Molecular markers for predicting the therapeutic efficacy of interferon α in patients with hepatitis B and its application

Abstract

The present invention belongs to the field of biomedicine, and discloses molecular markers for predicting the therapeutic efficacy of interferon α on hepatitis B patients and their applications. Including: 1. A molecular marker combination for predicting the therapeutic efficacy of interferon α on hepatitis B patients, including BST2rs9576, and at least one other molecular marker. 2. Reagents and / or kits for detecting the above molecular marker combination, including reagents for detecting the molecular marker BST2rs9576. 3. A kit, including primers for detecting the molecular marker BST2rs9576. 4. The use of reagents for detecting molecular markers in the preparation of products for predicting the therapeutic efficacy of interferon α on hepatitis B patients, the molecular marker is BST2rs9576, and the reagents are primers for detecting BST2rs9576. The primers and products provided by the present invention can specifically and efficiently detect the polymorphic sites of molecular markers to achieve pre-treatment prediction.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to molecular markers for predicting the therapeutic efficacy of interferon alpha on hepatitis B patients and applications thereof. Background Art

[0002] Chronic hepatitis B (CHB) is a global public health threat, with an estimated 292 million people infected worldwide. Currently, hepatitis B virus (HBV) infection is considered to be the main risk factor for chronic hepatitis B and liver cancer.

[0003] Currently, the first-line clinical drugs for anti-HBV include pegylated interferon alpha (PegIFNα) and nucleoside analogues (NUCs). PegIFNα has a wide range of antibacterial activity and is also the most important cytokine for antiviral infection. Although PegIFNα has obvious adverse reactions, its many advantages have also made it always active in the first-line clinical treatment plan: the once-weekly dosing regimen improves patient compliance and tolerance, and has the dual effects of regulating immunity and antiviral, allowing patients to obtain long-term responses during treatment; it can be used as an important part of some new combination drug regimens; and it plays a more important role than NUCs in preventing CHB patients from progressing to liver cancer. However, currently PegIFNα treatment only responds in a small number of patients (about 30%), and the treatment price is relatively expensive. If we can screen out these patients who respond to PegIFNα treatment, we can continue to treat them in the same way; while for patients who do not respond or respond poorly, we will adjust the treatment plan and carry out precise treatment to reduce the high cost of treatment but poor treatment effect. Therefore, it is particularly important to screen patients' response to PegIFNα treatment before treatment. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a molecular marker combination for predicting the therapeutic efficacy of interferon (IFN) α on hepatitis B patients, which can evaluate the efficacy of antiviral treatment of hepatitis B patients with interferon α, so as to facilitate the selection of treatment methods and precise treatment.

[0005] The present invention also provides a reagent and / or a kit for detecting the molecular marker combination.

[0006] The invention also provides a kit for predicting the therapeutic effect of interferon alpha on hepatitis B patients.

[0007] The present invention also proposes the use of a reagent for detecting molecular markers in the preparation of a product for predicting the therapeutic efficacy of interferon α on hepatitis B patients.

[0008] According to one aspect of the present invention, a molecular marker combination for predicting the therapeutic efficacy of interferon α on hepatitis B patients is proposed, wherein the molecular marker combination includes BST2 rs9576 and at least one other molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients.

[0009] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved:

[0010] The present invention can evaluate the efficacy of interferon α antiviral treatment of hepatitis B patients based on the genotyping results of detecting BST2 rs9576 and at least one other molecular marker used to predict the therapeutic efficacy of interferon α on hepatitis B patients, thereby facilitating the selection of antiviral treatment plans and precise treatment of hepatitis B patients.

[0011] In liver cells infected or not infected with viruses, interferon can induce the expression of antiviral genes called interferon stimulated genes (ISGs). Bone marrow stromal cell antigen 2 (BST2), also known as CD317 or tetherin, is one of the ISGs that inhibit the release of enveloped viruses. The inventors found in previous studies that in cell experiments, the higher the expression of BST2, the better the response to interferon α treatment, suggesting that single nucleotide polymorphisms (SNPs, which refer to DNA sequence polymorphisms caused by variations in single nucleotides at the genomic level, are a common type of heritable genomic variation in humans) sites associated with BST2 expression in the BST2 gene may be related to the evaluation of the efficacy of interferon α treatment in patients with hepatitis B. Based on this, the inventors screened out a potential functional SNP site from the BST2 gene: rs9576.

[0012] In some embodiments of the present invention, the at least one other molecular marker for predicting the therapeutic efficacy of interferon α in treating hepatitis B patients includes ALPK1 rs35389530; and / or the at least one other molecular marker for predicting the therapeutic efficacy of interferon α in treating hepatitis B patients includes at least one of HLA-DPA1 rs3077, PAK4 rs9676717, CYP27B1rs4646536, and IFNAR1 rs2850015.

[0013] In some embodiments of the present invention, the hepatitis B patient is a chronic hepatitis B patient.

[0014] In some embodiments of the present invention, the hepatitis B patient includes a mild chronic hepatitis B patient, a moderate chronic hepatitis B patient or a severe chronic hepatitis B patient.

[0015] In some embodiments of the present invention, the interferon alpha comprises pegylated interferon alpha or a derivative thereof.

[0016] In some embodiments of the present invention, the pegylated interferon alpha includes any one of pegylated interferon alpha-2a and pegylated interferon alpha-2b.

[0017] In some embodiments of the present invention, the pegylated interferon alpha derivative includes any one of dextran pegylated interferon alpha, transferrin pegylated interferon alpha, carboxy pegylated interferon alpha, and glycine-pegylated interferon alpha.

[0018] In some embodiments of the present invention, the evaluation index of the therapeutic effect includes at least the level of hepatitis B antigen (HBsAg) in the hepatitis B patient.

[0019] In some embodiments of the present invention, the evaluation index of the therapeutic effect also includes the levels of hepatitis B e antigen (HBeAg), hepatitis B virus (HBV) DNA, and alanine aminotransferase (ALT) in the hepatitis B patient.

[0020] In some embodiments of the present invention, after treatment with interferon α, the HBsAg of the hepatitis B patient is cleared or converted (accompanied by the production of anti-HBsAg antibodies), and HBeAg seroconversion occurs (accompanied by the production of anti-HBeAg antibodies), the HBVDNA level is <2000 IU / mL, and ALT is <the lower limit of normal value, which means that interferon α is effective in treating hepatitis B patients.

[0021] According to a second aspect of the present invention, a reagent and / or a kit for detecting the molecular marker combination is provided, including a reagent for detecting the molecular marker BST2 rs9576.

[0022] In some embodiments of the present invention, the reagent further comprises a reagent for detecting at least one of the molecular markers ALPK1 rs35389530, HLA-DPA1 rs3077, PAK4 rs9676717, CYP27B1 rs4646536, and IFNAR1 rs2850015.

[0023] In some embodiments of the present invention, the reagent is a primer for detecting the molecular marker BST2 rs9576.

[0024] In some embodiments of the invention, the primer comprises any one of (a) or (b):

[0025] (a) a primer consisting of the single-stranded DNA shown in SEQ ID NO: 1 and the single-stranded DNA shown in SEQ ID NO: 2;

[0026] (b) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:1 and SEQ ID NO:2, and having the same function as the primer in (a), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0027] In some embodiments of the present invention, SEQ ID NO: 1 is 5'-CCCATAACAACAGGCAGCAC-3', and SEQ ID NO: 2 is 5'-TCATGGGGCAACACGGTTAG-3'.

[0028] In some embodiments of the present invention, the reagents further include any one of sequencing reagents, restriction fragment length polymorphism detection reagents, flight mass spectrometry detection reagents, fluorescent probe detection reagents, and gene chip detection reagents.

[0029] In some embodiments of the present invention, the reagent also includes a primer for detecting the molecular marker ALPK1 rs35389530.

[0030] In some embodiments of the invention, the primer comprises any one of (c) or (d):

[0031] (c) a primer consisting of the single-stranded DNA shown in SEQ ID NO:3 and the single-stranded DNA shown in SEQ ID NO:4;

[0032] (d) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:3 and SEQ ID NO:4, and having the same function as the primer in (c), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0033] In some embodiments of the present invention, SEQ ID NO: 3 is 5'-ACGTTGACGACAGGTCAGC-3', and SEQ ID NO: 4 is 5'-CCTGGGGTATTATGAGGCGAG-3'.

[0034] In some embodiments of the present invention, the primers are used to detect mutations of the molecular markers.

[0035] In some preferred embodiments of the present invention, the primers are used to detect point mutations of the molecular markers.

[0036] According to a third aspect of the present invention, a kit for predicting the therapeutic efficacy of interferon α on hepatitis B patients is provided, comprising primers for detecting the molecular marker BST2 rs9576; the primers include any one of (a) or (b):

[0037] (a) a primer consisting of the single-stranded DNA shown in SEQ ID NO: 1 and the single-stranded DNA shown in SEQ ID NO: 2;

[0038] (b) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:1 and SEQ ID NO:2, and having the same function as the primer in (a), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0039] In some embodiments of the present invention, the kit also includes any one of kits for sequencing, detecting restriction fragment polymorphism, flight mass spectrometry detection, fluorescent probe detection, and gene chip detection.

[0040] In some embodiments of the present invention, the kit further comprises primers for detecting the molecular marker ALPK1rs35389530.

[0041] In some embodiments of the invention, the primer comprises any one of (c) or (d):

[0042] (c) a primer consisting of the single-stranded DNA shown in SEQ ID NO:3 and the single-stranded DNA shown in SEQ ID NO:4;

[0043] (d) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:3 and SEQ ID NO:4, and having the same function as the primer in (c), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0044] In some embodiments of the present invention, the method for predicting the efficacy of interferon α in treating hepatitis B patients using the kit comprises the following steps:

[0045] Extracting DNA from the sample to be tested of the hepatitis B patient; using the DNA as a template and adopting the kit to perform PCR amplification to obtain an amplified product; detecting the amplified product to determine the genotype of the hepatitis B patient.

[0046] In some embodiments of the present invention, the sample to be tested includes a sample selected from cells, tissues, urine, blood, serum or plasma.

[0047] In some embodiments of the present invention, the detection includes electrophoresis detection and sequencing detection.

[0048] The electrophoresis detection is used to determine whether the amplified product is the target fragment and confirm its purity.

[0049] The sequencing test is used to determine the genotype of the amplified product through the sequencing peak diagram of the amplified product, and further determine the genotype carried by the hepatitis B patient.

[0050] Genotyping can be used to determine the therapeutic efficacy of interferon α for patients with hepatitis B. If the genotype of BST2 rs9576 is GG, the therapeutic efficacy of interferon α is good; if the genotype of BST2 rs9576 is GT / TT, the therapeutic efficacy of interferon α is poor.

[0051] According to a fourth aspect of the present invention, a method for preparing a product for predicting the therapeutic efficacy of interferon α on hepatitis B patients is provided. The molecular marker is BST2 rs9576.

[0052] In some embodiments of the present invention, the reagent is a primer for detecting the molecular marker BST2 rs9576.

[0053] In some embodiments of the invention, the primer comprises any one of (a) or (b):

[0054] (a) a primer consisting of the single-stranded DNA shown in SEQ ID NO: 1 and the single-stranded DNA shown in SEQ ID NO: 2;

[0055] (b) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:1 and SEQ ID NO:2, and having the same function as the primer in (a), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0056] In some embodiments of the present invention, the molecular markers further include at least one of ALPK1 rs35389530, HLA-DPA1rs3077, PAK4 rs9676717, CYP27B1 rs4646536, and IFNAR1 rs2850015.

[0057] The primers and corresponding products provided by the present invention can specifically and efficiently detect polymorphic sites of molecular markers. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0059] Figure 1 This is a flow chart of screening the SNP sites of the BST2 gene in Example 1 of the present invention;

[0060] Figure 2 The figure is a gel electrophoresis result of the PCR amplification product in Example 2 of the present invention; wherein, lane 1: DNA marker III; P1, P2, and P3 represent the serial numbers of three patients respectively; the numbers in the left column represent the molecular weight of the bands;

[0061] Figure 3 The sequencing peak diagram of the PCR amplification product in Example 2 of the present invention; wherein, (a): amplification product of patient P1, (b): amplification product of patient P2, (c): amplification product of patient P3; the shaded bases are the sites to be tested (SNP sites);

[0062] Figure 4 This is a graph showing the results of the phenotypic and genotypic association analysis of the peginterferon α treatment response in CHB patients in Example 3 of the present invention. DETAILED DESCRIPTION

[0063] Embodiments of the present invention are described in detail below. The embodiments described with reference to the accompanying drawings are exemplary and are only used to explain the present invention, but should not be construed as limiting the present invention.

[0064] In the description of the present invention, unless otherwise clearly defined, words such as detection and prediction should be understood in a broad sense, and technicians in the relevant technical field can reasonably determine the specific meanings of the above words in the present invention in combination with the specific content of the technical solution.

[0065] In the description of the present invention, reference to the terms "one embodiment", "some embodiments", etc. means that the specific features, materials or characteristics described in conjunction with the embodiment are included in at least one embodiment of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment. Moreover, the specific features, materials or characteristics described can be combined in any suitable manner in one or more embodiments.

[0066] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials and reagents used, unless otherwise specified, are all reagents and materials available from commercial sources.

[0067] Example 1

[0068] This example screened the SNP sites of the BST2 gene, a molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients. The specific process was as follows:

[0069] (1) Screening for potential functional SNP sites related to BST2 expression in the BST2 gene: See the screening process for details. Figure 1 Specifically, 1) 471 SNP sites were found in the BST2 gene of East Asian subjects in the 1000 Genomes Project. According to the screening criteria (minor allele frequency MAF>0.05, missing rate <0.05, Hardy-Weinberg equilibrium P value <0.001), 82 SNP sites that met the criteria were screened out; 2) Through the expression analysis of quantitative trait loci (eQTL) in liver tissue of the GTEx database, 59 SNP sites with P < 0.01 were retained; 3) SNP sites located in functional regions (missense mutations or UTR regions) were screened from the SNP sites in 2), and 2 SNP sites, rs9576 and rs13485, were screened out; 4) Through LD analysis, using the RegulomeDB database, it was found that rs9576 was more likely to be a functional site, so rs9576 was selected for the next step of research.

[0070] (2) Evaluation of the correlation between BST2 rs9576 and treatment response: The correlation between BST2 rs9576 and treatment response was evaluated in two groups of HBeAg-positive chronic hepatitis B (CHB) patients who received peginterferon α for at least 48 weeks and were followed up for 24 weeks (cohort 1, 238 people, i.e., n=238; cohort 2, 707 people, i.e., n=707). The inclusion and exclusion criteria of the two groups of patients were similar, including age 18-65 years, HBsAg positivity for at least 6 months, HBeAg positivity, HBV DNA>10 5The patients were divided into two groups: the control group and the control group. The control group was ...

[0071] Table 1

[0072]

[0073]

[0074] Note: * represents the baseline value;

[0075] ** The chi-square test or Fisher's exact test was used for comparison of binary variables, and the t test was used to calculate P values ​​for comparison of continuous variables.

[0076] At week 72, the association between BST2 rs9576 genotype (including GG, GT, and TT genotypes) and the combined response of the two cohort treatment groups was analyzed by multivariate logistic regression. The results are shown in Table 2.

[0077] Table 2

[0078]

[0079]

[0080] Note: * represents the baseline value;

[0081] ** The ORs and P values ​​were calculated by multivariate logistic regression analysis, including variables with P values ​​less than 0.2 in univariate logistic regression analysis.

[0082] The results in Table 2 show that BST2 rs9576 was significantly associated with the combined response rate of the two peginterferon α treatment cohorts (cohort 1: P = 0.005, OR = 2.49; cohort 2: P = 0.001, OR = 1.99). That is, the CR rate of patients carrying allele G was higher than that of patients carrying allele T. Therefore, it can be determined that the molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients is BST2 rs9576, whose nucleic acid sequence is shown in SEQ ID NO:5: 5'-CCCATAACAACAGGCAGCACATGCCCCCCACACCGCACCCCATGCCCAATCTCAGGGTGGGAGACAAGAGGGGGGACTCATTGTCCGGAGGGAGGCTCTGGAGGGAGACAGCCCTGGGTCAACCCGACTGTGTCCCCACACCCAGGACTTCCCCATGGCCCCTCCAGACCTGCTCCAGAGGCCCTTCTCCGGCTACCCCGTGCTCTCCCCGCTAACCGTGTTGCCCCATGA-3', the SNP site is located at position 150, and the polymorphism is G / T.

[0083] Example 2

[0084] This embodiment uses a kit for predicting the therapeutic efficacy of interferon α on hepatitis B patients to predict the efficacy of pegylated interferon α in treating chronic hepatitis B subjects. The specific process is as follows:

[0085] This embodiment proposes a kit, comprising primers for detecting the molecular marker BST2 rs9576: the nucleic acid sequence of the upstream primer is shown in SEQ ID NO: 1: CCCATAACAACAGGCAGCAC, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO: 2: TCATGGGGCAACACGGTTAG; the above primer set is synthesized by BGI; the kit also includes PCR reaction reagents: DNA polymerase (LA-Taq, purchased from TAKARA), buffer (10×LA Buffer, purchased from TAKARA), and substrate (dNTPs, purchased from TAKARA).

[0086] Prediction Method:

[0087] (1) DNA was extracted from whole blood of subjects with chronic hepatitis B treated with pegylated interferon α (using QIAamp Blood MiniKit 250 kit for extraction) and stored at -20°C for future use;

[0088] (2) Using the DNA in (1) as a template, PCR amplification was performed using the above-mentioned kit for predicting the therapeutic efficacy of interferon α on hepatitis B patients. The PCR reaction system is shown in Table 3;

[0089] Table 3

[0090] Reagents Volume (μL) water 12.4 10×LA Buffer 2 dNTPs (2.5 mM) 3 LA-Taq 0.2 rs9576 upstream primer (20pM) 0.2 rs9576 downstream primer (20pM) 0.2 DNA (50 ng / μL) was added to each sample. 2 Final volume 20

[0091] Add the reagents in the order of Table 3 to the PCR tube, mix well, put the PCR tube into the PCR instrument, and set the reaction program as shown in Table 4;

[0092] Table 4

[0093]

[0094] Start the PCR instrument to perform PCR reaction;

[0095] (3) Detection of amplified products: Prepare a 1.5% agarose gel and add the amplified products to the agarose gel for electrophoresis to detect whether it is the target fragment (i.e., BST2) and confirm its purity. The electrophoresis diagram of the PCR amplified products is as follows: Figure 2 As shown, lane 1: DNA marker III (Tiangen Biochemical Technology Co., Ltd.), lanes 2, 3, and 4 are the bands of amplified products obtained after specific amplification of whole blood DNA of patients numbered P1, P2, and P3, respectively. The results show that the band positions of the amplified products of the three DNA samples are approximately between 200 and 500 bp, which is consistent with the prediction that the target fragment is 231 bp. The bands of the amplified products are clear and single, and no non-specific bands are seen. In addition, the amplification efficiency of this method is high, and the results are reliable.

[0096] (4) Purification and sequencing of PCR products: After the PCR amplification products are recovered and purified, they are sent to Beijing Liuhe BGI Gene Technology Co., Ltd. for sequencing. The sequencing results returned by the company are the base sequence diagrams of the amplification products, such as Figure 3 As shown; and the obtained sequence was compared with the standard sequence of the BST2 normal genome (NCBI Accession number) using MEGA-11 software to determine whether BST2 contains rs9576 heterozygous or homozygous mutation. Figure 3 (a), (b), and (c) correspond to Figure 2 From the sequencing peak diagram of the amplified products of the whole blood DNA of patients P1, P2, and P3, it can be seen that the amplified product of patient P1 is T homozygous, the amplified product of patient P2 has a heterozygous mutation of T→G, and the amplified product of patient P3 is G homozygous.

[0097] Therefore, the kit of the present invention can be used to specifically and efficiently detect the polymorphic site of BST2 rs9576.

[0098] Example 3

[0099] This example analyzes the phenotype of the peginterferon α treatment response and the rs9576 genotype of CHB patients, and the specific process is as follows:

[0100] The phenotype and genotype of the response to peginterferon α in 945 CHB patients were analyzed for association, of which 368 had the GG genotype and 513 had the GT / TT genotype. Figure 4 As shown in two independent cohorts, the combined response rate (CR) of patients with rs9576 GG genotype was significantly higher than that of patients with rs9576 GT / TT genotype (cohort 1: 35.6% vs. 17.9%, P = 2.526 × 10 -3 Cohort 2: 25.6% vs. 15.0%, P = 7.111 × 10 -4 When the two cohorts were combined, the CR rate of patients with rs9576 GG genotype was 28.0%, while that of patients with rs9576 GT / TT genotype was only 15.8% (P = 1.116 × 10 -5 ). That is, the accuracy of predicting the response of CHB patients to antiviral treatment with pegylated interferon α is 60.7% (368 people with GG genotype, 28.0% of whom responded to treatment (calculated as 103.04 people); 513 people with GT / TT genotype, 15.8% of whom responded to treatment (calculated as 81.054 people), and 431.946 people did not respond to treatment, so the accuracy = (103.04 + 431.946) / (368 + 513) = 60.7%).

[0101] Therefore, rs9576 genotyping before patients are treated with pegylated interferon α can be used to predict the therapeutic effect of pegylated interferon α on CHB patients, so as to achieve personalized precision treatment.

[0102] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a reagent for detecting molecular markers in the preparation of a product for predicting the therapeutic efficacy of interferon α on hepatitis B patients, characterized in that: The molecular marker is BST2 rs9576, and the reagent is a primer for detecting the molecular marker BST2rs9576, wherein the primer comprises a primer composed of a single-stranded DNA shown in SEQ ID NO: 1 and a single-stranded DNA shown in SEQ ID NO: 2; If the genotype of BST2 rs9576 is GG, the treatment with interferon α is effective; if the genotype of BST2 rs9576 is GT / TT, the treatment with interferon α is less effective.

Images