A functional InDel molecular marker BW07-InDel tightly linked to upland cotton boll size and its application

Abstract

The present invention provides a functional InDel molecular marker BW07-InDel, tightly linked to boll size in upland cotton, and its use, belonging to the technical field of upland cotton breeding. The nucleotide sequence of the functional InDel molecular marker BW07-InDel, tightly linked to boll size in upland cotton, provided by the present invention, is shown in SEQ ID NO. 1. Using this molecular marker, boll size can be quickly, efficiently, and accurately identified during the early stages of cotton growth, improving the efficiency of selecting large-boll upland cotton varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of upland cotton breeding, and in particular relates to an InDel functional molecular marker BW07-InDel that is tightly linked to upland cotton boll size and an application thereof. Background Art

[0002] Cotton is an important cash and oil crop and a primary raw material for the textile industry. Cotton yield is composed of three factors: boll weight (BW), boll number per plant (NB), and lint percentage (LP). Boll weight, as a key component of cotton yield traits, is a crucial determinant of cotton yield. Boll weight is the weight of the seed cotton within a single boll, representing the sum of the weight of the seed and the weight of the cotton fiber. Selection for boll weight requires indoor testing, which has a certain lag and affects the efficiency of field breeding. Boll size, on the other hand, can, to a certain extent, directly reflect boll weight. Therefore, breeders often use boll size as a key indicator in field testing. Rapid, efficient, and accurate identification of boll size requires precise mapping of the target trait and the identification of molecular markers closely linked to it. However, no molecular markers closely linked to boll size (boll weight) have been reported, and there are relatively few reports on gene cloning for target traits, which cannot meet the requirements of modern rapid marker-assisted selection and molecular aggregation breeding. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide an InDel functional molecular marker BW07-InDel that is closely linked to the boll size of upland cotton. The molecular marker of the present invention can be used to quickly, efficiently and accurately identify the boll size in the early stage of cotton growth, thereby improving the selection efficiency of upland cotton large-boll varieties.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides an InDel functional molecular marker BW07-InDel that is tightly linked to upland cotton boll size. The nucleotide sequence of the InDel functional molecular marker BW07-InDel is shown in SEQ ID NO.1.

[0006] The present invention also provides a primer pair for detecting the above-mentioned InDel functional molecular marker BW07-InDel, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0007] The present invention also provides a kit for detecting the size of upland cotton bolls, which comprises the above primer pair.

[0008] The present invention also provides the use of the above-mentioned InDel functional molecular marker BW07-InDel or the above-mentioned primer pair or the above-mentioned kit in detecting the size of upland cotton bolls.

[0009] The present invention also provides the use of the above-mentioned InDel functional molecular marker BW07-InDel or the above-mentioned primer pair or the above-mentioned kit in the breeding of high-yield cotton varieties.

[0010] The present invention also provides the use of the above-mentioned InDel functional molecular marker BW07-InDel or the above-mentioned primer pair or the above-mentioned kit in molecular polymerization breeding.

[0011] The present invention also provides the use of the above-mentioned InDel functional molecular marker BW07-InDel or the above-mentioned primer pair or the above-mentioned kit in upland cotton gene map-based cloning.

[0012] The present invention also provides a method for detecting the size of upland cotton bolls, comprising the following steps: using the DNA of the cotton to be tested as a template, performing PCR amplification with the above-mentioned primer pair to obtain an amplified product; judging the size of the bolls of the cotton to be tested based on the length of the amplified product: when the length of the amplified product is 1820 bp, the bolls of the cotton to be tested are small; when the length of the amplified product is 975 bp, the bolls of the cotton to be tested are large.

[0013] Preferably, the reaction system for PCR amplification is: 19 μl of ddH2O, 2.0 μl of template DNA, 25 μl of 2×PhantaFlashMasterMix, 2.0 μl of 10 μM forward primer, and 2.0 μl of 10 μM reverse primer.

[0014] Preferably, the reaction procedure of the PCR amplification is preheating at 98°C for 30s; denaturation at 98°C for 10s, annealing at 57°C for 10s, extension at 72°C for 10s, 30 cycles; extension at 72°C for 1min, and storage at 4°C.

[0015] Beneficial effects of the present invention:

[0016] This invention provides, for the first time, a functional molecular marker, BW07-InDel, that is tightly linked to boll size on chromosome 07 of upland cotton. This marker is tightly linked to the target trait and possesses the target trait function. The functional molecular marker BW07-InDel provided by this invention can rapidly and accurately identify boll size (boll weight), significantly accelerating the breeding of high-yielding cotton varieties. It has important application value in marker-assisted selection and molecular aggregation breeding for boll size (boll weight), and also lays the foundation for map-based cloning of boll size (boll weight) QTLs / genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Comparative analysis of boll size of parent cotton and boll length (BL) and boll width (BW) in different years;

[0018] Figure 2 For the fine mapping of the target trait cotton boll size and identification of tightly linked molecular markers;

[0019] Figure 3 This is the identification result of the functional molecular marker BW07-InDel on the parents and 14 natural population materials, among which P1 is Lumianyan 22 (LMY22), P2 is CSSL7, No. 1-14 are China Cotton Research Institute No. 5, ASJ-5, Chang 429, Yiyin 85, Huimin R-99, Xuzhou 1818, PD6189, Shaanxi 401, Jinmian 38, Zhongyuan 9114, Suyuan 04-21, Jimian 17, Kuche 386-5 and Xinlu Zao 6 respectively; among them, No. 1, 4, 5, 6, 9, 10, 12 and 14 are small-boll materials; among them, No. 2, 3, 7, 8, 11 and 13 are large-boll materials;

[0020] Figure 4 These are the distribution diagrams of cotton boll length data for two parents and 14 natural population materials in different years, where Figure (a) is the data from 2019 and Figure (b) is the data from 2020; P1 is Lumianyan No. 22 (LMY22), P2 is CSSL7, and No. 1-14 are respectively China Cotton Research Institute No. 5, ASJ-5, Chang 429, Yiyin 85, Huimin R-99, Xuzhou 1818, PD6189, Shaanxi 401, Jinmian 38, Zhongyuan 9114, Suyuan 04-21, Jimian 17, Kuche 386-5 and Xinlu Zao 6; among them, No. 1, 4, 5, 6, 9, 10, 12 and 14 are small boll materials; among them, No. 2, 3, 7, 8, 11 and 13 are large boll materials. DETAILED DESCRIPTION

[0021] The present invention provides an InDel functional molecular marker BW07-InDel that is tightly linked to upland cotton boll size. The nucleotide sequence of the InDel functional molecular marker BW07-InDel is shown in SEQ ID NO.1.

[0022] The present invention discovered a new allelic variation of the major gene GhBW1 controlling boll size, located on chromosome 7 of cotton, and obtained an InDel functional molecular marker BW07-InDel that can be used to distinguish between the two. Simply by detecting the amplified band characteristics of the above-mentioned marker, it is possible to determine whether the GhBW1 locus in the target material is a new allelic variation, which can be used to guide breeding work to improve cotton boll size (boll weight) and enable the screening of varieties with large boll phenotypes. The molecular markers provided by the present invention can not only distinguish the genotypes of cotton varieties at the seedling stage, but also conveniently, quickly, and directly realize the identification of target genes in cotton germplasm resources and breeding offspring, greatly reducing labor costs, saving time, and being unaffected by environmental and human factors.

[0023] The present invention also provides a primer pair for detecting the above-mentioned InDel functional molecular marker BW07-InDel, the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.2: ACCTCTCTAAACTTTTAGTGTTCAA and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3: TGGTAAAAATCTGGCACAAG.

[0024] The present invention also provides a kit for detecting the size of upland cotton bolls, which comprises the above primer pair.

[0025] The present invention has no particular limitation on other reagents contained in the kit, and any reagent commonly used in PCR amplification in the art may be used, such as dNTPs, Taq DNA polymerase, and 10× Taq buffer containing magnesium ions.

[0026] The present invention also provides the use of the above-mentioned InDel functional molecular marker BW07-InDel or the above-mentioned primer pair or the above-mentioned kit in detecting upland cotton boll size, breeding of high-yield cotton varieties, molecular polymerization breeding or upland cotton gene map cloning.

[0027] The present invention also provides a method for detecting the size of upland cotton bolls, comprising the following steps: using the DNA of the cotton to be tested as a template, performing PCR amplification with the above-mentioned primer pair to obtain an amplified product; judging the size of the bolls of the cotton to be tested based on the length of the amplified product: when the length of the amplified product is 1820 bp, the bolls of the cotton to be tested are small; when the length of the amplified product is 975 bp, the bolls of the cotton to be tested are large.

[0028] The present invention does not specifically limit the specific method for obtaining the cotton DNA to be tested, and conventional DNA extraction methods in the art can be used. In the present invention, the reaction system for the PCR amplification is preferably: 19 μl of ddH2O, 2.0 μl of template DNA, 25 μl of 2×PhantaFlashMasterMix, 2.0 μl of 10 μM forward primer, and 2.0 μl of 10 μM reverse primer. The present invention does not specifically limit the specific sources of the above-mentioned reagents, and conventional commercially available products in the art can be used. In the present invention, the reaction procedure for the PCR amplification is preferably preheating at 98°C for 30s; denaturation at 98°C for 10s, annealing at 57°C for 10s, extension at 72°C for 10s, and 30 cycles; extension at 72°C for 1min, and storage at 4°C.

[0029] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] In the following examples, unless otherwise specified, all methods are conventional.

[0031] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0032] Example 1

[0033] To identify candidate genes controlling boll size, the large-boll Chromsome Single-segment Substitution Line 7 (CSSL7) (boll weight 6.02 g) obtained in the early stage of this project was hybridized with the normal-boll cotton line LMY22 (boll weight 5.29 g) to obtain the F1 generation. Specifically, in the summer of 2015, a (LMY22×CSSL7) F1 pairing was conducted at the Linqing Experimental Station of the Shandong Academy of Agricultural Sciences. The parent, Lumianyan 22 (LMY22), had small bolls, with a boll length (BL) of 46.79 mm, a boll width (BW) of 33.14 mm, and a boll weight (BW) of 5.29 g. The parent, CSSL7, had large bolls, with a boll length (BL) of 52.76 mm, a boll width (BW) of 36.39 mm, and a boll weight (BW) of 6.02 g. Significant differences were found between the two parents in boll length, width, and weight. A comparison of the boll size of the parents and the boll length (BL) and width (BW) in 2018 and 2019 is shown below. Figure 1 shown.

[0034] A secondary introgression F2 population was obtained by selfing in Sanya, Hainan, during the winter of 2015. Amplification of this secondary introgression F2 population using polymorphic primers was performed in a 10-μl reaction system consisting of 4.7 μl of ddH₂O, 1.0 μl of template DNA, 1.0 μl of 10× Buffer, 1.0 μl of 2.5 mM MgCl₂, 0.2 μl of 10 mM dNTPs, 1.0 μl of a 10 μM forward primer, 1.0 μl of a 10 μM reverse primer, and 0.1 μl of Taq DNA polymerase. The amplification protocol was as follows: preheating at 95°C for 5 min, denaturation at 94°C for 45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min; 30 cycles were performed, followed by extension at 72°C for 10 min. The mixture was then stored at 4°C until removal and analyzed by electrophoresis on an 8% native polyacrylamide (PAGE) gel. In 2016, the F2 population of parental and secondary introgression (LMY22×CSSL7) was planted at the Linqing Experimental Station of Shandong Academy of Agricultural Sciences. The F2 population size was 3302 plants. Both parents were resequenced at the same time, InDel molecular markers were developed for the target region, and parental polymorphic markers were screened. From 2017 to 2018, the identification of recombinant exchange individuals was carried out for four generations for two consecutive years, and 13 homozygous exchange recombinant individuals were identified, such as Figure 2 In 2019, the parents and 13 homozygous exchange recombinant individuals were planted at the Linqing Experimental Station of Shandong Academy of Agricultural Sciences. Boll size was measured in late August. Since there were significant differences in boll length and boll width between the parents, but the increase in boll length (11.31%) was greater than that in boll width (8.93%), the phenotypic data of boll length were mainly used to locate the boll size gene in the subsequent fine positioning of cotton boll size ( Figure 2 Combined with the boll length phenotypic data, the fine mapping of cotton boll size was performed, and the candidate region was found to be an InDel with a physical distance of 54.77 kb. BW15 and SSR01, and with InDel BW02Molecular markers were tightly linked, and comparison with the cotton genome database revealed that the candidate region contained only one gene, functionally annotated to be related to organ development and named GhBW1. The genomic size of this gene is 4252 bp, consisting of two exons and one intron. Resequencing of the parents revealed a large difference in the target gene region between the parents CSSL7 and LMY22. Due to the large size of the target gene, the gene was amplified in three sections. The first section consisted of the promoter (500 bp), the first exon (246 bp), and the deletion to the first intron (1074 bp), totaling approximately 1820 bp. The second section consisted of the deletion to the second exon (approximately 1787 bp). The third section consisted of the second exon and the following 500 bp, totaling approximately 1616 bp. Amplification results showed no differences between the two parents in the second and third sections, but the first section differed in nucleotide sequence as shown in SEQ ID NO. 1. Further sequence comparison analysis revealed that CSSL7 lacked the nucleotide sequence shown in SEQ ID NO.1 in the gene intron compared with LMY22, resulting in the difference in boll size between the two parents. The InDel functional molecular marker BW07-InDel, whose nucleotide sequence is shown in SEQ ID NO.1, was determined to be closely linked to boll size in upland cotton.

[0035] Example 2

[0036] For the InDel functional molecular marker BW07-InDel obtained in Example 1, a primer pair as shown in Table 1 was designed. Two parents and 14 natural population materials were planted for two consecutive years in 2019 and 2020. The 14 natural populations were phenotypic classified into 8 small-boll materials, namely, Zhongmian 5, Yiyin 85, Huimin R-99, Xuzhou 1818, Jinmian 38, Zhongyuan 9114, Jimian 17, Xinlu Zao 6, and 6 large-boll materials, namely, ASJ-5, Chang 429, PD6189, Shaanxi 401, Suyuan 04-21, and Kuche 386-5. The boll size was measured in late August of the planting year, and PCR amplification was performed using the primer pairs described in Table 1. The PCR amplification reaction system was 50 μl and consisted of the following: 19 μl ddH2O, 2.0 μl template DNA, 25 μl 2×PhantaFlashMasterMix (DyePlus), 2.0 μl forward primer at a concentration of 10 μM, and 2.0 μl reverse primer at a concentration of 10 μM. The amplification reaction procedure was as follows: preheat at 98°C for 30 seconds; denaturation at 98°C for 10 seconds, annealing at 57°C for 10 seconds, and extension at 72°C for 10 seconds, for 30 cycles; extension at 72°C for 1 minute; storage at 4°C until removal, and recording the results using 1% gel electrophoresis. The results are shown in the figure below. Figure 3The identification results showed that 8 small-boll materials had the same genotype as the parent LMY22, and the amplified product was 1820 bp long; 6 large-boll materials had the same genotype as the parent CSSL7, and the amplified product was 975 bp long.

[0037] The boll size (boll length) data results are as follows Figure 4 The boll lengths of the eight small-boll materials were basically the same as that of the parent LMY22, and the six large-boll materials were basically the same as that of the parent CSSL7. There were significant differences between the small-boll materials and the large-boll materials.

[0038] Table 1 Primer pairs for amplifying the InDel functional molecular marker BW07-InDel

[0039]

[0040]

[0041] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A functional InDel molecular marker BW07-InDel tightly linked to boll size in upland cotton, characterized by: The nucleotide sequence of the InDel functional molecular marker BW07-InDel is shown in SEQ ID NO.

1.

2. A primer pair for detecting the InDel functional molecular marker BW07-InDel according to claim 1, characterized in that: The primer pair includes a forward primer whose nucleotide sequence is shown as SEQ ID NO.2 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.

3.

3. A kit for detecting the size of upland cotton bolls, characterized in that: The kit comprises the primer pair according to claim 2.

4. Use of the InDel functional molecular marker BW07-InDel according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in detecting boll size in upland cotton.

5. Use of the InDel functional molecular marker BW07-InDel according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in breeding high-yielding cotton varieties.

6. Use of the InDel functional molecular marker BW07-InDel according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in breeding of upland cotton boll size polymers.

7. A method for detecting the size of upland cotton bolls, characterized in that: The method comprises the following steps: using the DNA of the cotton to be tested as a template and performing PCR amplification with the primer pair according to claim 2 to obtain an amplified product; and judging the size of the cotton bolls to be tested according to the length of the amplified product: when the length of the amplified product is 1820 bp, the bolls of the cotton to be tested are small; and when the length of the amplified product is 975 bp, the bolls of the cotton to be tested are large.

8. The method according to claim 7, characterized in that The reaction system of the PCR amplification is: 19 μl of ddH2O, 2.0 μl of template DNA, 25 μl of 2×Phanta Flash MasterMix, 2.0 μl of 10 μM forward primer, and 2.0 μl of 10 μM reverse primer.

9. The method according to claim 7, characterized in that The reaction procedure of the PCR amplification was as follows: preheating at 98°C for 30s; denaturation at 98°C for 10s, annealing at 57°C for 10s, extension at 72°C for 10s, 30 cycles; extension at 72°C for 1min, and storage at 4°C.

Images