass layers, remove the gel, and cut off the corners to mark the gel (wear gloves to prevent contamination). Stain with Coomassie Brilliant Blue, and scan the image.

[0034] (5) Compare the 2-D electrophoresis patterns of the experimental and control groups, e.g. Figure 1 As shown in the figure, it can be found that the small molecular peptides below 29kDa in the hemolymph of shrimps stressed by ammonia nitrogen for 12 hours are significantly more than those in the control group. The PDQuest8.0 software provided by Bio-Rad Company of the United States was used to analyze the gel images and find the differentially expressed protein spots.

[0035] (6) Mass spectrometry identification: The proteins with significant differences (up-regulated or down-regulated) were spotted on gel and sent to Shantou University Medical College for mass spectrometry analysis to identify the protein.

[0036] Example 2: Analysis of molecular characteristics of shrimp hemocyanin degradation peptides related to reducing blood ammonia toxicity and concentration

[0037] (1) According to the mass spectrometry results, the protein spots identified as hemocyanin with significant differences were excised and recovered.

[0038] (2) The protein gel spots were sent to Shenzhen Micron for De novo mass spectrometry sequencing.

[0039] (3) The sequencing results successfully obtained the complete 122-amino acid sequence of the PvHMCs27 degradation fragment, with a theoretical Mw of 13.70 kDa, which 100% matches the amino acid sequence 277-398 at the M-terminus of the small subunit of hemocyanin. The amino acid sequence of PvHMCs27 is as follows:

[0040] Lys-Tyr-Gly-Gly-Gln-Phe-Pro-Ala-Arg-Pro-Asp-Asn-Val-Lys-Phe-Glu-Asp-Val-Asp-Asp-Val -Ala-Arg-Ile-Arg-Asp-Met-Val-Ile-Val-Glu-Ser-Arg-Ile-Arg-Asp-Ala-Ile-Ala-His-Gly-Ty r-Ile-Val-Asp-Ser-Glu-Gly-Lys-His-Ile-Asp-Ile-Ser-Asn-Glu-Lys-Gly-Ile-Asp-Ile-Le u-Gly-Asp-Ile-Ile-Glu-Ser-Ser-Leu-Tyr-Ser-Pro-Asn-Val-Gln-Tyr-Tyr-Gly-Ala-Leu-Hi s-Asn-Thr-Ala-His-Ile-Val-Leu-Gly-Arg-Gln-Gly-Asp-Pro-His-Gly-Lys-Phe-Asp-Leu-Pr o-Pro-Gly-Val-Leu-Glu-His-Phe-Glu-Thr-Ala-Thr-Arg-Asp-Pro-Ser-Phe-Phe-Arg-Leu-His

[0041] Example 3: PvHMCs27 gene cloning and prokaryotic expression

[0042] (1) Based on the N-terminal and C-terminal sequences of the polypeptide, the amino acid sequence 277-398 at the M-terminus of the small subunit of hemocyanin was located. Combined with the nucleotide sequence: AAGTATGGAGGTCAGTTCCCTGCTCGTCCTGACAATGTTAAATTCGAAGATGTGGACGATGTTGCTCGAATTCGAGATATGGTCATCGTGGAGAGTCGAATTCGTGATGCCATTGCCCATGGCTATATAGTTGACAGTGAGGGCAAACACATTGACATCAGTAATGAGAAAGGTATTGACATTCTTGGTGATATCATCGAATCCTCACTATACAGTCCCAACGTGCAGTACTATGGAGCTTTACATAACACTGCCCATATTGTACTAGGCCGTCAAGGGGATCCTCATGGAAAGTTTGATTTACCACCTGGTGTGCTGGAACACTTCGAAACTGCCACCCGTGATCCCAGCTTCTTCCGGCTTCAC, PCR primers were designed and PCR amplification was performed using hepatopancreas cDNA as a template. The target band was recovered and purified using an agarose gel DNA recovery kit (Shanghai Biotechnology Co., Ltd.) according to the kit instruction manual, and the concentration was measured for use in the next experiment.

[0043] (2) The purified PCR product and pGEX-6p-1 were digested with restriction endonucleases, the concentrations were measured after gel recovery, and the ligated products were ligated with T4 ligase overnight at 16°C. The ligated products were transformed into Escherichia coli strain BL21 and cultured in an inverted manner on LB solid medium containing 100 μg / mL ampicillin (AMP) at 37°C.

[0044] (3) Pick a single colony and culture it in LB liquid medium containing 100 μg / mL Amp at 37°C. Perform PCR verification on the bacterial solution. Based on the verification results, send some of the bacterial strains to BGI for sequencing to verify the correctness of the sequence. Based on the sequencing results, retain the bacterial strain with the correct sequence. Add glycerol to a final concentration of 20% to the bacterial solution and store at -20°C until use.

[0045] (4) The strain with the correct sequence was used for induced expression. The strain with the correct sequence was added to liquid LB medium (containing AMP 100 μg / mL) at a ratio of 1:100; IPTG was added to a final concentration of 0.05 mM when the OD600 was about 0.6 at 37°C and 180 rpm; 1 mL of bacterial solution was taken out as an uninduced control; the bacterial solution after induction at 37°C for 16 hours was transferred to a centrifuge tube and centrifuged at 5000 g for 20 minutes at 4°C to collect the bacteria; an appropriate amount of ultrasonic disruption buffer (containing 50 mM Tris, 5 mM EDTA, 100 mM NaCl, pH 8.0, and 1 mM PMSF) was added to resuspend the bacteria; the bacteria were ultrasonically disrupted on ice; the culture was centrifuged at 20000 g for 30 minutes at 4°C, and the supernatant and precipitate were collected respectively; SDS-PAGE analysis was performed to verify whether there was induced expression.

[0046] (5) Denature the inclusion bodies containing the target fragment with 8 M urea for 2 h, dialyze against dialysis buffer (50 mM Tris-HCl, 50 mM NaCl, 10% Glycine, 10% Glycerol, pH 8.0) at 4°C for 48 h (change the dialysis buffer every 24 h), and collect the dialyzed protein solution.

[0047] (6) GST-tagged PvHMCs27 (abbreviated as rGST-HMCs27, the same below) was purified using GST columns (GE Heathercare, US).

[0048] (7) The GST tag was removed using PreScission Protease (GE Healthcare, US) to obtain the prokaryotic expression protein PvHMCs27.

[0049] (8) According to the above steps, the E. coli BL21 strain transformed with the pGEX-6P-1 plasmid was induced to express, and the GST-tagged protein was purified using a GST column. GST was specifically eluted from the column using 10 mM reduced glutathione and stored at -20°C for later use.

[0050] SDS-PAGE analysis Figure 2 As shown: purified recombinant GST protein (rGST) and recombinant PvHMCs27 (rGST-HMCs27) were obtained.

[0051] Example 4: Analysis of the survival of shrimps after rGST-PvHMCs27 injection combined with ammonia nitrogen stress

[0052] (1) The recombinantly expressed degradation fragment PvHMCs27 was diluted to 50 μg / mL with sterile 0.01 M PBS (pH 7.4) (negative control: recombinantly expressed GST: 50 μg / mL). 100 μl of the recombinant protein solution was injected into the second abdominal segment of the shrimp using a sterile 1 ml syringe.

[0053] (2) Then, an ammonia nitrogen (150 mg / L) stress experiment was conducted, and the survival of shrimp was recorded at 0, 6, 12, 18, 24, and 30 h.

[0054] The results are as follows Figure 3 As shown in the results, it was found that the survival rate of shrimp was significantly improved after injection of the degradation fragment PvHMCs27 combined with ammonia nitrogen stress for 24 hours.

[0055] Example 5: Analysis of the effects of rGST-PvHMCs27 injection combined with ammonia nitrogen stress on the hepatopancreas transcriptome of shrimp

[0056] (1) The same treatment conditions as in Example 4 were used to culture the shrimp Penaeus vannamei.

[0057] (2) Five shrimps were randomly selected within 24 hours, and the hepatopancreas tissue was taken. The total RNA of the hepatopancreas was extracted by Trizol method. After molecular gel electrophoresis and concentration determination, the RNA was sent to Shanghai Meiji Biotechnology Co., Ltd. for transcriptome sequencing analysis.

[0058] The results are as follows Figure 4-5 As shown, the GO database was used to analyze the 973 genes that were detected differently before and after rGST-HMCs27 injection combined with ammonia nitrogen stress conditions. The genes were annotated into three major categories (cellular component; molecular function; biological process). After further classification, a total of 20 functional subcategories were obtained. Among them, in the cellular component classification, the two secondary categories of membrane component (membrane part) and cell component (cell part) had the most annotated genes, which were 222 and 115 genes respectively. In the molecular function classification, it was mainly enriched in the two functional subcategories of catalytic activity and binding, with 211 and 209 genes respectively. In the biological process classification, it was mainly enriched in the two subcategories of cellular process (cellular process) and metabolic process (metabolic process), with 149 and 137 genes respectively ( Figure 4 ).

[0059] KEGG was used to annotate the pathways of the 973 differentially expressed genes obtained previously. The results showed that 287 and 506 up-regulated and down-regulated genes, totaling 793 genes, were annotated to the corresponding pathways. Among them, signal transduction (22 up-regulated and 43 down-regulated genes) was the most annotated, followed by carbohydrate metabolism (31 up-regulated and 32 down-regulated genes), endocrine system (15 up-regulated and 36 down-regulated genes), neurodegenerative disease (14 up-regulated and 34 down-regulated genes), digestive system (16 up-regulated and 31 down-regulated genes), cancer overview (11 up-regulated and 35 down-regulated genes), transport and catabolism (14 up-regulated and 28 down-regulated genes), immune system (15 up-regulated and 19 down-regulated genes), glycan biosynthesis and metabolism (16 up-regulated and 31 down-regulated genes), and mitochondria: anatomy and physiology (18 up-regulated and 28 down-regulated genes). metabolism, up-regulated and down-regulated genes totaling 12 and 20), parasitic infectious diseases (Infectious disease: parasitic, up-regulated and down-regulated genes totaling 5 and 25) and other pathway-related genes ( Figure 5 ).

[0060] Furthermore, 90 differentially expressed genes related to metabolism were screened from the above differentially expressed genes, of which 60 were upregulated and 30 were downregulated (Tables 1 and 2). Further analysis of these differentially expressed genes revealed that compared with the control group, the expression levels of genes related to antioxidant enzymes, metabolism, and hydrolysis (trypsin and chymotrypsin are involved in tissue repair), such as Cu-Zn SOD (superoxide dismutase [Cu-Zn]-like), CAT (catalase-like), GPX (glutathione peroxidase-like), Cyt C (cytochrome c), IDH (isocitrate dehydrogenase), trypsin, and chymotrypsin, were significantly upregulated in the rGST-PvHMCs27 injection combined with ammonia nitrogen stress group (Table 1). The expression levels of genes related to liver tissue damage indicators, such as GST (glutathione S-transferase) and ALT (alanine aminotransferase), were significantly downregulated (Table 2). PvHMCs27 can reduce blood ammonia toxicity by enhancing the expression of genes related to the antioxidant system, metabolism and tissue repair (hydrolase), thereby improving the adaptability of shrimp under ammonia nitrogen stress. Table 1. List of significantly upregulated differentially expressed genes in the hepatopancreas transcriptome of shrimp injected with PvHMCs27 and combined with ammonia nitrogen stress.

[0061]

[0062]

[0063] Table 2. List of differentially expressed genes significantly downregulated in the hepatopancreas transcriptome of shrimp injected with the degradation fragment PvHMCs27 that reduces blood ammonia toxicity and concentration and combined with ammonia nitrogen stress.

[0064]

[0065] Example 6: Verification of significantly altered genes in hepatopancreas transcriptomics by rGST-PvHMCs27 injection combined with ammonia nitrogen stress

[0066] (1) The same treatment conditions as in Example 4 were used to culture Penaeus vannamei.

[0067] (2) Five healthy Penaeus vannamei were randomly selected within 24 h, and the hepatopancreas tissue was taken. The total RNA of the hepatopancreas was extracted using the RNAfast200 kit (Shanghai Feijie). One-step gDNA Removal and cDNA Synthseis SuperMix (Beijing Quanshijin) instructions were used to reverse transcribe the hepatopancreas total RNA prepared above into cDNA for qPCR analysis.

[0068] The results are as follows Figure 6 As shown in the results, the transcription levels of SOD, CAT, GPX, IDH, Cyt C, trypsin and chymotrypsin were significantly upregulated, while the transcription level of GST was significantly downregulated, which was consistent with the sequencing results.

[0069] Example 7: Analysis of the effect of rGST-PvHMCs27 on blood ammonia content and toxicity of shrimp

[0070] (1) The same treatment conditions as in Example 4 were used to culture Penaeus vannamei.

[0071] (2) Five shrimps were randomly selected within 24 hours and their hepatopancreas tissues and plasma were collected.

[0072] (3) Blood ammonia content test (item number: A086-1-1, Nanjing Jiancheng), CAT test (item number: A007-1-1, Nanjing Jiancheng), total antioxidant capacity test (item number: A015-3-1, Nanjing Jiancheng), total superoxide dismutase test (item number: A001-1-1, Nanjing Jiancheng), ALT detection kit (item number: C009-2-1, Nanjing Jiancheng), GST detection kit (item number: A004-1-1, Nanjing Jiancheng), etc. were performed according to the instructions. Tissue protein content was determined according to the BCA method, and plasma pH was measured using a pH meter (Mettler Toledo, model: FE20K).

[0073] The results are as follows Figures 7-9 As shown in the figure, compared with the control group, the enzyme activities of SOD and CAT and the total antioxidant capacity of the hepatopancreas (various antioxidant substances and antioxidant enzymes, T-AOC) in the rGST-HMCs27 injection combined with ammonia nitrogen stress group were significantly upregulated ( Figure 7 ), while blood ammonia content, plasma pH, plasma GST and ALT contents were significantly downregulated ( Figures 8-9 )(P<0.05). It is speculated that PvHMCs27 can, on the one hand, reduce the degree of oxidative damage to the hepatopancreas caused by ammonia nitrogen by improving the antioxidant system of shrimp, and on the other hand, promote the TCA cycle by inducing the expression of IDH, producing more carbon dioxide, lowering the pH value in the body, and neutralizing more NH3 in the body, thereby reducing the toxicity and concentration of blood ammonia and improving the survival rate of shrimp under ammonia nitrogen stress.

[0074] The above disclosure is merely a preferred embodiment of the present invention and certainly cannot be used to limit the scope of the present invention. Therefore, equivalent changes made according to the claims of the present invention are still within the scope of the present invention.

Claims

1. A degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration, the amino acid sequence of which is shown in SEQ ID NO:

1.

2. A gene encoding the degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin that reduces blood ammonia toxicity and concentration as claimed in claim 1, as shown in SEQ ID NO:

2.

3. An expression cassette containing the coding gene as claimed in claim 2.

4. A recombinant bacterium containing the coding gene as claimed in claim 2.

5. A recombinant vector containing the coding gene according to claim 2.

6. Use of the degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration as claimed in claim 1, the encoding gene as claimed in claim 2, or the recombinant vector as claimed in claim 5 in the preparation of an injection for reducing blood ammonia toxicity and concentration.

7. An injection for reducing blood ammonia toxicity and concentration, characterized in that: Contains one or more of the degradation fragment PvHMCs27 derived from Penaeus vannamei hemocyanin for reducing blood ammonia toxicity and concentration as claimed in claim 1, the encoding gene as claimed in claim 2, and the recombinant vector as claimed in claim 5.