Application of stemness gene WOX14 in controlling plant shoot regeneration

Abstract

The invention discloses an application of a stem gene WOX14 in promoting plant bud regeneration, and belongs to the field of plant biotechnology. The invention finds that the stem gene WOX14 has an application in controlling plant bud regeneration, and can use genetic engineering means to overexpress the stem gene WOX14 through gene editing or overexpression to improve the bud regeneration ability in plant tissue culture, and can also reduce the bud regeneration ability of plants in tissue culture by knocking out the stem gene WOX14.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and particularly relates to application of a stemness gene WOX14 in promoting plant bud regeneration. Background Art

[0002] Tissue culture is one of the commonly used plant biotechnology methods to achieve asexual reproduction and large-scale propagation of plants. Specifically, under sterile culture conditions, by adjusting the type, content and ratio of plant hormones in the culture medium, mainly including auxins and cytokinins, suitable explants are induced to form embryonic callus, and further undergo callus proliferation and differentiation processes to obtain high-quality regenerated buds. The regenerated buds take root under the action of suitable growth regulators, generally high-concentration cytokinins, and finally a large number of regenerated seedlings are obtained through seedling training and other steps. Obtaining high-quality regenerated buds is a key link that affects the success or failure of plant tissue culture.

[0003] The bud regeneration process commonly used in tissue culture needs to go through two stages: the first step is to form pluripotent embryonic callus under the induction of high concentrations of auxin, and the second step is to initiate bud regeneration under the induction of high concentrations of cytokinins. The bud regeneration process is related to the activity of plant stem cells, but it is different from the development of shoot apical meristem and root apical meristem. It is related to factors such as plant species, genotype, explant type, culture conditions and growth regulators, but the specific regulatory mechanism is still unclear. For tissue culture production, studying methods to promote bud regeneration has broad application value.

[0004] Genotype is an intrinsic factor that affects plant callus formation and bud regeneration. Discovering the main and functionally conserved genes that regulate plant bud regeneration and manipulating the gene expression activity through genetic engineering is a feasible biotechnology means to improve plant bud regeneration ability.

[0005] WUSCHEL (WUS)-RELATED HOMEOBOX 14 (WOX14) is a homeobox gene that maintains stem cell activity in the Arabidopsis shoot apical meristem. WOX14 and its homologous gene WOX4 jointly regulate plant vascular tissue development (Etchells JP, Provost CM, Mishra L, et al. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation [J]. Development, 2013, 140 (10): 2224-2234.). What other physiological functions does WOX14 have, and whether WOX14 has new functions different from its homologous genes (such as WOX4) has not been publicly reported.

[0006] Obtaining high-quality regenerated buds is a key link that affects the success or failure of plant tissue culture. Even if you try to adjust the type, content and ratio of plant hormones in the culture medium, some plants still have difficulty in regenerating buds. For tissue culture production, studying the regulatory mechanism that affects bud regeneration, discovering regulatory genes, and thus improving the ability of bud regeneration through genetic engineering methods has broad application value. Summary of the invention

[0007] The purpose of the present invention is to provide application of stemness gene WOX14 in controlling plant bud regeneration.

[0008] The present invention found that compared with the wild type, the number of regenerated shoots formed by hypocotyl explants of WOX14 overexpressing plants on shoot induction medium (SIM) was significantly increased, indicating that WOX14 is a positive regulatory factor controlling Arabidopsis shoot regeneration.

[0009] The present invention found that compared with the wild type, the callus of the WOX14 overexpressing plant can form regenerated shoots on a medium without cytokinins, indicating that WOX14 can promote Arabidopsis shoot regeneration through a cytokinin-independent pathway. The regenerated shoot phenotype of the overexpressed or mutant plants of WOX4, a homologous gene of WOX14, is no different from that of the wild type, indicating that the function of WOX14 in promoting Arabidopsis shoot regeneration is specific.

[0010] The present invention found that the deletion of the WOX14 encoding gene resulted in a significant decrease in the number of regenerated shoots formed by Arabidopsis hypocotyl explants on shoot induction medium (SIM), further supporting the above conclusion at the genetic level, that is, WOX14 is a positive regulatory factor controlling Arabidopsis shoot regeneration.

[0011] Based on the above findings, the present invention provides an application of the stemness gene WOX14 in controlling plant bud regeneration. The amino acid sequence of the WOX14 protein encoded by the stemness gene WOX14 is shown in SEQ ID NO. 1. The control of plant bud regeneration is to increase or decrease the bud regeneration ability of the plant in tissue culture.

[0012] In some embodiments, the WOX14 gene can be knocked in by gene editing or overexpressed by transgenics to enhance the gene expression activity and improve the bud regeneration ability of the plant in tissue culture.

[0013] In some embodiments, the WOX14 gene can be knocked out by gene editing or other gene mutation methods to achieve the purpose of inhibiting gene expression activity and reducing the plant's ability to regenerate shoots in tissue culture.

[0014] In some embodiments, the nucleotide sequence of the stemness gene WOX14 is as shown in SEQ ID NO.2.

[0015] In some embodiments, the plant is a plant containing the stemness gene WOX14 or a homologous gene thereof.

[0016] In some embodiments, the plant is Arabidopsis thaliana.

[0017] The advantages of the present invention are:

[0018] (1) The present invention discovered a new function of the homeobox gene WOX14, which is universally conserved in higher plants, in promoting plant bud regeneration.

[0019] (2) The function of WOX14 in promoting plant shoot regeneration is a specific function different from that of its homologous genes.

[0020] (3) As plant gene editing technology matures, more and more plant genomes are sequenced, making it feasible to knock out, knock in, or overexpress genes in different plants. Knocking in or overexpressing WOX14 will significantly improve the ability of plant bud regeneration during tissue culture. This application is particularly important for plants that have difficulty regenerating buds from callus. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1It is the gene expression detection of WOX4 overexpression material. Real-time fluorescence quantitative PCR (RT-qPCR) is used to detect the target gene expression level of overexpression transgenic material. Col-0 is wild-type Arabidopsis, which is the control. 35S:WOX14 is the overexpression transgenic material.

[0022] Figure 2 The figure shows the number of regenerated shoots of WOX14 overexpression materials, wox14 deletion mutants and wild type. Col-0 is wild type Arabidopsis and is the control. 35S:WOX14 is an overexpression transgenic material. wox14-1 is a WOX14 deletion mutant. wox4-1 wox14-1 is a double mutant of WOX4 and WOX14. (A) Phenotypic diagram. (B) Statistical diagram. Asterisks represent significant differences. Statistical methods: Dunnett's multiple comparison test, one-way ANOVA (*P<0.05, **P<0.01, ****P<0.0001).

[0023] Figure 3 The phenotypes of calli of WOX14 overexpression material and wild type in normal medium (without cytokinin). Col-0 is wild type Arabidopsis thaliana, which is the control. 35S:WOX14 is an overexpression transgenic material.

[0024] Figure 4 The figure shows the number of regenerated shoots of WOX4 overexpression materials, wox4 deletion mutants and wild type. Col-0 is wild type Arabidopsis and is the control. 35S:WOX4 is the overexpression transgenic material. wox4-1 is the WOX4 deletion mutant. (A) Phenotypic diagram. (B) Statistical diagram. Asterisks represent significant differences. Statistical methods: Dunnett's multiple comparison test, one-way ANOVA (*P<0.05, **P<0.01, ****P<0.0001). DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0026] Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods and can be carried out according to the described recombinant technology (see Molecular Cloning Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can all be obtained from commercial channels.

[0027] The culture medium and culture conditions used for tissue culture in the following examples are as follows: the CIM medium formula is: 4.4gMS basic salt (containing vitamins); basal medium with vitamins, 0.5g / L methylestersulfonate, 20g / L sucrose, 2.2mM 2,4-D, 0.2mM kinetin and 8g / L agar, pH 5.7; the SIM medium formula is: 4.4gMS basic salt (containing vitamins), 0.5g / L methylestersulfonate, 20g / L sucrose, 5mM kinetin, 0.9mM indole-3-acetic acid and 8g / L agar, pH 5.7; the culture temperature is 22°C, and the photoperiod is 16h light / 8h dark.

[0028] Example 1 Compared with the wild type, the shoot regeneration ability of the WOX14 overexpressing plant (35S:WOX14) was significantly enhanced.

[0029] The strong 35S promoter was used to drive WOX14 to obtain transgenic overexpression materials. The regenerated shoot phenotype of the overexpression materials was investigated.

[0030] The method for creating the 35S:WOX14 overexpression plant involved in Example 1 is as follows: the genomic fragment containing the WOX14 coding region is amplified by PCR and then cloned into the pPLV26 vector containing the 35S promoter (De Rybel B, van den Berg W, Lokerse AS, et al. A versatile set of ligation-independent cloning vectors for functional studies in plants [J]. Plant physiology, 2011, 156 (3): 1292-1299.) by the Gibson homologous recombination method. The sequence fidelity is confirmed by sequencing to obtain the 35S:WOX14 overexpression vector. After the vector is transformed into Agrobacterium, it is transformed into Arabidopsis thaliana by the inflorescence dip method. The target gene of the obtained transgenic line is detected by RT-qPCR, and finally a stable WOX14 overexpression transgenic line is obtained. The RT-qPCR detection results are shown in Figure 1 In the WOX14 overexpression transgenic materials, the expression level of the WOX14 gene was significantly increased ( Figure 1 ).

[0031] The cloning primer sequences are:

[0032] WOX14-OE-F: 5'-AGGACACGGGGCCCCTCGAGATGGTAAAAAAAAAAAAGGAAAAGGAG-3',

[0033] WOX14-OE-R: 5'-TGAACGATCGGGGATCGGATCCTTAAGTCTCCATAAATTTCCCTATACTCAAC-3'.

[0034] The RT-qPCR primer sequences are as follows:

[0035] qRT-WOX14-PCF:CCGTTATTTGTGACCAACTCG,

[0036] qRT-WOX14-PCR:AAAGTATCCGCCAACCATTG.

[0037] After 7 days of dark culture, 1 cm hypocotyls of WOX14 overexpressing transgenic materials were taken as explants. After the explants were transferred to CIM medium, culture was continued for 7 days until callus was formed. The callus was transferred to SIM medium and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph and count the number of regenerated buds of each explant callus. A regenerated bud was defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected in 3 biological replicates. The results showed that WOX14 overexpression significantly promoted the formation of regenerated buds in Arabidopsis hypocotyl explants on SIM medium ( Figure 2 ).

[0038] Example 2 Compared with the wild type, the deletion of the WOX14 encoding gene resulted in a significant decrease in the number of regenerated shoots formed by Arabidopsis hypocotyl explants on shoot induction medium.

[0039] There are three Arabidopsis materials involved in Example 2. Col-0 is wild-type Arabidopsis, which is the control. wox14-1 is a WOX14 deletion mutant. wox4-1 wox14-1 is a double mutant of WOX4 and WOX14. The preparation of wox4-1, wox14-1 and wox4-1 wox14-1 is detailed in the literature Etchells JP, Provost CM, Mishra L, et al. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation [J]. Development, 2013, 140 (10): 2224-2234.

[0040] All materials were cultured in the dark for 7 days, and 1 cm hypocotyls were taken as explants. After the explants were transferred to CIM medium, they were cultured for another 7 days until callus was formed. The callus was transferred to SIM medium and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph, and count the number of regenerated buds of each explant callus. A regenerated bud was defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that compared with the wild type, the loss of the WOX14 encoding gene resulted in a significant reduction in the number of regenerated buds formed by Arabidopsis hypocotyl explants on bud induction medium ( Figure 2 ). In summary, it was proved at the genetic level that WOX14 is a positive regulatory factor controlling plant shoot regeneration.

[0041] Example 3 Compared with the wild type, calli of WOX14 overexpressing plants can form regenerated shoots on a medium without cytokinins, indicating that WOX14 can promote Arabidopsis shoot regeneration through a cytokinin-independent pathway.

[0042] All materials were cultured in the dark for 7 days, and 1 cm hypocotyls were taken as explants. After the explants were transferred to CIM medium, they were cultured for another 7 days until callus was formed. The callus was transferred to normal culture medium (MS medium, without cytokinin) and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph, and count the number of regenerated buds of each explant callus. A regenerated bud is defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that compared with the wild type, the callus of the WOX14 overexpressing plant could form regenerated buds even on a culture medium without cytokinin ( Figure 3), further supporting that WOX14 has a strong role in promoting shoot regeneration.

[0043] Example 4 The regenerated shoot phenotype of overexpressed or mutant plants of WOX4, a homologous gene of WOX14, is no different from that of the wild type, indicating that the function of WOX14 in promoting shoot regeneration in Arabidopsis is specific.

[0044] The preparation of WOX4 overexpressing plant 35S:WOX4 is detailed in the literature Suer S, Agusti J, Sanchez P, et al. WOX4imparts auxin responsiveness to cambium cells in Arabidopsis[J]. The Plant Cell, 2011, 23(9): 3247-3259. The preparation of the WOX4 mutant plant wox4-1 is the same as described in Example 2.

[0045] All materials were cultured in the dark for 7 days, and 1 cm hypocotyls were taken as explants. After the explants were transferred to CIM medium, they were cultured for another 7 days until callus was formed. The callus was transferred to normal medium (without cytokinin) and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph, and count the number of regenerated buds of each explant callus. A regenerated bud is defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that the regenerated bud phenotype of WOX4 overexpression or mutant plants was no different from that of the wild type ( Figure 4 ), which indirectly suggests that the function of WOX14 in promoting shoot regeneration in Arabidopsis is specific and different from the known functions of its homologous genes.

[0046] In summary, these in vivo genetic evidence, i.e., the results of the regeneration shoot phenotype analysis of overexpression and mutant materials, indicate that WOX14 is a regulatory factor that promotes shoot regeneration. From the perspective of plant phylogenetic analysis, the present invention provides an implementation method for controlling the efficiency of regeneration shoots in tissue culture of different plants by genetic manipulation of WOX14.

[0047] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. Sequence Listing <110> Shaanxi Normal University Hubei Medical College <120> Application of stemness gene WOX14 in controlling plant shoot regeneration <160> 2 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 211 <212> PRT <213> Arabidopsis thaliana <400> 1 Met Val Lys Lys Lys Lys Glu Lys Glu Lys Ser Lys Glu Ile Glu Glu 1 5 10 15 Met Asp Arg Glu Ile Gln Asn Gly Ala Tyr Ser Gly Arg Val Met Thr 20 25 30 Glu Glu Gln Met Glu Ile Leu Arg Lys Gln Ile Ala Val Tyr Ala Val 35 40 45 Ile Cys Asp Gln Leu Val Leu Leu His Asn Ser Leu Ser Ser Tyr His 50 55 60 Pro Leu Ser Ser Gly Val Arg Pro Met Val Gly Gly Tyr Phe Asp Pro 65 70 75 80 Met Gly Ala Ser Ser Ser Ser His Arg Ile Ser Thr Arg His Arg Trp 85 90 95 Thr Pro Thr Ser Thr Gln Leu Gln Ile Leu Glu Ser Ile Tyr Asp Glu 100 105 110 Gly Ser Gly Thr Pro Asn Arg Arg Arg Ile Arg Glu Ile Ala Thr Glu 115 120 125 Leu Ser Glu His Gly Gln Ile Thr Glu Thr Asn Val Tyr Asn Trp Phe 130 135 140 Gln Asn Arg Arg Ala Arg Ser Lys Arg Lys Gln Pro Gln Thr Thr Thr 145 150 155 160 Ala Asn Gly Gln Ala Asp Asp Val Ala Val Thr Thr Glu Glu Arg Arg 165 170 175 Ser Cys Gly Asp Ser Gly Gly Leu Glu Ser Tyr Glu His Ile Leu Phe 180 185 190 Pro Ser Pro Asp Leu Gly Ile Glu His Leu Leu Ser Ile Gly Lys Phe 195 200 205 Met Glu Thr 210 <210> 2 <211> 636 <212> DNA <213> Arabidopsis thaliana <400> 2 atggtaaaaa aaaaaaagga aaaggagaaa agcaaagaaa tagaggagat ggatagagag 60 atccaaaacg gtgcgtatag tgggagagtg atgactgagg agcagatgga gattctccgt 120 aagcagatcg ccgtttacgc cgttatttgt gaccaactcg tcctcctcca caactccctc 180 tcttcttacc atccactctc atcaggagtg aggccaatgg ttggcggata ctttgatccg 240 atgggggcat cgtcaagttc tcataggata tcgactaggc atcggtggac tccgacttca 300 acacagcttc agatacttga gagcatttac gacgaaggaa gtggaacacc gaatcgacgg 360 aggattagag agatcgcgac ggagctgtct gaacatggac agatcacgga gacaaatgtc 420 tacaattggt ttcaaaaccg gcgagctcgg tccaaacgaa agcagcctca aacgacgaca 480 gctaatggtc aggctgacga tgtggcggtg acaacggagg aaaggaggag ttgtggagat 540 tcagggggat tagagtctta tgagcatata ctcttcccaa gtcctgactt agggattgag 600 catttgttga gtatagggaa atttatggag acttaa 636

Claims

1. Application of the stemness gene WOX14 in controlling plant bud regeneration, characterized in that: The amino acid sequence of the WOX14 protein encoded by the stemness gene WOX14 is shown in SEQ ID NO.1; the controlling of plant bud regeneration is to increase or decrease the bud regeneration ability of the plant in tissue culture; Improve the shoot regeneration ability of plants in tissue culture by enhancing the expression activity of the stemness gene WOX14; The shoot regeneration ability of plants in tissue culture was reduced by inhibiting the expression activity of the stemness gene WOX14.

2. The use according to claim 1, characterized in that: The plant is a plant containing the stemness gene WOX14.

3. The use according to claim 1, characterized in that: The plant is Arabidopsis thaliana.

4. The use according to claim 1, characterized in that: The nucleotide sequence of the stemness gene WOX14 is shown in SEQ ID NO.2.

Images