Molecular markers for predicting the therapeutic efficacy of interferon α in patients with hepatitis B and their application

Abstract

The present invention belongs to the field of biomedicine, and discloses molecular markers and their applications for predicting the therapeutic efficacy of interferon α on hepatitis B patients. Including: 1. A molecular marker combination for predicting the therapeutic efficacy of interferon α on hepatitis B patients, including ALPK1rs35389530, and at least one other molecular marker. 2. Reagents and / or kits for detecting the above molecular marker combination, including reagents for detecting ALPK1rs35389530. 3. A kit, including primers for detecting the molecular marker ALPK1rs35389530. 4. The use of reagents for detecting molecular markers in the preparation of products for predicting the therapeutic efficacy of interferon α on hepatitis B patients, the reagents being primers for detecting ALPK1rs35389530. The primers and products of the present invention can specifically and efficiently detect the polymorphic sites of molecular markers to achieve pre-treatment prediction.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to molecular markers for predicting the therapeutic efficacy of interferon alpha on hepatitis B patients and applications thereof. Background Art

[0002] Chronic hepatitis B (CHB) is a global public health threat, with an estimated 292 million people infected worldwide. Currently, hepatitis B virus (HBV) infection is considered to be the main risk factor for chronic hepatitis B and liver cancer.

[0003] Currently, the first-line clinical drugs for anti-HBV include pegylated interferon alpha (PegIFNα) and nucleoside analogues (NUCs). PegIFNα has a wide range of antibacterial activity and is also the most important cytokine for antiviral infection. Although PegIFNα has obvious adverse reactions, its many advantages have also made it always active in the first-line clinical treatment plan: the once-weekly dosing regimen improves patient compliance and tolerance, and has the dual effects of regulating immunity and antiviral, allowing patients to obtain long-term responses during treatment; it can be used as an important part of some new combination drug regimens; and it plays a more important role than NUCs in preventing CHB patients from progressing to liver cancer. However, currently PegIFNα treatment only responds in a small number of patients (about 30%), and the treatment price is relatively expensive. If we can screen out these patients who respond to PegIFNα treatment, we can continue to treat them in the same way; while for patients who do not respond or respond poorly, we will adjust the treatment plan and carry out precise treatment to reduce the high cost of treatment but poor treatment effect. Therefore, it is particularly important to screen patients' response to PegIFNα treatment before treatment. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a molecular marker combination for predicting the therapeutic efficacy of interferon (IFN) α on hepatitis B patients, which can evaluate the efficacy of antiviral treatment of hepatitis B patients with interferon α, so as to facilitate the selection of treatment methods and precise treatment.

[0005] The present invention also provides a reagent and / or a kit for detecting the molecular marker combination.

[0006] The invention also provides a kit for predicting the therapeutic effect of interferon alpha on hepatitis B patients.

[0007] The present invention also proposes the use of a reagent for detecting molecular markers in the preparation of a product for predicting the therapeutic efficacy of interferon α on hepatitis B patients.

[0008] According to one aspect of the present invention, a molecular marker combination for predicting the therapeutic efficacy of interferon α on hepatitis B patients is proposed, wherein the molecular marker combination includes ALPK1 rs35389530 and at least one other molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients.

[0009] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved:

[0010] The present invention can evaluate the efficacy of interferon α antiviral treatment of hepatitis B patients based on the genotyping results of detecting ALPK1 rs35389530 and at least one other molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients, thereby facilitating the selection of antiviral treatment plans and precise treatment of hepatitis B patients.

[0011] ALPK1 belongs to a newly discovered protein kinase family, and its gene sequence has no homology with conventional protein kinases. Based on the fact that the phosphorylation regions of these protein kinases are located in the α helix, this new family of protein kinases is called α kinase. Related studies have shown that ALPK1 plays a major regulatory role in inflammation and innate immunity against bacterial infection, which suggests that ALPK1 may have antiviral effects. The inventors found in previous studies that in cell experiments, the higher the expression of ALPK1, the better the response to interferon α treatment, suggesting that the ALPK1 gene may have single nucleotide polymorphisms (SNP, which refers to the polymorphism of DNA sequences caused by single nucleotide variations at the genomic level, and is a common type of heritable genomic variation in humans) sites related to the evaluation of the efficacy of interferon α treatment in patients with chronic hepatitis B. Based on this, the inventors screened out a potential functional SNP site from the ALPK1 gene: rs35389530.

[0012] In some embodiments of the present invention, the at least one other molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients includes BST2 rs9576; and / or the at least one other molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients includes at least one of STAT4 rs7574865 and CFB rs12614.

[0013] In some embodiments of the present invention, the hepatitis B patient is a chronic hepatitis B patient.

[0014] In some embodiments of the present invention, the hepatitis B patient includes a mild chronic hepatitis B patient, a moderate chronic hepatitis B patient or a severe chronic hepatitis B patient.

[0015] In some embodiments of the present invention, the interferon alpha comprises pegylated interferon alpha or a derivative thereof.

[0016] In some embodiments of the present invention, the pegylated interferon alpha includes any one of pegylated interferon alpha-2a and pegylated interferon alpha-2b.

[0017] In some embodiments of the present invention, the pegylated interferon alpha derivative includes any one of dextran pegylated interferon alpha, transferrin pegylated interferon alpha, carboxy pegylated interferon alpha, and glycine-pegylated interferon alpha.

[0018] In some embodiments of the present invention, the evaluation index of the therapeutic effect includes at least the level of hepatitis B antigen (HBsAg) in the hepatitis B patient.

[0019] In some embodiments of the present invention, the evaluation index of the therapeutic effect also includes the levels of hepatitis B e antigen (HBeAg), hepatitis B virus (HBV) DNA, and alanine aminotransferase (ALT) in the hepatitis B patient.

[0020] In some embodiments of the present invention, after treatment with interferon α, the HBsAg of the hepatitis B patient is cleared or converted (accompanied by the production of anti-HBsAg antibodies), and HBeAg seroconversion occurs (accompanied by the production of anti-HBeAg antibodies), the HBVDNA level is <2000 IU / mL, and ALT is <the lower limit of normal value, which means that interferon α is effective in treating hepatitis B patients.

[0021] According to a second aspect of the present invention, a reagent and / or a kit for detecting the molecular marker combination is provided, including a reagent for detecting the molecular marker ALPK1 rs35389530.

[0022] In some embodiments of the present invention, the reagent further comprises a reagent for detecting at least one of the molecular markers BST2 rs9576, STAT4rs7574865, and CFB rs12614.

[0023] In some embodiments of the present invention, the reagent is a primer for detecting the molecular marker ALPK1 rs35389530.

[0024] In some embodiments of the invention, the primer comprises any one of (a) or (b):

[0025] (a) a primer consisting of the single-stranded DNA shown in SEQ ID NO: 1 and the single-stranded DNA shown in SEQ ID NO: 2;

[0026] (b) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:1 and SEQ ID NO:2, and having the same function as the primer in (a), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0027] In some embodiments of the present invention, SEQ ID NO: 1 is 5'-ACGTTGACGACAGGTCAGC-3', and SEQ ID NO: 2 is 5'-CCTGGGGTATTATGAGGCGAG-3'.

[0028] In some embodiments of the present invention, the reagents further include any one of sequencing reagents, restriction fragment length polymorphism detection reagents, flight mass spectrometry detection reagents, fluorescent probe detection reagents, and gene chip detection reagents.

[0029] In some embodiments of the present invention, the reagent also includes a primer for detecting the molecular marker BST2 rs9576.

[0030] In some embodiments of the invention, the primer comprises any one of (c) or (d):

[0031] (c) a primer consisting of the single-stranded DNA shown in SEQ ID NO:3 and the single-stranded DNA shown in SEQ ID NO:4;

[0032] (d) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:3 and SEQ ID NO:4, and having the same function as the primer in (c), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0033] In some embodiments of the present invention, SEQ ID NO: 3 is 5'-CCCATAACAACAGGCAGCAC-3', and SEQ ID NO: 4 is 5'-TCATGGGGCAACACGGTTAG-3'.

[0034] In some embodiments of the present invention, the primers are used to detect mutations of the molecular markers.

[0035] In some preferred embodiments of the present invention, the primers are used to detect point mutations of the molecular markers.

[0036] According to a third aspect of the present invention, a kit for predicting the therapeutic efficacy of interferon α on hepatitis B patients is provided, comprising primers for detecting the molecular marker ALPK1 rs35389530; the primers include any one of (a) or (b):

[0037] (a) a primer consisting of the single-stranded DNA shown in SEQ ID NO: 1 and the single-stranded DNA shown in SEQ ID NO: 2;

[0038] (b) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:1 and SEQ ID NO:2, and having the same function as the primer in (a), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0039] In some embodiments of the present invention, the kit also includes any one of kits for sequencing, detecting restriction fragment polymorphism, flight mass spectrometry detection, fluorescent probe detection, and gene chip detection.

[0040] In some embodiments of the present invention, the kit further comprises primers for detecting the molecular marker BST2 rs9576.

[0041] In some embodiments of the invention, the primer comprises any one of (c) or (d):

[0042] (c) a primer consisting of the single-stranded DNA shown in SEQ ID NO: 3 and the single-stranded DNA shown in SEQ ID NO: 4;

[0043] (d) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:3 and SEQ ID NO:4, and having the same function as the primer in (c), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0044] In some embodiments of the present invention, the method for predicting the efficacy of interferon α in treating hepatitis B patients using the kit comprises the following steps:

[0045] Extracting DNA from the sample to be tested of the hepatitis B patient; using the DNA as a template and adopting the kit to perform PCR amplification to obtain an amplified product; detecting the amplified product to determine the genotype of the hepatitis B patient.

[0046] In some embodiments of the present invention, the sample to be tested includes a sample selected from cells, tissues, urine, blood, serum or plasma.

[0047] In some embodiments of the present invention, the detection includes electrophoresis detection and sequencing detection.

[0048] The electrophoresis detection is used to determine whether the amplified product is the target fragment and confirm its purity.

[0049] The sequencing test is used to determine the genotype of the amplified product through the sequencing peak diagram of the amplified product, and further determine the genotype carried by the hepatitis B patient.

[0050] Genotyping can be used to determine the therapeutic efficacy of interferon α for patients with hepatitis B. If the genotype of ALPK1rs35389530 is CT, the therapeutic efficacy of interferon α is good; if the genotype of ALPK1rs35389530 is CC, the therapeutic efficacy of interferon α is poor.

[0051] According to a fourth aspect of the present invention, a method for preparing a product for predicting the therapeutic efficacy of interferon α on hepatitis B patients is provided. The molecular marker is ALPK1 rs35389530.

[0052] In some embodiments of the present invention, the reagent is a primer for detecting the molecular marker ALPK1 rs35389530.

[0053] In some embodiments of the invention, the primer comprises any one of (a) or (b):

[0054] (a) a primer consisting of the single-stranded DNA shown in SEQ ID NO: 1 and the single-stranded DNA shown in SEQ ID NO: 2;

[0055] (b) A primer consisting of two single-stranded DNA molecules represented by the sequences obtained by substituting and / or deleting and / or adding one or more nucleotides in SEQ ID NO:1 and SEQ ID NO:2, and having the same function as the primer in (a), wherein the substitution and / or deletion and / or addition of one or more nucleotides does not affect the detection of the molecular marker.

[0056] In some embodiments of the present invention, the molecular markers further include at least one of BST2 rs9576, STAT4rs7574865, and CFB rs12614.

[0057] The primers and corresponding products provided by the present invention can specifically and efficiently detect polymorphic sites of molecular markers. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0059] Figure 1 This is a flow chart of screening SNP sites of the ALPK1 gene in Example 1 of the present invention; wherein N represents the number of SNP sites screened;

[0060] Figure 2 The figure is a gel electrophoresis result of the PCR amplification product in Example 2 of the present invention; wherein, lane 1: DNA marker III; P1, P2, P3, P4 and P5 represent the serial numbers of 5 patients respectively; the numbers in the left column represent the molecular weight of the bands;

[0061] Figure 3 The sequencing peak diagram of the PCR amplification products in Example 2 of the present invention; wherein, (a): amplification product of patient P1, (b): amplification product of patient P2, (c): amplification product of patient P3, (d): amplification product of patient P4, (e): amplification product of patient P5; the shaded bases are the sites to be tested (SNP sites);

[0062] Figure 4 This is a graph showing the results of the phenotypic and genotypic association analysis of the peginterferon α treatment response in CHB patients in Example 3 of the present invention. DETAILED DESCRIPTION

[0063] Embodiments of the present invention are described in detail below. The embodiments described with reference to the accompanying drawings are exemplary and are only used to explain the present invention, but should not be construed as limiting the present invention.

[0064] In the description of the present invention, unless otherwise clearly defined, words such as detection and prediction should be understood in a broad sense, and technicians in the relevant technical field can reasonably determine the specific meanings of the above words in the present invention in combination with the specific content of the technical solution.

[0065] In the description of the present invention, reference to the terms "one embodiment", "some embodiments", etc. means that the specific features, materials or characteristics described in conjunction with the embodiment are included in at least one embodiment of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment. Moreover, the specific features, materials or characteristics described can be combined in any suitable manner in one or more embodiments.

[0066] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials and reagents used, unless otherwise specified, are all reagents and materials available from commercial sources.

[0067] Example 1

[0068] This example screened the SNP sites of the ALPK1 gene, a molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients. The specific process was as follows:

[0069] (1) Screening for potential functional SNP sites in the ALPK1 gene: Whole-genome SNP mining was performed based on the 1000 Genomes Project data to screen for potential functional SNP sites in the ALPK1 sequence. The screening criteria and process are shown in Figure 1 Specifically, the following methods were used: 1) 63,013 SNP sites in ALPK1 were screened; 2) 105 SNP sites with potential functions were screened from the 63,013 sites in 1), including missense, nonsense, frameshift, splice donor and splice acceptor variants; 3) only common genetic variants were retained from the 105 sites in 2), and 8 SNP sites were screened from sites with minor allele frequency (MAF) > 0.01 in Asian populations; 4) only independent genetic variants (linkage disequilibrium, r) were retained from the 8 sites in 3). 2 <0.5), 3 in total, rs35389530, rs2074388 and rs2074380.

[0070] (2) Evaluation of the correlation between ALPK1 rs35389530 and treatment response: The correlation between three candidate SNPs (rs35389530, rs2074388, and rs2074380) and treatment response was evaluated in two groups of HBeAg-positive chronic hepatitis B (CHB) patients who received peginterferon α for at least 48 weeks and were followed up for 24 weeks (cohort 1, 238 people, i.e., n=238; cohort 2, 707 people, i.e., n=707). The inclusion and exclusion criteria of the two groups of patients were similar, including age 18-65 years, HBsAg positivity for at least 6 months, HBeAg positivity, HBV DNA>10 5The patients were divided into two groups: the first group was 55, the second group was 76, and the third group was 18. The patients were divided into two groups: the first group was 55, the second group was 156, and the third group was 17. The patients were divided into two groups: the first group was 76, the second group was 18, and the third group was 17. The patients were divided into two groups: the first group was 76, the second group was 18, and the third group was 17. The patients were divided into two groups: the first group was 76, the second group was 18, and the third group was 17. The patients were divided into two groups: the first group was 76, the second group was 18, and the third group was 17.

[0071] Table 1

[0072]

[0073]

[0074] Note: * represents baseline value.

[0075] The analysis showed (see Table 2) that at week 72, rs35389530 was the only SNP significantly associated with HBeAg seroconversion, HBV DNA level <2000 IU / mL, and CR in both cohorts.

[0076] Table 2

[0077]

[0078]

[0079] Note: * represents the P value of the allele model calculated by the chi-square test.

[0080] Therefore, at week 72, the association between ALPK1 rs35389530 genotype (including CC and CT genotypes) and the combined response of the two cohort treatment groups was analyzed by multivariate logistic regression. The results are shown in Table 3.

[0081] Table 3

[0082]

[0083]

[0084] Note: * represents the baseline value;

[0085] **The ORs and P values ​​were calculated by multivariate logistic regression analysis, including variables with P values ​​less than 0.2 in univariate logistic regression analysis.

[0086] The results in Table 3 show that ALPK1 rs35389530 was significantly associated with the combined response rate of the two peginterferon α treatment cohorts (cohort 1: P = 0.001, OR = 7.20; cohort 2: P = 0.001, OR = 3.39). That is, the CR rate of patients carrying allele T was higher than that of patients carrying allele C. Therefore, it can be determined that the molecular marker for predicting the therapeutic efficacy of interferon α on hepatitis B patients is ALPK1 rs35389530, whose nucleic acid sequence is shown in SEQ ID NO: 5: 5'-ACGTTGACGACAGGTCAGCCAGAAAAGAGCCTGGCAAAGAACATCTGGTGGACACTCAGTGTTCCACTGCCTTGTCTGAGGAGCTAGAGAATGACAGGGAAGGCAGAGCTATGCATTCATTGCATTCACAGCTTCATGATCTCTCTCTTCAGGAACCCAACAATGACAATTTGGAGCCTTCTCAAAATCAGCCACAGCAACAGATGCCCTTGACACCCTTCTCGCCTCATAATACCCCAGG-3', the SNP site is located at position 178, and the polymorphism is C / T.

[0087] Example 2

[0088] This embodiment uses a kit for predicting the therapeutic efficacy of interferon α on hepatitis B patients to predict the efficacy of pegylated interferon α in treating chronic hepatitis B subjects. The specific process is as follows:

[0089] This embodiment proposes a kit, comprising a primer pair for detecting the molecular marker ALPK1 rs35389530: the nucleic acid sequence of the upstream primer is shown in SEQ ID NO: 1: ACGTTGACGACAGGTCAGC; the nucleic acid sequence of the downstream primer is shown in SEQ ID NO: 2: CCTGGGGTATTATGAGGCGAG, and the above primer pair is synthesized by BGI; the kit also includes PCR reaction reagents: DNA polymerase (LA-Taq, purchased from TAKARA), buffer (10×LA Buffer, purchased from TAKARA), and substrate (dNTPs, purchased from TAKARA).

[0090] Prediction Method:

[0091] (1) DNA was extracted from whole blood of subjects with chronic hepatitis B treated with pegylated interferon α (using QIAamp Blood MiniKit 250 kit for extraction) and stored at -20°C for future use;

[0092] (2) Using the DNA in (1) as a template, PCR amplification was performed using the above-mentioned kit for predicting the therapeutic efficacy of interferon α on hepatitis B patients. The PCR reaction system is shown in Table 4;

[0093] Table 4

[0094] Reagents Volume (μL) water 12.4 10×LA Buffer 2 dNTPs (2.5 mM) 3 LA-Taq 0.2 rs35389530 upstream primer (20pM) 0.2 rs35389530 downstream primer (20pM) 0.2 DNA (50 ng / μL) was added to each sample. 2 Final volume 20

[0095] Add the reagents in the order of Table 4 to the PCR tube, mix well, put the PCR tube into the PCR instrument, and set the reaction program as shown in Table 5;

[0096] Table 5

[0097]

[0098]

[0099] Start the PCR instrument to perform PCR reaction;

[0100] (3) Detection of amplified products: Prepare a 1.5% agarose gel and add the amplified products to the agarose gel for electrophoresis to detect whether it is the target fragment (i.e., ALPK1) and confirm its purity. The electrophoresis diagram of the PCR amplified product is shown in Figure 2 As shown, lane 1: DNA marker Ⅲ (Tiangen Biochemical Technology Co., Ltd.), lanes 2, 3, 4, 5, and 6 are the bands of amplified products obtained after specific amplification of whole blood DNA of patients numbered P1, P2, P3, P4, and P5, respectively. The results show that the band positions of the amplified products of the five DNA samples are approximately between 200 and 500 bp, which is consistent with the prediction that the target fragment is 241 bp. The bands of the amplified products are clear and single, and no non-specific bands are observed. In addition, the amplification efficiency of this method is high, and the results are reliable.

[0101] (4) Purification and sequencing of PCR products: After the PCR amplification products are recovered and purified, they are sent to Beijing Liuhe BGI Gene Technology Co., Ltd. for sequencing. The sequencing results returned by the company are the base sequence diagrams of the amplification products, such as Figure 3 As shown; and the obtained sequence was compared with the standard sequence of the ALPK1 normal genome (NCBI Accession number) using MEGA-11 software to determine whether ALPK1 contains rs35389530 heterozygous or homozygous mutation. Figure 3(a), (b), (c), (d), and (e) correspond to Figure 2 From the sequencing peak diagram of the amplified products of whole blood DNA of patients P1, P2, P3, P4, and P5, it can be seen that the amplified product of patient P1 underwent a heterozygous mutation of C→T, and the amplified products of patients P2, P3, P4, and P5 were homozygous for C.

[0102] Therefore, the kit of the present invention can be used to specifically and efficiently detect the polymorphic site of ALPK1 rs35389530.

[0103] Example 3

[0104] This example analyzes the phenotype of peginterferon α treatment response and rs35389530 genotype in CHB patients, and the specific process is as follows:

[0105] The phenotype and genotype of the response to peginterferon α in 945 CHB patients were analyzed, of which 885 had CC genotype and 57 had CT genotype. Figure 4 As shown in the figure, at the 24th week of treatment, the combined response rate (CR rate) of patients with rs35389530CT genotype and patients with CC genotype was basically the same (P = 1.000); at the 48th week of treatment, the CR rate of patients with rs35389530CT genotype was 30.9%, while the CR rate of patients with rs35389530CC genotype was only 14.6% (P = 0.001), showing a significant difference; at the 72nd week of treatment, the CR rate of patients with rs35389530CT genotype was 46.3%, while the CR rate of patients with rs35389530CC genotype was only 19.2% (P = 2.12 × 10 -6 ), the difference was significant. That is, the accuracy of predicting the response of CHB patients to antiviral treatment with pegylated interferon α was 78.7% (at week 72, there were 57 people with CT genotype, of which 46.3% showed treatment response (calculated as 26.391 people); there were 885 people with CC genotype, of which 19.2% showed treatment response (calculated as 169.92 people), and there were 715.08 people who did not show treatment response, so the accuracy rate = (26.391 + 715.08) / (57 + 885) = 78.7%).

[0106] Therefore, rs35389530 genotyping before patients are treated with pegylated interferon α can be used to predict the therapeutic effect of pegylated interferon α on CHB patients, so as to achieve personalized precision treatment.

[0107] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a reagent for detecting molecular markers in the preparation of a product for predicting the therapeutic efficacy of interferon α on hepatitis B patients, characterized in that: The molecular marker is ALPK1 rs35389530; the reagent is a primer for detecting the molecular marker ALPK1 rs35389530; The primers for detecting the molecular marker ALPK1 rs35389530 consist of the single-stranded DNA shown in SEQ ID NO: 1 and the single-stranded DNA shown in SEQ ID NO: 2; If the genotype of ALPK1 rs35389530 is CT, the treatment with interferon α is effective; if the genotype of ALPK1 rs35389530 is CC, the treatment with interferon α is less effective.

Images