Non-syndromic congenital tooth agenesis gene mutation sites and their application

Abstract

The present invention discloses a non-syndromic congenital tooth agenesis gene mutation site and its application, which is c.296C>A located on the PAX9 gene. A detection primer based on the gene mutation site can be made into a kit for non-syndromic congenital tooth agenesis mechanism research, screening, auxiliary diagnosis or auxiliary treatment.

Description

Technical Field

[0001] The present invention relates to a congenital tooth agenesis, in particular to a non-syndromic congenital tooth agenesis mutation site and application thereof, belonging to the field of gene technology. Background Art

[0002] Congenital tooth agenesis refers to teeth that fail to develop and form during the formation of tooth germs, which is a numerical abnormality among tooth development abnormalities. The clinical diagnosis is based on the standard of "partial or complete tooth loss during clinical examination, combined with X-rays to confirm the absence of permanent tooth germs, and confirmation that there is no history of tooth extraction in the past". For cases of congenital tooth agenesis, clinically, it is generally divided into individual tooth loss (missing teeth <6), majority tooth loss (missing teeth ≥6) and congenital edentulism according to the number of missing teeth. According to whether there are associated symptoms, congenital tooth agenesis can be divided into non-syndromic (simple) congenital tooth agenesis (referring to congenital tooth loss only, without any other congenital developmental malformations) and syndromic congenital tooth agenesis (referring to congenital tooth agenesis accompanied by developmental abnormalities of other organs). Congenital tooth agenesis can be accompanied by several dental abnormalities, such as too small teeth and conical teeth; and dental abnormalities such as ectopic eruption of teeth, enlarged tooth gaps and retained deciduous teeth are also related to congenital tooth agenesis. Congenital tooth agenesis affects not only the patient's chewing, but also their appearance, pronunciation and even mental health. Therefore, the search for its cause has become a hot topic of concern for many oral clinicians and basic research scholars today.

[0003] So far, more than 150 syndromes and 80 genes are associated with congenital tooth agenesis. However, the mutation detection rate of known pathogenic genes in patients with congenital tooth agenesis is often very low, and there are still many cases at home and abroad where the gene mutation type corresponding to the clinical manifestations has not been found. This suggests that congenital tooth agenesis has obvious genetic heterogeneity, and there may be new pathogenic genes or unknown mutations of known genes that have not been discovered. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the above-mentioned prior art and provide a non-syndromic congenital tooth agenesis gene mutation site and its application.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] 1. The gene mutation site for non-syndromic congenital tooth agenesis is c.296C>A located on the PAX9 gene.

[0007] 2. Use of primers for detecting gene mutation sites in the preparation of a kit for the study of the mechanism of non-syndromic congenital tooth agenesis, screening, auxiliary diagnosis or auxiliary treatment, wherein the gene mutation site is c.296C>A located on the PAX9 gene.

[0008] Preferably, the primers include an upstream primer and a downstream primer, and their nucleotide sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0009] Upstream primer: aggaggtgttcgtgaacggga, as shown in SEQ ID NO.1;

[0010] Downstream primer: aggctggggtacgagtaga, as shown in SEQ ID NO.2.

[0011] 3. A kit for the study, screening, auxiliary diagnosis or auxiliary treatment of the mechanism of non-syndromic congenital tooth agenesis, which comprises primers for detecting gene mutation sites, wherein the gene mutation site is c.296C>A located on the PAX9 gene.

[0012] 4. A method for screening gene mutation sites for non-syndromic congenital tooth agenesis, the specific steps are as follows:

[0013] (1) Collect pedigrees with a family history of non-syndromic congenital tooth agenesis, identify patients with non-syndromic congenital tooth agenesis in the pedigree through family investigation and clinical data collection, and then identify the proband;

[0014] (2) Extract genomic DNA and perform whole exome sequencing on the proband;

[0015] (3) Screening the raw data of whole exome sequencing according to the screening strategy in Table 1;

[0016] Table 1. Whole exome sequencing raw data screening strategy

[0017]

[0018] (4) Among the candidate genes screened, the correlation with non-syndromic congenital tooth agenesis was predicted based on Provean and SIFT, Mutation Taster and Polyphen-2 websites. Analysis determined that the PAX9 gene c.296C>A mutation was the mutation site that caused non-syndromic congenital tooth agenesis.

[0019] Beneficial effects of the present invention:

[0020] The applicant previously found a new mutation (c.296C>A on the PAX9 gene) that has never been reported to be associated with non-syndromic congenital tooth agenesis through whole exome sequencing and family co-segregation. The relationship between this mutation and congenital tooth agenesis is still unclear, and no relevant functional studies have been found. The applicant confirmed through a series of in vitro functional experiments that this mutation is an important cause of congenital tooth agenesis, expanding the spectrum of pathogenic genes of the disease, providing a basis for genetic counseling, prevention and gene therapy of non-syndromic congenital tooth agenesis, and also providing a theoretical basis for screening a large range of congenital tooth agenesis population. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a pedigree chart of non-syndromic dominant congenital tooth agenesis;

[0022] Figure 2 It is a panoramic film of the patients in the family. A. IV-1 panoramic film of the proband. B. II-1 panoramic film. C. III-2 panoramic film. D. IV-2 panoramic film (white five-pointed stars represent the position of congenital missing teeth, and blue five-pointed stars represent the position of missing teeth due to trauma or extraction history);

[0023] Figure 3 is the result of Sanger sequencing (arrows represent the base positions of mutations);

[0024] Figure 4 is the PAX9-empty plasmid map;

[0025] Figure 5 is the PAX9-MUT plasmid map;

[0026] Figure 6 is the pGL3-Basic-BMP4P plasmid map;

[0027] Figure 7 is the fluorescence image of the cell localization experiment (the experiment was repeated 3 times);

[0028] Figure 8 It is the protein degradation rate of cycloheximide tracing experiment (the experiment was repeated 3 times); A. Western Blot strip chart B. Data statistical line chart (*: P<0.05);

[0029] Fig. 9 These are the results of a dual luciferase reporter experiment (the experiment was repeated three times); (MOCK is the empty vector group; WT is the normal PAX9; MUT is the mutant PAX9; *: P<0.05). DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with the accompanying drawings and embodiments. It should be noted that the following description is only for explaining the present invention and does not limit its contents.

[0031] 1. Family investigation and clinical data collection

[0032] Oral examinations were performed on children who visited the Department of Pediatric Dentistry of Xiangya Hospital of Stomatology, Central South University, and pedigrees of non-syndromic congenital tooth agenesis with a family history of genetic disease were collected and informed consent was signed.

[0033] (1) Fill in the relevant questionnaire.

[0034] (2) Interview: Collect basic information and ask whether the patient has a history of trauma or tooth extraction.

[0035] (3) Specialized examination and general physical examination: record the number of missing teeth, their specific location and abnormally shaped teeth; determine whether there are any developmental abnormalities in other tissues or organs (such as hair, skin mucosa, bones and nails).

[0036] (4) Panoramic X-ray examination: to determine whether the inherited permanent tooth germs are missing.

[0037] (5) Collect photographic information of the proband and other edentulous patients: take photographs of the face, limbs, and oral cavity.

[0038] The above information was combined to determine the clinical phenotype characteristics of this family (all third molar losses were not included in the missing teeth record).

[0039] Results: The family had four generations and 12 members in total. Through family investigation and clinical data collection, it was determined that there were 4 patients with non-syndromic congenital agenesis in the family: the proband (IV-1) (12, 15, 16, 17, 21, 22, 25, 26, 27, 33, 37, 47 teeth missing), the proband's grandfather (II-1) (12, 15, 21, 32, 41 teeth missing, 21, 41 teeth with a history of trauma), the proband's mother (III-2) (17, 26, 27 teeth missing, 26 teeth with a history of tooth extraction) and the proband's sister (IV-2) (17, 16, 13, 12, 27, 37, 47 teeth). The pedigree chart is shown in Figure 1 , panoramic film see Figure 2 .

[0040] 2. Screening and identification of family pathogenic genes

[0041] 2.1 Extraction of genomic DNA

[0042] (1) Take 4 ml of peripheral blood and add 40 ml of 1× red blood cell lysis buffer and mix well.

[0043] (2) Centrifuge at 4°C, 3000 rpm for 10 min, discard the supernatant, add 3 ml 1× nuclear lysis buffer, 25 μl proteinase K, and 300 μl 20% SDS (sodium dodecyl sulfate) aqueous solution, shake and mix. Digest at 37°C overnight.

[0044] (3) Add 6 ml of saturated phenol to the digestion solution, mix well, centrifuge at 4°C, 3000 rpm for 10 min, take the supernatant, add chloroform and saturated phenol (3 ml each), mix well by inversion, centrifuge at 4°C, 3000 rpm for 10 min, take the supernatant, add 6 ml of chloroform, mix well by inversion, centrifuge at 4°C, 3000 rpm for 10 min, take the supernatant, add 10 ml of anhydrous ethanol, mix well by inversion, and white floccules can be seen. Use a flat-headed, large-diameter large-tip head to suck out the white floccules and collect them in a 1.5 ml EP tube. Some of them are stored in a -20°C refrigerator, and some are used to dissolve DNA.

[0045] (4) Centrifuge at 13,000 rpm for 20 min at room temperature, remove the supernatant, add 400 μl of 75% ethanol, slowly invert upside down to mix, and centrifuge at 13,000 rpm for 5 min.

[0046] (5) Remove the supernatant, add 200 μl of 75% ethanol, mix by inversion, and centrifuge at 4°C, 3000 rpm for 10 min.

[0047] (6) Take the supernatant, open the lid and dry it at room temperature for 5 min. The white flocs will turn transparent, indicating that DNA has been obtained.

[0048] (7) Add 30 μl of EB and dissolve at room temperature overnight.

[0049] (8) Mix well by pipetting and centrifuge, measure OD value by ultraviolet light, and check DNA quality and concentration (A260 / A280 ratio should be between 1.8 and 2.0).

[0050] 2.2 Whole exome sequencing

[0051] The whole exome sequencing of proband IV-1 was performed by The Berry Genomics Co., Ltd. (Beijing, China). The steps included testing DNA samples; building a capture library; library testing; and sequencing.

[0052] 2.3 Bioinformatics analysis

[0053] The next step of screening for the original WES results is as follows (Table 1):

[0054] Table 1. Whole exome raw data screening strategy

[0055]

[0056]

[0057] Among the candidate genes screened out, the correlation with non-syndromic congenital tooth agenesis was predicted based on Provean and SIFT, Mutation Taster and Polyphen-2 websites. Analysis showed that the c.296C>A mutation in the PAX9 gene was an important mutation site that might cause non-syndromic congenital tooth agenesis in this family.

[0058] 2.4 Sanger sequencing

[0059] Specific primers were designed for the selected candidate genes, PCR amplified the DNA of all family members, and then Sanger sequencing was performed, and finally the family co-segregation was performed to confirm the mutant gene and mutation site of the family. The nucleotide sequence and number of PAX9 were from GenBank (accession number: NC_000014.9, nucleotide number: NM_006194). PrimerPremier 5.0 was used to design candidate gene primers, amplify the coding region, and verify the primers using Primer BLAST (primer sequences are shown in Table 2).

[0060] Table 2. Sequencing primer sequences at mutation sites

[0061]

[0062] PCR amplification conditions: pre-denaturation: 95℃, 3min; denaturation: 95℃, 15s; annealing: 60℃, 15s; extension: 72℃, 30s; repair extension: 72℃, 5min; reaction termination: 4℃, hold.

[0063] After PCR amplification, the PCR products were separated by 1% agarose gel electrophoresis, and the target PCR band was cut and recovered; the sequencing products were purified and electrophoresed, and the corresponding PCR products were sent to Shanghai Biosune Company for Sanger sequencing, and the results were analyzed by sequence analysis. The genotyping results, such as Figure 3 As shown, all patients with non-syndromic congenital tooth agenesis had heterozygous mutations, while normal controls had no mutations found at this site. Therefore, according to the design scheme of the present invention, it can be successfully confirmed in this example that the c.296C>A mutation on the third exon of the PAX9 gene detected by whole genome exon sequencing may be a new pathogenic site for non-syndromic congenital tooth agenesis, and heterozygosity can cause disease. It can be seen that the PAX9 mutant gene provided by the present invention can be used for non-syndromic congenital tooth agenesis mechanism research, screening, auxiliary diagnosis and / or treatment.

[0064] 3. Functional study of pathogenic gene mutation sites

[0065] 3.1 Construction of PAX9-empty, PAX9-WT, pGL3-BMP4, and pRL-TK plasmids

[0066] (1) Construction of PAX9-WT / MUT / empty plasmids

[0067] OBIO TECHNOLO (SHANGHAI) was commissioned to synthesize the full-length cDNA sequence of PAX9 (NM_006194.3) and cloned into the PAX9-empty plasmid ( Figure 4 ) to obtain PAX9-WT plasmid. Primer Star (Vazyme) kit was used for site-directed mutagenesis to obtain mutant PAX9-MUT plasmid ( Figure 5 ), the site-directed mutagenesis primer sequences are shown in Table 3:

[0068] Table 3 Site-directed mutagenesis primer sequences

[0069]

[0070]

[0071] (2) Construction of plasmids related to dual luciferase reporter assay

[0072] HonorGene (CHANGSHA) was commissioned to synthesize pGL3-Basic (product number: HG-VQP0121) and internal reference pRL-TK plasmid (product number: HG-VQP0126), and then the BMP4 promoter sequence (NM_001202) (about 2kb) was cloned into pGL3-Basic to obtain the BMP4-related promoter reporter plasmid pGL3-Basic-BMP4p. The more effective sequence of the BMP4 promoter (about 400bp) was selected to reconstruct the BMP4-related promoter reporter plasmid (referred to as pGL3-Basic-BMP400). The pGL3-Basic-BMP4P plasmid map is shown in Figure 6 .

[0073] 3.2 Expression of eukaryotic expression plasmids

[0074] COS-7 cells (passage 4) were selected for the first cell passage, followed by conventional cell passage, cell freezing, cell recovery, mixing with Lipo-3000 and plasmids, incubating at room temperature, and culturing.

[0075] 3.3 Mutant protein cellular localization experiment

[0076] This experiment was divided into three groups: WT group, MUT group and control group. PAX9-MUT, PAX9-WT and PAX9-empty plasmids were transfected into COS-7 cells respectively. After 48 hours of transfection, DAPI staining was performed and the relative position of the protein and the cell nucleus was observed by Leica fluorescence microscope. The results showed that both PAX9-WT and PAX9-MUT proteins were localized in the nucleus, and the localization of PAX9-MUT in the cell did not change ( Figure 7 ).

[0077] 3.4 Cycloheximide tracing experiment

[0078] The stability of PAX9-MUT protein and PAX9-WT protein in cells was further compared by cycloheximide tracing experiment. The two groups of plasmids PAX9-MUT and PAX9-WT were transfected into COS-7 cells, respectively. Cycloheximide (CHX) reagent (working concentration 20 mg / ml) was added 24 hours after transfection, and then the protein was extracted at 0h, 2h, 4h, 8h, 12h and 24h. The results showed that after inhibiting protein synthesis, PAX9-MUT protein began to show obvious degradation at the 4th hour, and the overall degradation rate was significantly faster than that of PAX9-WT group. The protein had been degraded to 50% around the 9th hour; PAX9-WT protein began to show obvious degradation at the 12th hour after CHX treatment (p<0.05), and the protein was not degraded to the original 50% at 24h after treatment ( Figure 8 ).

[0079] 3.5 Dual luciferase reporter assay

[0080] This experiment was designed to investigate the effect of PAX9 on the activation of the downstream target gene BMP4 promoter. The promoter region about 400 bp upstream of BMP4 was selected, and the PAX9 reporter plasmid (pGL3-Basic-BMP400) was successfully constructed.

[0081] The steps of this experiment are as follows:

[0082] (1) Take COS-7 cells (purchased from BNCC Biotechnology Co., Ltd.) with good growth conditions and inoculate;

[0083] (2) The experiment was divided into three groups: WT group, MUT group, and control group (MOCK group). Each group was co-transfected with three plasmids, and the total amount of plasmid in each well was 1 μg;

[0084] (3) 1 h before transfection, the culture medium was changed to DMEM and transfected with Lip-2000 transfection reagent, and 6 h later, it was changed to 10% complete culture medium;

[0085] (4) After 24 h, place the 24-well plate on ice, discard the culture medium, wash three times with pre-cooled PBS, add 1x PBL to each well (100 μl per well of the 24-well plate), and shake on a shaker at room temperature for 5 min;

[0086] (5) Use the tip of a pipette to thoroughly blow the lysed cells and collect them into a 1.5 ml EP tube. Centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to a new EP tube.

[0087] (6) Set the parameters of the single-tube chemiluminescence spectrometer, select the "DUALMEAS" mode, "Delay time" 2s, and "Measurement" 10s.

[0088] (7) Prepare LARII (freeze at -80°C after preparation) and Stop&Glo working solution (store at -20°C, fresh preparation required) according to the instructions. Add 50μl LARII (purchased from Promega, luciferase detection reagent) to a new 1.5ml EP tube, then add 10μl cell lysate (try to take the supernatant), mix and read the firefly fluorescence value; continue to quickly add 50μl Stop&Glo and read the sea cucumber fluorescence value. The final fluorescence value of each well is the firefly fluorescence / sea cucumber fluorescence value.

[0089] The results showed that after PAX9 mutation, the ability of PAX9 to activate the BMP4 promoter decreased, and the activity of BMP4 transcription decreased, and the results were statistically significant (p < 0.05) ( Fig. 9 ).

[0090] Although the above describes the specific implementation mode of the present invention in conjunction with the accompanying drawings, it is not intended to limit the scope of protection of the present invention. Based on the technical solution of the present invention, various modifications or variations that can be made by those skilled in the art without creative work are still within the scope of protection of the present invention.

Claims

1. Use of primers for detecting gene mutation sites in the preparation of a non-syndromic congenital tooth agenesis screening or auxiliary diagnosis kit, characterized in that: The gene mutation site is located at PAX9 c.296C>A on the gene.

Images