A digital PCR detection reagent for DMD gene detection
By designing digital PCR detection reagents for DMD gene detection, the problems of high cost, long periods and high false negative rates of existing detection methods are solved, and multiple quantitative detection of all 79 exons of the DMD gene are achieved, reducing the detection cost and cycle, and improving the accuracy and sensitivity of the detection.
Patent Information
- Application Number
- CN202211494375.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-25
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2042-11-25
AI Technical Summary
The existing DMD gene detection methods have problems with high cost, long cycles and high false negative rates, and cannot effectively screen risk groups, and cannot achieve comprehensive detection of 79 exons of the DMD gene.
A digital PCR detection reagent for DMD gene detection was designed. By rationally designing primers and probes, the specificity, precision and sensitivity of ultra-multiplex digital PCR technology is improved, and multiple quantitative detection of all 79 exons of the DMD gene is achieved.
Absolute quantitative detection of DMD genes is realized, which reduces detection costs and cycles, improves detection accuracy and sensitivity, and can be used for multi-stage detection with different detection requirements.
Smart Images

Figure CN115976191B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene detection, and in particular, to a digital PCR detection reagent for DMD gene detection. Background Art
[0002] Duchenne muscular dystrophy (DMD), also known as Duchenne muscular dystrophy (OMIM 310200), is the most common type of progressive muscular dystrophy and is inherited in an X-linked recessive manner. This disease mainly affects boys, and most women do not get sick. They may be carriers of the disease-causing gene. A small number of affected women may be related to X chromosome inactivation. Existing DMD detection methods mainly include serological detection and gene detection. Compared with serological detection, gene detection can effectively evaluate the genetic disease risk, but there are also disadvantages such as high cost and long cycle, which restrict the application possibility of screening high-risk populations.
[0003] Chinese Patent CN110527720A discloses an amplification system and its kit for detecting copy number variations of DMD gene exons. It only performs PCR detection on 8 exons of the DMD gene. This qPCR method based on screening partial exon regions for detection has a relatively high probability of false negative detection results. Considering that missed detection may lead to serious clinical consequences, other methods are still needed to perform secondary discrimination on negative results, and its practical application value is limited, and it cannot give full play to the low-cost advantage of the methodology.
[0004] The detection method based on ultra-multiplex digital PCR detects all 79 exons of the DMD gene, which can avoid missed detection as much as possible, and at the same time takes into account the cost and cycle advantages of PCR technology, and has significant clinical application prospects. Although there are currently PCR technologies for detecting all 79 exons of the DMD gene (such as Chinese Patents CN112410410A, CN108220418A, CN109554443A, CN113652474A), the detection method based on the MLPA technology cannot perform quantification, and precise control of DNA concentration is required to obtain reliable results. The detection method based on ultra-multiplex digital PCR can achieve absolute quantification, and the specific gene mutation abundance can be obtained only by comparing the copy numbers of target fragments and internal reference fragments in the sample.
[0005] The detection method based on the MLPA technology also has certain requirements for the sample volume and cannot be used for the detection of fetal free DNA in the peripheral blood of pregnant women before childbirth. The detection method based on ultra-multiplex digital PCR has ultra-high sensitivity and can meet the different detection requirements at multiple stages, such as pre-pregnancy screening for DMD gene defects in would-be parents, non-invasive detection of DMD gene defects in prenatal infants, and detection of DMD gene defects in newborns, with the same detection method.
[0006] The detection method based on NGS technology has a high cost and a long cycle. It often takes dozens of working days to give the detection results, and the cost is generally at the level of thousands of yuan. The detection method based on ultra-multiplex digital PCR can generally complete the entire detection process and give the detection results within 1 day, with a lower cost. After large-scale application, the cost is more likely to be even lower.
[0007] The ultra-multiplex digital PCR technology combines the ability of ultra-multiplex PCR technology to simultaneously detect multiple gene regions and the precise quantification ability of digital PCR. When applied to the detection of DMD gene defects, it has the advantages of high accuracy and low cost. The principle of digital PCR is to divide the reaction system into as many tiny reaction units as possible, which can be in the form of droplets or micro-wells on a chip. Each reaction unit contains the enzymes, primers, probes and other components required for PCR, and the templates are randomly distributed in these reaction units. Most reaction units only contain a single template sequence. By the fluorescence signals given by the reaction units after amplification, the presence of different template sequences in the sample can be distinguished. Finally, the fluorescence signal conditions of all reaction units can be presented in the form of a two-dimensional scatter plot. Since the two-dimensional plane can theoretically accommodate and distinguish many types of reaction unit signals, it has the potential for multiplex detection (as shown in Figure 1 and Figure 2 ).
[0008] The above existing PCR systems can only qualitatively detect mutations and do not perform quantitative detection of mutations. More importantly, these existing technologies do not consider the specificity, precision and sensitivity of the PCR detection technology itself, while high specificity, precision and sensitivity are essential conditions for ultra-multiplex digital PCR detection. PCR technologies with low specificity, precision and sensitivity cannot accurately determine the types and quantities of mutations. Therefore, how to improve the specificity, precision and sensitivity of the ultra-multiplex digital PCR detection method is an urgent problem to be solved, and solving this problem is also crucial for giving full play to the quantitative detection advantages of the ultra-multiplex digital PCR detection method. Summary of the Invention
[0009] Based on the above research and analysis, this application aims to design primer pairs and probes for all 79 exons of the DMD gene, and use a reasonably designed primer mixture to improve the specificity, precision and sensitivity of the ultra-multiplex digital PCR technology.
[0010] The present invention provides the following technical solutions:
[0011] A digital PCR detection reagent for DMD gene detection, comprising exon primer sequences shown in SEQ ID NO:1 to SEQ ID NO:158.
[0012] Preferably, it further includes exon probe sequences shown in SEQ ID NO: 159 to SEQ ID NO: 237.
[0013] Preferably, it further includes reference primer sequences shown in SEQ ID NO: 238 to SEQ ID NO: 277 and reference probe sequences shown in SEQ ID NO: 278 to SEQ ID NO: 297.
[0014] A super-multiplex digital PCR detection method includes the following steps:
[0015] S1. Prepare a PCR reaction system; the PCR reaction system contains the primer and probe sequence mixture described in claim 3;
[0016] S2. Add the mixed PCR reaction system and droplet generation oil into a droplet generation chip, and place the droplet generation chip into a sample preparation instrument to generate droplets;
[0017] S3. After droplet generation is completed, transfer the droplets to a PCR plate and seal the film;
[0018] S4. Amplify the PCR plate on a PCR instrument;
[0019] S5. After the PCR amplification reaction is completed, place the PCR plate in a reader for droplet detection and result analysis;
[0020] Preferably, the system of the PCR reaction is as follows:
[0021]
[0022]
[0023] In the DMD primer mixture, 99 pairs of primers are added in equal amounts, and 99 probes show a gradient change according to the signal distribution concentration.
[0024] Preferably, the final added concentration of each primer is 200 nM; the signals are divided into 7 levels. The final concentration of the probe at level 1 is 20 nM, the final concentration of the probe at level 2 is 40 nM, the final concentration of the probe at level 3 is 60 nM, the final concentration of the probe at level 4 is 90 nM, the final concentration of the probe at level 5 is 120 nM, the final concentration of the probe at level 6 is 150 nM, and the final concentration of the probe at level 7 is 190 nM.
[0025] Preferably, the components of the PCR reaction solution include 50 mM Tris-HCl, 35 mM KCl, 3.5 mM MgCl2, 0.5 mM dNTP, 6 mM glycerol, 0.3 mM EDTA, 0.5 μg / μL BSA; the concentration of the DNA polymerase is 0.08 U / μL.
[0026] Preferably, the sample is human genomic DNA, such as genomic DNA extracted from white blood cells in the peripheral blood of a newborn.
[0027] Preferably, the PCR reaction conditions are as follows:
[0028]
[0029] Beneficial effects achieved by the present invention:
[0030] Based on the optimization of primer and probe design, the present invention optimizes the signal resolution ability of digital PCR. For 79 exons of DMD, based on the technology of ultra-multiplex PCR, one pair of primer-probe is designed for each exon to respectively perform copy number quantitative detection. At the same time, 20 pairs of primer-probes are designed for 20 different sites selected from the fragments on the X chromosome that do not contain the DMD gene for copy number quantitative detection as internal references. By judging whether the copy number quantitative result of each exon is consistent with 1 / 20 of the 20-fold quantitative result of the X chromosome, it can be obtained whether each exon of the DMD gene has defects such as deletion and duplication, and whether the abundance of this defect is 100% homozygous pathogenic or 50% heterozygous carrier. The multiplex quantification of all exons of DMD is realized. Brief Description of the Drawings
[0031] Figure 1 It is the signal verification result of the DMD exon regions No. 1-38 and 10 control regions of the sequence in Example 1.
[0032] Figure 2 It is the signal verification result of the DMD exon regions No. 39-79 and 10 control regions of the sequence in Example 1.
[0033] Figure 3 It is the verification result diagram of exons No. 1-38 of 10 negative clinical samples.
[0034] Figure 4 It is the verification result diagram of exons No. 39-79 of negative clinical samples.
[0035] Figure 5 It is the verification result diagram of exons No. 1-38 of positive clinical samples.
[0036] Figure 6 It is the verification result diagram of exons No. 39-79 of positive clinical samples.
[0037] Among them, CY5, CY3, FAM, and ROX all represent the types of fluorescent labels, and both the horizontal and vertical coordinates are the numerical values of fluorescence intensity. Detailed Description of the Invention
[0038] The following is a detailed description of the specific embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present application without creative efforts shall fall within the scope of protection of the present application.
[0039] Example 1: Design of primer and probe sequences:
[0040] One set of primers and probes was designed for each of the 79 exons of DMD (i.e., DMD exon 1-79), and at the same time, 20 sites were evenly selected in the non-DMD region of the X chromosome as internal references (Chromosome X1-X20), as shown in Table 1.
[0041] Table 1 Exon primer sequences, probe sequences, and internal reference sequences for DMD gene detection
[0042]
[0043]
[0044]
[0045] Example 2: The rest are the same as in Example 1, except that the primer and probe sequences for exon 4 are replaced with:
[0046] Upstream: GCTGGTCAGTGAACACTCTTTTG;
[0047] Downstream: ACCTTGTCCAGGGTACTACTTAC;
[0048] Probe: CCTGAACAATGTCAACAAG.
[0049] Example 3: The rest are the same as in Example 1, except that the primer sequence for exon 8 is replaced with: Upstream: GATACCACCTATCCAGATAAGAAGTC
[0050] Downstream: TGGCCTTGGCAACATTTCCACT
[0051] Probe: ACATCACATCACTCTT
[0052] Example 4: The rest are the same as in Example 1, except that the primer sequence for exon 17 is replaced with: Upstream: TGCCACTCCAAGCAGTCTTTAC
[0053] Downstream: GTGGTCACCGTAGTTACTGTTTC
[0054] Probe: CATCACTAACACAGACAAC
[0055] Example 5: The rest is the same as Example 1, except that the primer sequences for exon 44 are replaced with: Forward: TCAGTGGCTAACAGAAGCTGAAC
[0056] Reverse: GAGTCCAGATGTGCTGAAGATAAATAC
[0057] Probe: CAGAAAGACACAAATTC
[0058] Comparative Example 1: The primer pairs for exons 1-79 of the DMD gene disclosed in Chinese Patent CN112410410A were used for ultra-multiplex digital PCR verification. Each probe was labeled with 2 different fluorophores for single-template specificity verification.
[0059] Example 6: Primer sensitivity test:
[0060] The sensitivity test of the primer mixture was verified using plasmid DNA containing 79 DMD exon fragments as templates respectively. Three copy number loading amounts (3000 copies, 300 copies, 30 copies) were tested in 3 batches, and 20 replicates were performed for each group in each batch. When the positive result was greater than 95%, it was determined to be qualified.
[0061] 1. Preparation of PCR reaction system
[0062] 1.1. Thaw the PCR reaction solution (purchased from PREGENE, product number PJ205051) and the DMD primer mixture at room temperature. After inverting and mixing well, briefly centrifuge with a microcentrifuge to make all the liquid settle at the bottom of the tube. The samples were plasmid DNA containing 79 DMD exon fragments and 20 internal reference fragments respectively.
[0063] 99 pairs of primers in the DMD primer mixture were added in equal amounts, and 99 probes showed a gradient change according to the signal distribution concentration. Specifically, there were 99 pairs of primers, a total of 198 primers, and the final added concentration of each primer was 200 nM. There were 170 probes in total, and the signals were divided into 7 levels (such as Figures 1 to 6 the number of color spots on the horizontal and vertical coordinates in was both 7). From left to right and from bottom to top, the probe concentration increased. The probe concentration at level 1 was 20 nM, level 2 was 40 nM, level 3 was 60 nM, level 4 was 90 nM, level 5 was 120 nM, level 6 was 150 nM, and level 7 was 190 nM.
[0064] In this embodiment, probes are added according to the conventional digital multiplex PCR method. The 99 probe sequences are expanded to 170 probes according to different fluorescent labels. Among the 170 probes, on the X and Y axes, the probes in each well are of the same sequence, but the labels on the probes are different, and the probe sequences in each well are different from each other. Except for the middle position of the plane of the X and Y axes, each well requires 2 probes with different sequences.
[0065] 1.2. Prepare the amplification reaction system according to the following table, shake well and centrifuge briefly to make all the liquid settle at the bottom of the tube.
[0066] Table 2. Preparation Table of PCR Amplification Reaction System
[0067]
[0068] The components of the PCR reaction solution include 50 mM Tris-HCl, 35 mM KCl, 3.5 mM MgCl2, 0.5 mM dNTP, 6 mM glycerol, 0.3 mM EDTA, 0.5 μg / μL BSA, pH 8.5; the concentration of the DNA polymerase is 0.08 U / μL.
[0069] 2. Droplet Generation
[0070] 2.1 Add the mixed reaction system and droplet generation oil to the droplet generation chip, and place the chip in the sample preparation instrument for droplet generation. (For the principle of droplet generation, see Zhu, Zhi, et al. "Single-molecule emulsion PCR in microfluidic droplets." Analytical and Bioanalytical Chemistry 403.8 (2012): 2127-2143. For the usage method of the chip, see the instruction manual provided by the manufacturer Yongnuo Biology).
[0071] 3. PCR Amplification
[0072] 3.1. After droplet generation is completed, transfer the droplets to a 96-well PCR plate and seal the film.
[0073] 3.2. Amplify the PCR plate on the PCR instrument under the following conditions.
[0074] Table 3. PCR Reaction Conditions
[0075]
[0076] 4. Result Reading and Analysis
[0077] 4.1 After PCR amplification, place the 96-well PCR plate in a reader for droplet detection and analysis of the DMD gene detection results. The device system and detection method used in this example can refer to Patent CN114958583A. The results are as follows:
[0078] Table 4. Sensitivity test results of Example 1
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085] Table 5 Sensitivity analysis results of Examples 2-5 and Comparative Example 1 (copies / reaction)
[0086]
[0087]
[0088]
[0089] The comparison of the results in Table 4 and Table 5 shows that after replacing the primers and probes of a certain exon, the sensitivity of the entire primer mixture will decrease. The results in Table 4 show that the exon primer sequence and probe sequence combination in Table 1 achieved the best sensitivity compared with the existing primers. The primer combination in Comparative Example 1 could not achieve good sensitivity for DMD exon detection either.
[0090] Example 7: Primer specificity test:
[0091] The primer specificity test was verified by four primer probes randomly selected on autosomes. The PCR system and method were the same as in Example 6. In the normal human gDNA sample, the copy numbers of each test site on autosomes were consistent with those of each test site on the DMD gene.
[0092] Table 6. Specificity analysis test results of Examples 1-5 and Comparative Example 1
[0093]
[0094]
[0095]
[0096] Table 6 results show that the replacement of individual exon primers and probes will lead to a decrease in the overall specificity of the primer mixture (as shown in the results of Examples 2 to 5). When the existing primers in Comparative Example 1 are directly used for ultra-multiplex digital PCR, problems of low specificity will also occur.
[0097] Table 7 Random primer and probe sequences on autosomes
[0098]
[0099] Example 8: Primer precision test:
[0100] The precision test of the primer mixture was completed by testing plasmid DNA templates containing 79 DMD exon fragments in three batches within 6 days. The input amount of the plasmid template was 300 copies per reaction. The PCR reaction system and method were the same as in Example 6, and the test results are as follows:
[0101] Table 8 Precision test results of the primer mixture in Example 1
[0102]
[0103]
[0104]
[0105] Since non-specific amplification occurred in Examples 2 - 5 (as shown in Table 6), precision tests could not be performed, and precision data are not listed here;
[0106] Example 9: The primer mixture in Example 1 was actually used for ultra-multiplex digital PCR reaction of white blood cell samples to detect all 79 exons and give the detection results. In this example, genomic nucleic acids were extracted from white blood cell samples collected from neonatal peripheral blood and detected, and the results are as follows:
[0107] Table 9 Quantitative results of each exon in negative clinical samples
[0108]
[0109]
[0110]
[0111] Table 9 results show that the internal reference ratio meets expectations, the ratio of each exon is close to 1, and there is no exon deletion in the sample. Table 8 results indicate that the primer and probe mixture provided by the present invention can be used for ultra-multiplex digital PCR reaction to accurately determine DMD mutations. The results are as follows:
[0112] Quantification results of each exon of the positive clinical samples in Table 10
[0113]
[0114]
[0115]
[0116] The results in Table 10 show that the proportion of the internal reference meets the expectation, exon 48 is deleted, and the proportions of the remaining exons are close to 1 without deletion. The present application has been described in detail above in combination with specific embodiments and exemplary examples, but these descriptions should not be construed as limiting the present application. Those skilled in the art understand that without departing from the spirit and scope of the present application, various equivalent substitutions, modifications or improvements can be made to the technical solutions and their implementation manners of the present application, and these all fall within the scope of the present application. The protection scope of the present application shall be subject to the appended claims.
Claims
1. A digital PCR detection reagent for DMD gene detection, characterized in that, It includes exon primer sequences shown in SEQ ID NO:1 to SEQ ID NO:158, exon probe sequences shown in SEQ ID NO:159 to SEQ ID NO:237, internal reference primer sequences shown in SEQ ID NO:238 to SEQ ID NO:277, and internal reference probe sequences shown in SEQ ID NO:278 to SEQ ID NO:
297.
2. A super-multiplex digital PCR detection method, characterized in that, The super-multiplex digital PCR detection method is for non-disease diagnosis and treatment purposes and includes the following steps: S1. Prepare a PCR reaction system; the PCR reaction system contains a mixture of the primer and probe sequences described in claim 1. S2. Add the mixed PCR reaction system and droplet generation oil into a droplet generation chip, and place the droplet generation chip into a sample preparation instrument for droplet generation. S3. After droplet generation is completed, transfer the droplets to a PCR plate and seal the film. S4. Amplify the PCR plate on a PCR instrument. S5. After the PCR amplification reaction is completed, place the PCR plate in a reader for droplet detection and result analysis.
3. The super-multiplex digital PCR detection method according to claim 2, characterized in that, The system of the PCR reaction is: In the DMD primer mixture, 99 pairs of primers are added in equal amounts, and 99 probes vary in concentration gradient according to signal distribution.
4. The super-multiplex digital PCR detection method according to claim 3, characterized in that, The final added concentration of each primer is 200 nM; the signals are divided into 7 levels. The final concentration of the probe in level 1 is 20 nM, in level 2 is 40 nM, in level 3 is 60 nM, in level 4 is 90 nM, in level 5 is 120 nM, in level 6 is 150 nM, and in level 7 is 190 nM.
5. The super-multiplex digital PCR detection method according to claim 3, characterized in that, The components of the PCR reaction solution include 50 mM Tris-HCl, 35 mM KCl, 3.5 mM MgCl2, 0.5 mM dNTP, 6 mM glycerol, 0.3 mM EDTA, 0.5 μg / μL BSA; the concentration of the DNA polymerase is 0.08 U / μL.
6. The super-multiplex digital PCR detection method according to claim 3, characterized in that, The sample is human genomic DNA.
7. The super-multiplex digital PCR detection method according to claim 3, characterized in that, The PCR reaction conditions are:
Citation Information
Patent Citations
Detection kit and method for Duchenne / Becker muscular dystrophy based on multiplex PCR (Polymerase Chain Reaction) trapping technique
CN108220418A
Primers for detecting DMD gene variation based on high throughput sequencing technology and application thereof
CN109554443A
Amplifying system and reagent kit for detecting DMD (Duchenne muscular dystrophy) gene exon copy number variation
CN110527720A
Copy number variation detection kit of DMD (Duchenne Muscular Dystrophy) and SMA (Spinal Muscular Atrophy) based on MLPA-NGS technology, and application thereof
CN112410410A
DMD gene exon copy number variation detection method and application thereof
CN113652474A