A del molecular marker, primer pair and application related to chilling requirement trait of peach
By developing DEL molecular markers and primer pairs related to the chilling requirement of peaches, and using PCR amplification and gel electrophoresis detection, the problem of identifying low chilling requirement peach varieties in existing technologies has been solved, achieving efficient breeding identification and selection, and improving breeding efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
- Filing Date
- 2022-08-10
- Publication Date
- 2026-04-24
AI Technical Summary
Existing technologies make it difficult to efficiently identify and select peach varieties with low chilling requirements. Conventional breeding is inefficient and time-consuming, resulting in uneven flowering, elongated shape, and reduced marketability of peach fruits.
We developed DEL molecular markers and primer pairs related to the chilling requirement trait of peaches, and identified the chilling requirement trait of peaches by PCR amplification and agarose gel electrophoresis.
This study enabled accurate identification of chilling requirements in peaches, provided molecular marker-assisted selection for low chilling requirement varieties, and improved breeding efficiency and accuracy.
Smart Images

Figure CN115992281B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a DEL molecular marker, primer pair, and application related to the chilling requirement trait of peaches, and belongs to the field of biotechnology. Background Technology
[0002] Peaches are an important fruit tree species in my country, ranking first in the world in terms of both cultivation area and yield. As a seasonal fruit, extending the supply period of fresh peaches is one of the goals of the modern peach industry. Among these, early-maturing cultivation in northern greenhouses and open-field cultivation in low-latitude and low-altitude areas in the south are effective ways to advance the fruit ripening period. The application of low-chillation-requirement varieties plays a decisive role in this process.
[0003] Chilling requirement (CR) refers to the effective amount of low temperature accumulation required to break the natural winter dormancy of deciduous fruit trees. Peach is one of the deciduous fruit species with the most stringent chilling requirements. Insufficient chilling can lead to uneven flowering, elongated fruit shape, reduced marketability, and even prevent normal flowering and fruiting, resulting in yield loss. Developing low-chilling-requirement varieties is one of the important breeding goals for peaches. However, conventional breeding methods are inefficient and time-consuming, making breakthroughs in the selection of such varieties difficult. Therefore, identifying the key genes controlling chilling requirement in peaches and their regulatory mechanisms is of significant practical importance for the practical application of low-chilling-requirement molecular breeding of peaches.
[0004] GWAS (Genome-wide analysis study), as an analytical method linking phenotype and genotype, has played a crucial role in the mapping of key genes controlling major agronomic traits in horticultural crops (peach, apple, cherry, pear, plum, and jujube). China, the origin center of peaches, has developed numerous local and improved varieties through artificial selection and differentiation during long-term breeding and introduction, resulting in rich varietal resource diversity that can serve as a natural population for GWAS analysis. Furthermore, during intense natural selection and domestication, key peach traits (chillation requirement, weight, polysaccharide content, low acidity, and hairlessness) have been selected for, thus GWAS provides a powerful tool for identifying genes related to important peach traits. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the purpose of this invention is to provide a DEL molecular marker, primer pair, and application related to the chilling requirement trait of peaches, which can accurately identify the chilling requirement trait of peaches.
[0006] To achieve the above objectives, one of the technical solutions of the present invention is as follows:
[0007] A DEL molecular marker associated with the chilling requirement trait of peaches, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0008] One of the technical solutions of the present invention is: a primer pair for amplifying the DEL molecular marker, wherein the upstream and downstream primers in the primer pair are designed based on the upstream and downstream sequences of the insertion / deletion site.
[0009] Furthermore, the sequence of the upstream primer in the primer pair is shown in SEQ ID NO.2, and the sequence of the downstream primer is shown in SEQ ID NO.3.
[0010] One of the technical solutions of the present invention is the application of the DEL molecular marker and the primer pair in marker-assisted selection breeding of peaches with high, medium and low chilling requirements.
[0011] One of the technical solutions of the present invention is: a method for identifying the chilling requirement trait of peaches, comprising the following steps:
[0012] (1) DNA extraction: Collect leaves of peaches to be tested and extract genomic DNA as a template for PCR amplification;
[0013] (2) PCR amplification: Using the extracted DNA as a template, PCR amplification was performed using the primer pairs to obtain the corresponding PCR amplification products;
[0014] (3) Genotype identification: The PCR amplification products were detected by agarose gel electrophoresis, and the chilling requirement of peaches was identified based on the detection results.
[0015] Furthermore, the PCR amplification system consisted of: 3 μL 200 ng / μL DNA template, 30 μL 2×Taq Master mix, and 2 μL 10 μmol·L⁻¹. -1 Upstream primer, 2 μL 10 μmol·L -1 Downstream primer, 13 μL ddH2O.
[0016] Furthermore, the PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 15 s, 35 cycles; and a final extension at 72℃ for 5 min.
[0017] Furthermore, the identification method is as follows: if the PCR amplification product contains a 150 bp band, the peach to be tested is a medium to high chilling requirement variety; if the PCR amplification product contains a 120 bp band, the peach to be tested is a low chilling requirement variety.
[0018] The beneficial effects of this invention are:
[0019] This invention selected 550 natural peach accessions with different chilling requirements for whole-genome resequencing, followed by genotyping and data quality control. Loci with deletion rates exceeding 20% and allele frequencies less than 5% were removed. LD decay was used to assess marker density, and population structure was predicted to facilitate the selection of an appropriate association analysis model. Finally, association analysis was performed. A 30 bp deletion variant closely linked to chilling requirement was identified, located at 1143 bp upstream of the President.1G531700 promoter in the DAM gene cluster.
[0020] This invention verified the relationship between this variation and chilling requirement in 88 different chilling-requirement peach varieties. The results showed that the genotypes of medium and high chilling-requirement (≥400 h) varieties did not contain the 30 bp deletion, while the genotypes of low chilling-requirement (<400 h) varieties all contained the 30 bp deletion, with an accuracy rate of 100%. This indicates that the 30 bp deletion is significantly associated with the chilling requirement trait, and this variation can be accurately used as a molecular marker for the identification of chilling requirement traits in peaches. Attached Figure Description
[0021] Figure 1 This section shows the localization and analysis of key genes related to chilling requirements. In section a, a is a Manhattan plot of the GWAS results for chilling requirements in 550 peach samples. The dashed line indicates a significance threshold of 0.05. Section b shows the location of the candidate gene promoter variant regions (InDel). Orange represents exons, blue represents UTRs, and the black lines between orange sections represent introns. Sections c and d show the LD block (15.8 kb), the most significant signal localization region in GWAS, and related genes. In section d, different colors indicate differences in linkage levels: red indicates high linkage, yellow indicates low linkage, and black triangles represent LD blocks.
[0022] Figure 2 This is a diagram showing the relationship between genotype and phenotype. Genotypes containing a 30 bp deletion are low chilling requirement phenotypes, while those without are medium or high chilling requirement phenotypes.
[0023] Figure 3 This study analyzed promoter sequencing data for peach varieties with low, medium, and high chilling requirements.
[0024] Figure 4 This is for promoter activity analysis. Negative control: negative control; 30 bp DEL: 30 bp deletion; Non-DEL: no 30 bp deletion; positive control: positive control.
[0025] Figure 5 The results are validated using a 30 bp molecular marker in 88 peach varieties with different chilling requirements. Detailed Implementation
[0026] The specific embodiments of the present invention will be further described in detail below with reference to examples.
[0027] Example 1: Obtaining DEL
[0028] In the early stages, through material selection and trait survey analysis, 550 natural populations of peaches with different chilling requirements were selected for whole-genome resequencing. Subsequently, genotyping and data quality control were carried out, removing loci with a deletion rate of more than 20% and loci with a minor allele frequency (MAF) of less than 5%. LD decay assessment was used to evaluate the marker density, and population structure was predicted to facilitate the selection of an appropriate association analysis model. Finally, association analysis was performed. Genome-wide association analysis (GWAS) was performed on the 208,803 structural variations (SVs). The GWAS analysis utilized three different models: MLM, CMLM, and FarmCPU. Ultimately, a major QTL was identified in the located region on chromosome 1 (Chr. 1). This QTL region was only 15.8 kb in length, containing only the complete gene `Prupe.1G531700`. Furthermore, a 30 bp deletion variant (DEL) closely linked to chilling requirements was identified, located 1143 bp upstream of the `Prupe.1G531700` promoter in the DAM gene cluster. Figure 1 This invention, through statistical analysis of sequencing data, found that medium- and high-chillation-requirement germplasm genotypes do not contain this 30 bp deletion (≥400 h), while low-chillation-requirement (<400 h) germplasm genotypes do contain the 30 bp deletion. Figure 2 Its nucleotide sequence is: AAAGTTTACTCTCCTTATAACTAAAT AAAT (SEQ ID NO.1).
[0029] Subsequently, this invention selected 10 young leaves from peach germplasms with different chilling requirements, and extracted genomic DNA using the QIAGEN DNeasy plantmini kit. The extracted DNA samples were then analyzed by agarose gel electrophoresis and their OD values were measured using a UV spectrophotometer. 260 / 280 The absorbance value.
[0030] Amplification of a 30 bp differential fragment:
[0031] Using the aforementioned 10 peach DNA samples with low, medium, and high refrigeration requirements as templates, a promoter fragment containing a 30 bp gene was amplified. The amplification primers used were:
[0032] F (upstream primer): 5'- GACCATGATTACGCCAAGCTTCGTCATCGTTATTGCATAGTATGGC-3' (SEQ ID NO.2)
[0033] R (downstream primer): 5'- GGACTGACCACCCGGGGATCCGGTCCCCAGATCTAAATGAAC -3' (SEQ ID NO.3)
[0034] PCR amplification was performed using a 50 μL reaction system, including 3 μL DNA template (200 ng / μL), 30 μL 2×TaqMaster mix, and 2 μL 10 μmol·L⁻¹. -1 Upstream primer, 2 μL 10 μmol·L -1 Downstream primer, 13 μL ddH2O.
[0035] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 15 s, 35 cycles; and a final extension at 72℃ for 5 min.
[0036] Under 120 V conditions, PCR amplification products were subjected to agarose gel electrophoresis (3% concentration). For peach varieties with medium to high chilling requirements, the PCR amplification product contained a 150 bp band; for varieties with low chilling requirements, the PCR amplification product contained a 120 bp band. The correctly sized bands were excised and then purified using a QIAGEN gel purification kit (Qiagen, Valencia, CA). Subsequently, Sanger sequencing was performed on the purified DNA from 10 varieties with medium, high, and low chilling requirements. Comparative analysis confirmed that the 30 bp deletion only existed in low chilling requirement (<400 h) varieties and was absent in medium and high chilling requirement (≥400 h) varieties. Figure 3 ).
[0037] Example 2: Verification of DEL
[0038] To further verify the effect of this mutation on promoter activity, the pBI121-GUS vector was double-digested with HindIII and BamHI. Different genotype DNA fragments amplified in Example 1 were then homologously recombinated with the pBI121-GUS vector and transformed into *E. coli* DH5α. The specific transformation steps were as follows: 5 μL of the homologous recombination plasmid sample was added to 50 μL of *E. coli* DH5α competent cells, followed by incubation on ice for 30 min, heat shock at 42°C for 60 s, and another 2 min on ice. Finally, 500 μL of LB broth was added, and the cells were shaken at 42°C for 1 h. 60 μL of the transformation product was then plated on a plate containing kanamycin resistance to screen transformants, and colony PCR was performed for verification. Positive clones were sequenced. Sequencing verification confirmed that correctly matched *E. coli* bacteria were cultured in amplified culture, plasmids were extracted, and Agrobacterium GV3101 competent cells were transformed. The specific transformation steps were as follows: 3 μL of the extracted *E. coli* plasmid was added to 50 μL of Agrobacterium GV3101 competent cells, followed by sequential ice bath for 5 min, liquid nitrogen flash freezing for 5 min, 37℃ water bath for 5 min, and finally ice bath for 5 min. Transformants were then screened on plates containing kanamycin and rifampicin resistance. Subsequently, transient transformation with Agrobacterium was performed on tobacco leaves at the 4-6 leaf stage. The detailed steps of transient transformation were as follows: First, Agrobacterium was shaken to OD... 600 When the concentration reaches 0.7, centrifuge to remove the supernatant, and dilute the Agrobacterium cells with the prepared transient transformation infection solution (10 mM MgCl2, 10 mM (2-(N-morpholino)ethanesulfonic acid), 100 μM acetylsuccinone) to OD200. 600 =0.7, after standing for 2 h at room temperature in the dark, the sample was injected into young tobacco leaves. Two days later, the injected tobacco leaves were stained with GUS. A negative control (no promoter activity) and a positive control (with strong 35S promoter activity) were also set up, and GUS staining was performed to observe the results. Final analysis showed that the deletion of 30 bp significantly reduced promoter activity. Figure 4 ).
[0039] To further verify the relationship between this variation and chilling requirement through experiments, this invention verified the relationship between this variation and chilling requirement in 88 peach varieties with different chilling requirements (Table 1), using the same method as in Example 1. The results showed that the genotypes of medium and high chilling requirements (≥400 h) did not contain a 30 bp deletion, while the genotypes of low chilling requirements (<400 h) all contained a 30 bp deletion, achieving a 100% accuracy rate. Figure 5 This indicates that the 30 bp deletion is significantly correlated with the level of chilling requirement, and the 30 bp variation can be developed into a molecular marker. The development of this molecular marker lays an important genetic foundation for identifying peach germplasm with different chilling requirements.
[0040] Table 1: 88 peach varieties with different chilling requirements
[0041]
[0042]
Claims
1. A DEL molecular marker associated with the chilling requirement trait of peaches, characterized in that, The nucleotide sequence of the DEL molecular marker is shown in SEQ ID NO.
1.
2. An application of primer pairs for amplifying the DEL molecular marker of claim 1 in marker-assisted selection breeding of peaches with high or low chilling requirements.
3. A method for identifying the chilling requirement trait of peaches using primer pairs amplifying the DEL molecular marker described in claim 1, characterized in that, Includes the following steps: (1) DNA extraction: Collect leaves of peaches to be tested and extract genomic DNA as a template for PCR amplification; (2) PCR amplification: Using the extracted DNA as a template, PCR amplification was performed using primer pairs to obtain the corresponding PCR amplification products; (3) Genotype identification: The PCR amplification products were detected by agarose gel electrophoresis, and the chilling requirement of peaches was identified based on the detection results. The identification method was as follows: the genotypes of medium and high chilling requirement varieties did not contain the deletion of the 30bp DEL molecular marker, while the genotypes of low chilling requirement varieties all contained the deletion of the 30bp DEL molecular marker.