A drug containing a compound that inhibits endonuclease function and its anti-tumor use

Abstract

The present invention discloses an inhibitory drug and SSA enhancer for ENDOD1 endonuclease, and uses of the inhibitory drug and SSA enhancer for ENDOD1 endonuclease in manufacturing drugs for treating or preventing human tumors and hepatitis B virus infection diseases. The endonuclease is an endonuclease encoded by the ENDOD1 gene, the inhibitory drug inhibits the gene expression, activity and / or function of the ENDOD1 endonuclease, and the SSA enhancer upregulates the activity or function of single-stranded DNA fusion repair (SSA). The ENDOD1 endonuclease inhibitory drug or SSA enhancer can effectively inhibit or kill tumor cells with DNA homologous recombination, DNA damage response, DNA damage repair, gene mutations of tumor suppressor genes, gene expression or functional defects, and has no toxicity to non-tumor cells with normal genes or functions.

Description

[0001] This application is a divisional application of the invention application with application number CN202010295776.6, application date 2020.04.15, publication number CN111671904A, and publication date 2020.09.18. Technical Field

[0002] The invention belongs to the field of medicine, and specifically relates to the use of inhibiting the function of ENDOD1 endonuclease in preparing medicine for treating or preventing human tumors. Background Art

[0003] Malignant tumors are highly resistant to chemical drugs and are prone to drug resistance. It is difficult to temporarily control tumor growth and prolong patient survival. Therefore, the clinical demand for developing a new generation of tumor targeted therapy is particularly urgent. The key is to find drugs that can effectively kill tumor cells but cause relatively little damage to normal non-tumor cells. One of the drug development strategies to achieve this goal is synthetic lethality, which is to find specific defects in tumor cells and determine that destroying another cell function under this defective state will lead to the death of tumor cells (see: O'Neil, NJ, ML Bailey, and P. Hieter, Synthetic lethality and cancer. Nat Rev Genet, 2017. 18 (10): p. 613-623.).

[0004] The genome of normal cells is threatened by DNA damage factors at any time, leading to mutations in oncogenes and tumor suppressor genes and uncontrolled cell proliferation, which promotes tumorigenesis. In this process, DNA damage response and DNA repair mechanisms play a key role in inhibiting tumor-related genome mutations, eliminating cells with abnormal genome structure or replication defects, and ensuring genome stability and non-cancerous tissues and organs (see: Jeggo, PA, LH Pearl, and AM Carr, DNA repair, genomestability and cancer: a historical perspective. Nat Rev Cancer, 2016. 16 (1): p. 35-42.). Common tumor suppressor genes include PTEN, CDKN2A, TP53, APC, VHL, p16INK4A, p14ARF, LKB1, FBXW7, NF1, NF2 and WT-1, whose mutations lead to the occurrence of glioma, neurofibroma, lung cancer, gastric cancer, liver cancer, melanoma, colorectal cancer, nasopharyngeal carcinoma, renal cancer and lymphoma (see: Wang, LH, et al., Loss of Tumor Suppressor Gene Function in Human Cancer: An Overview. Cell Physiol Biochem, 2018. 51(6): p. 2647-2693.). In particular, mutations in the TP53 gene are widely present in 50-80% of tumors and can be destroyed by viral factors such as human papillomavirus (HPV) and hepatitis B virus (HBV) (see: Aubrey, BJ, A. Strasser, and G. L. Kelly, Tumor-Suppressor Functions of the TP53 Pathway. Cold Spring Harb Perspect Med, 2016. 6(5).).

[0005] In human cells, DNA damage response is mainly regulated by ATM and ATR kinases, which activate CHK1 and CHK2 through signal transduction pathways such as γH2AX, 53BP1, MDC1 and CDC25, control cell cycle progression, and promote the activation of DNA damage repair mechanisms. Known DNA damage repair mechanisms include non-identical end joining (NHEJ), homologous recombination repair (HR), single-strand DNA fusion (SSA), nucleotide excision repair (NER), base excision repair (BER), single-strand DNA break repair (SSR), etc. (See: Chatterjee, N. and GC Walker, Mechanisms of DNA damage, repair, and mutagenesis. Environ Mol Mutagen, 2017. 58 (5): p. 235-263.). Inactivation of these mechanisms leads to the occurrence of skin cancer, breast cancer, ovarian cancer, liver cancer, cholangiocarcinoma, colorectal cancer, prostate cancer and leukemia.

[0006] During cell proliferation, DNA replication generates a large amount of DNA damage, which can easily lead to gene mutations. These damages are mainly eliminated by repair mechanisms that rely on homologous sequences, such as HR and SSA. HR is mainly regulated by factors such as BRCA1, BRCA2, MRE11, NBS1, BLM, 53BP1, RAD51, RPA, WDR70 and Fanconi (FANC), while SSA depends on related repair factors such as RAD52, MRE11, RAD54B and RPA (see: Haber, JE, DNA Repair: The Search for Homology. Bioessays, 2018. 40(5): p.e1700229.).

[0007] The SSA mechanism is extremely conservative during evolution, and mainly occurs in homologous sequences near DNA breakpoints. The process relies on repair factors such as RAD52 to bind to DNA breakpoints to form nucleoprotein complex synapses, invade and fuse homologous sequences near DNA breakpoints. RAD52 is a key molecule in the SSA pathway, which can directly bind to the ends of processed DNA breaks, especially single-stranded DNA products, protect processed DNA from nuclease degradation, and promote the fusion of homologous sequences on single-stranded DNA (see: Wu, Y., et al., The DNA binding preference of RAD52 and RAD59 proteins: implications for RAD52 and RAD59 protein function in homologous recombination. J Biol Chem, 2006. 281 (52): p. 40001-9.). RAD52 can also promote interchain exchange in the late stage of homologous recombination repair. RAD52 can also bind to the single-stranded DNA formed by the replication fork block, maintain the stability of the replication fork, prevent the newly replicated DNA chain from being degraded, and play an important role in the stability of DNA during replication (see: Malacaria, E., et al., Rad52 prevents excessive replication fork reversal and protects from nascent strand degradation. Nat Commun, 2019.10(1): p.1412.). Because it may cause the loss of homologous sequences, SSA is considered to be a low-fidelity or even toxic repair method. Therefore, the disorder of SSA pathway regulation may lead to defects in DNA response and damage repair, resulting in genomic instability. Summary of the invention

[0008] The purpose of the present invention is to provide an ENDOD1 endonuclease inhibitory drug or an SSA enhancer and its use in the preparation of a drug for preventing or treating tumors, especially for treating tumors with DNA homologous recombination defects, DNA damage response defects, DNA repair defects, gene mutations of tumor suppressor genes such as TP53, gene expression or functional defects.

[0009] The ENDOD1 nuclease of the present invention serves as a new broad-spectrum anti-tumor drug target. The nuclease is a protein encoded by the ENDOD1 gene, wherein the mRNA sequence of the ENDOD1 is SEQ ID No. 1 (corresponding NCBI reference number NM_015036.3), and the encoded amino acid sequence of the protein is the sequence corresponding to NCBI accession number NP_055851.1.

[0010] The ENDOD1 endonuclease inhibitory drug herein may also be referred to as an ENDOD1 endonuclease inhibitor.

[0011] In one embodiment, the present invention provides a method for treating or preventing tumors, comprising administering an effective amount of an ENDOD1 endonuclease inhibitory drug or an SSA enhancer to a tumor patient, wherein the inhibitory drug inhibits the function of the ENDOD1 endonuclease, wherein the endonuclease is an endonuclease encoded by an ENDOD1 endonuclease gene. The SSA enhancer can improve the function of single strand DNA fusion repair (single strand annealing, SSA).

[0012] In the above-mentioned treatment method of the present invention, the tumor contains DNA homologous recombination defects, DNA damage response defects, DNA repair defects, gene mutations, gene expression or functional defects of tumor suppressor genes such as TP53, and specifically includes lung cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, ovarian cancer, cervical cancer, lymphoma, leukemia, prostate cancer, melanoma, endometrial cancer, neuroblastoma, glioma, sarcoma or / and cholangiocarcinoma.

[0013] In the above-mentioned treatment method of the present invention, the ENDOD1 endonuclease inhibitory drug or SSA enhancer can be any substance that has an inhibitory effect on ENDOD1 endonuclease, and the SSA enhancer can be any substance that improves single-stranded DNA fusion repair (SSA), specifically including but not limited to antibodies, organic compounds or natural compounds, small nucleic acids, small ribonucleic acids, proteins, polypeptides, antisense acids and inorganic substances.

[0014] The above-mentioned treatment method of the present invention further includes the use in combination with one or more other anti-tumor treatment methods or the use of the combination. The one or more other anti-tumor treatment methods include surgery, radiotherapy, chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, targeted therapy, adjuvant therapy and / or immunotherapy.

[0015] In some embodiments, the present invention provides a pharmaceutical composition for treating or preventing tumors, comprising an ENDOD1 endonuclease inhibitory drug or an SSA enhancer, wherein the ENDOD1 inhibitory drug can inhibit the gene expression, activity or function of the ENDOD1 endonuclease, and the endonuclease is an endonuclease encoded by the ENDOD1 endonuclease gene. The SSA enhancer can upregulate the function of single-stranded DNA fusion repair (SSA). The tumor carries a DNA homologous recombination defect, a DNA damage response defect, a DNA repair defect, a gene mutation, a gene expression or a functional defect of tumor suppressor genes such as TP53. Specifically, lung cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, ovarian cancer, cervical cancer, lymphoma, leukemia, prostate cancer, melanoma, endometrial cancer, neuroblastoma, glioma, sarcoma or / and cholangiocarcinoma.

[0016] In the pharmaceutical composition of the present invention, the ENDOD1 endonuclease inhibitory drug can be any substance that has an inhibitory effect on ENDOD1 endonuclease, and the SSA enhancer can be any substance that upregulates the single-stranded DNA fusion repair (SSA) function, specifically including but not limited to drugs selected from antibodies, synthetic organic compounds, natural organic compounds, small nucleic acids, small RNAs, proteins, polypeptides, antisense acids and inorganic substances.

[0017] In some embodiments, the use of the ENDOD1 endonuclease inhibitory drug or SSA enhancer of the present invention in the manufacture of a drug for treating and / or preventing tumors, wherein the ENDOD1 inhibitory drug can inhibit the gene expression, activity or function of the ENDOD1 endonuclease, and the endonuclease is an endonuclease encoded by the ENDOD1 endonuclease gene. The SSA enhancer can upregulate the function of single-stranded DNA fusion repair (SSA).

[0018] In the above-mentioned use of the present invention, the tumor has a DNA homologous recombination defect, a DNA damage response defect, a DNA repair defect, a gene mutation, a gene expression or functional defect of tumor suppressor genes such as TP53. The tumor includes but is not limited to lung cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, ovarian cancer, cervical cancer, lymphoma, leukemia, prostate cancer, melanoma, endometrial cancer, neuroblastoma, glioma, sarcoma or / and cholangiocarcinoma.

[0019] In the above-mentioned use of the present invention, the ENDOD1 nuclease inhibitory drug can be any substance that has an inhibitory effect on the gene expression, activity or function of ENDOD1 nuclease, and the SSA enhancer can be any substance that upregulates the single-stranded DNA fusion repair (SSA) function, specifically including but not limited to antibodies, organic compounds or natural compounds, small nucleic acids, small RNAs, proteins, polypeptides, antisense acids and inorganic substances.

[0020] The use of the present invention further includes combining the ENDOD1 endonuclease inhibitory drug or SSA enhancer with one or more other anti-tumor drugs or radiotherapy or using them as a composite composition.

[0021] In the above-mentioned use of the present invention, the other one or more anti-tumor drugs are selected from chemotherapeutic drugs, polypeptide drugs, antibody drugs, TKI (kinase inhibitors), small nucleic acids and protein drugs. Preferably, the chemotherapeutic drugs are selected from platinum, mitomycin C, camptothecin, PARP inhibitors, DNAPK inhibitors, radioactive isotopes, vinca alkaloids, anti-tumor alkylating drugs, monoclonal antibodies and antimetabolites.

[0022] The above-mentioned use of the present invention, the combination refers to the simultaneous or sequential administration of the ENDOD1 endonuclease inhibitor or SSA enhancer and one or more other anti-tumor drugs.

[0023] In the above-mentioned use of the present invention, the tumors with DNA response defects include tumors with ATM, ATR, CHK1, CHK2, DNAPK gene mutations or functional defects, or tumors with overexpression characteristics of CDC25A, CDC25B, CDC25C, Cyclin E, Cyclin B1, and Cyclin D1.

[0024] In some specific embodiments, a method for treating or preventing tumors of the present invention comprises administering an effective amount of an ENDOD1 endonuclease inhibitory drug or an SSA enhancer to a subject for treatment, wherein the inhibitory drug can inhibit the gene expression, activity or function of the ENDOD1 endonuclease, and the SSA enhancer can upregulate the single-stranded DNA fusion repair (SSA) function, and the tumor carries a gene mutation, gene expression or functional defect of DNA damage repair. Preferably, the DNA damage repair defect includes homologous recombination repair defect, base excision repair defect, nucleotide excision defect, single-stranded DNA break repair defect, and a gene mutation or gene expression and functional defect associated with the repair mechanism. The ENDOD1 endonuclease inhibitory drug is any substance that can inhibit the function of the ENDOD1 endonuclease, and the SSA enhancer can be any substance that upregulates the function of the single-stranded DNA fusion repair (SSA).

[0025] In some specific embodiments, a pharmaceutical composition for treating or preventing tumors of the present invention comprises an ENDOD1 endonuclease inhibitory drug or an SSA enhancer, wherein the ENDOD1 inhibitory drug can inhibit the gene expression, activity or function of the ENDOD1 endonuclease, and the SSA enhancer can upregulate the single-strand DNA fusion repair (SSA) function, and the tumor carries a gene mutation, gene expression or functional defect of a tumor suppressor gene. Preferably, the expression or functional defect of the tumor suppressor gene comprises a gene mutation or gene expression and functional defect of a gene or protein such as TP53, PTEN, CDKN2A, APC, p16INK4A, p14ARF, LKB1, FBXW, etc.

[0026] In the above-mentioned pharmaceutical composition, the ENDOD1 endonuclease inhibitory drug can be any substance that has an inhibitory effect on the activity or function of ENDOD1 endonuclease, specifically including but not limited to antibodies, organic compounds or natural compounds, small nucleic acids, small RNAs, proteins, polypeptides, antisense acids and inorganic substances.

[0027] In the above-mentioned pharmaceutical composition, the SSA enhancer can be any substance that upregulates the single-stranded DNA fusion repair (SSA) function, specifically including but not limited to antibodies, organic compounds or natural compounds, small nucleic acids, small RNAs, proteins, polypeptides, antisense acids and inorganic substances.

[0028] In another embodiment, the present invention provides a method for treating and preventing hepatitis B virus infection, comprising administering to the subject an effective dose of an ENDOD1 endonuclease inhibitory drug or an SSA enhancer, wherein the endonuclease is an endonuclease encoded by an ENDOD1 endonuclease gene.

[0029] The above-mentioned treatment methods or pharmaceutical compositions also include combined use with one or more other antiviral treatment methods or use in combination. The one or more antiviral treatment methods include antiviral metabolic drug therapy, gene therapy, DNA therapy, RNA therapy, targeted therapy, adjuvant therapy and / or immunotherapy. The endonuclease is an endonuclease encoded by the ENDOD1 endonuclease gene, the ENDOD1 endonuclease inhibitory drug can be any substance that has an inhibitory effect on the activity or function of the ENDOD1 endonuclease, and the SSA enhancer can be any substance that upregulates the single-stranded DNA fusion repair (SSA) function, specifically including but not limited to antibodies, organic compounds or natural compounds, small nucleic acids, small RNAs, proteins, polypeptides, antisense acids and inorganic substances.

[0030] In another specific embodiment, the present invention provides a pharmaceutical composition for treating and preventing hepatitis B virus infection, comprising an effective dose of an ENDOD1 endonuclease inhibitory drug or an SSA enhancer, and pharmaceutical excipients, wherein the endonuclease is an endonuclease encoded by an ENDOD1 endonuclease gene. Preferably, the ENDOD1 endonuclease inhibitory drug may be any substance that has an inhibitory effect on the activity or function of ENDOD1 endonuclease, and the SSA enhancer may be any substance that upregulates the function of single-stranded DNA fusion repair (SSA), specifically including but not limited to antibodies, organic compounds or natural compounds, small nucleic acids, small RNAs, proteins, polypeptides, antisense acids, and inorganic substances.

[0031] In the pharmaceutical composition of the present invention, the ENDOD1 endonuclease inhibitory drug or SSA enhancer comprises a small molecule compound, an antibody, a polypeptide or an antisense compound.

[0032] In another embodiment, the use of an ENDOD1 endonuclease inhibitory drug or an SSA enhancer in the manufacture of a drug for treating and preventing hepatitis B virus infection, wherein the endonuclease is an endonuclease encoded by an ENDOD1 endonuclease gene, and can further include using the ENDOD1 endonuclease inhibitory drug or the SSA enhancer in combination with other antiviral treatments simultaneously or sequentially.

[0033] In the above method, the ENDOD1 endonuclease inhibitory drug inhibits the expression level of ENDOD1 endonuclease and / or its regulatory genes, inhibits the endonuclease activity of ENDOD1 endonuclease, blocks its DNA repair activity, destroys its subcellular localization, destroys its protein degradation, ubiquitination, phosphorylation post-translational modification, or interferes with the shearing and signal peptide maturation biological functions of ENDOD1 endonuclease and its regulatory proteins.

[0034] The above method, the SSA enhancer, can upregulate the single-stranded DNA fusion repair (SSA) function, enhance the recruitment of RAD52, MRE11, and RAD54B at DNA break sites, enhance the binding of RAD52 to DNA breakpoint ends and single-stranded DNA, enhance the binding of RAD52 to RPA70 and RPA32, or enhance RAD52 to promote the fusion of homologous sequences on single-stranded DNA.

[0035] The present invention also provides a method for screening anti-tumor drugs or anti-hepatitis B infection drugs, comprising contacting the screening target substance with cells expressing ENDOD1 nuclease, and selecting a substance that has an inhibitory effect on the activity, function or expression of ENDOD1 nuclease.

[0036] The present invention also provides a method for screening anti-tumor drugs or anti-hepatitis B infection drugs, comprising contacting the screening target substance with the target cell and selecting a substance that has an up-regulating effect on the activity, function or expression of a single-stranded DNA fusion (SSA) repair factor.

[0037] Homologous genes of human ENDOD1 endonuclease (NCBI gene ID, 23052) are widely present in higher eukaryotes, but not in lower eukaryotes such as yeast, fruit flies and nematodes.

[0038] The human ENDOD1 endonuclease gene encodes a protein product of 500 amino acid residues (AA) and belongs to the His-Cys endonuclease family. There are five subtypes of ENDOD1 endonuclease protein, which are produced by post-translational cleavage, signal peptide cleavage and ubiquitination modification of ENDOD1 endonuclease.

[0039] Human ENDOD1 endonuclease is localized to the nuclear membrane and nucleus in normal growing cells. After DNA damage, ENDOD1 endonuclease can enter the DNA breakpoint to form a cluster, tightly bind to chromatin, and be recruited near the 2.5Kb of the DNA breakpoint.

[0040] Human ENDOD1 endonuclease participates in DNA repair, promotes non-homologous end joining (NHEJ) and homologous recombination (HR) repair functions, and more importantly, inhibits the function of single-stranded DNA fusion (SSA). The function of ENDOD1 endonuclease to inhibit SSA requires the participation of protein (RAD52). ENDOD1 endonuclease can also promote the aggregation of NHEJ factors (γH2AX and 53BP1, etc.) and HR factors (BLM, MRE11, etc.) at the damage site. The function of ENDOD1 endonuclease in regulating DNA damage repair depends on its endonuclease activity.

[0041] ENDOD1 endonuclease has endonuclease activity and can cleave DNA molecules with structural damage, such as UV damage, DNA double-strand breaks (5' and 3' overhangs), oxidative damage (hydrogen peroxide treatment), etc.

[0042] The inhibition of ENDOD1 endonuclease gene expression or function is combined with defects in multiple DNA damage response functions to cause lethality, including homologous recombination-related proteins, specifically including but not limited to CHK1, ATM, CHK2, DNAPK, etc.

[0043] Inhibition of ENDOD1 endonuclease gene expression or function is jointly lethal with defects in multiple DNA damage repair functions, including BRCA1, BRCA2, MRE11, ARID1A, ARID1B, CTIP, EXO1, FANC, and WDR70.

[0044] Simultaneous inhibition of ENDOD1 endonuclease and DNA damage repair functions (such as BRCA1) can lead to more severe DNA repair defects.

[0045] Inhibition of ENDOD1 endonuclease function combined with tumor suppressor genes such as TP53 and PTEN is lethal.

[0046] ENDOD1 endonuclease is a good tumor-specific therapeutic target for the following reasons:

[0047] 1) ENDOD1 endonuclease gene expression or functional inhibition has no effect on the proliferation of normal non-tumor cells (such as RPE-1, MRC-5 and L02).

[0048] 2) ENDOD1 endonuclease gene expression or functional inhibition can effectively kill tumor cells from a variety of tissues, accounting for 76% (19 / 25) of the tumor cell lines tested.

[0049] 3) ENDOD1 endonuclease gene expression or functional inhibition can effectively kill tumor cells with DNA repair gene mutations or functional defects.

[0050] 4) ENDOD1 endonuclease gene expression or functional inhibition can effectively kill tumor cells with TP53 tumor suppressor gene mutations or functional defects.

[0051] 5) ENDOD1 endonuclease gene expression or functional inhibition can synergistically enhance the anti-tumor activity of conventional chemoradiotherapy, while drug treatment under the same conditions has no significant cytotoxic effect on normal cells.

[0052] 6) In addition to inhibiting the expression level of ENDOD1 endonuclease gene, specific elimination of the nuclease activity region of ENDOD1 endonuclease can also effectively kill tumor cells.

[0053] One of the examples shows that by giving the treatment subject a sufficient dose of ENDOD1 endonuclease inhibitory drugs, tumors with DNA homologous recombination defects, DNA damage response defects, DNA repair defects, gene mutations of tumor suppressor genes such as TP53, gene expression or functional defects can be specifically treated or prevented, but no killing effect on normal non-tumor cells. The same principle also applies to drugs that can increase SSA activity (SSA enhancers), because it can be predicted that ENDOD1 inhibitory drugs can effectively enhance SSA activity, and killing tumors depends on the increase in SSA activity, so it can be inferred that other SSA enhancers should also have the same therapeutic effect.

[0054] The present invention found that in order to maintain the survival of tumor cells, the expression or activity of ENDOD1 nuclease and the functions of tumor suppressor genes TP53, PTEN, etc. cannot be lost at the same time, and the increase in single-strand fusion repair (SSA) activity cannot simultaneously lose the functions of tumor suppressor genes TP53, PTEN, etc. Silencing the ENDOD1 nuclease expression gene, or enhancing single-strand fusion repair (SSA), will significantly lead to the rapid death of TP53, PTEN and other defective tumor cells. Consistent with the cytological results, the mouse model of TP53-deficient tumors will be completely inhibited by silencing the ENDOD1 nuclease gene in vivo. TP53, PTEN and other tumor suppressor gene defective tumors include any defects that reduce, slow down, damage and prevent TP53 gene expression or protein level reduction, as well as the exercise of normal tumor suppressor gene functions, including deletions, point mutations, frameshift mutations, reduced gene expression (gene site methylation) and other mutations. These mutations are mutations that can be detected by any regular sequencing test. Without being bound by any particular theory, inhibition of ENDOD1 endonuclease protein or enhancement of single-strand fusion repair (SSA) function can enhance tumor cell death in cancers with defects in tumor suppressor genes such as TP53 and PTEN.

[0055] The present invention also found that to maintain the survival of tumor cells, the ENDOD1 endonuclease activity and the functions of homologous recombination repair genes (such as BRCA1, BRCA2, WDR70 and FANC, etc.) cannot be lost at the same time, and the single-strand fusion repair (SSA) activity cannot be lost at the same time. Silencing the ENDOD1 endonuclease protein expression gene will significantly lead to the rapid death of homologous recombination defective tumor cells. Consistent with the cytological results, the mouse model of homologous recombination defective tumors will be completely inhibited by silencing the ENDOD1 endonuclease gene in vivo. Homologous recombination defective tumors include any defects that reduce, slow down, damage and prevent homologous recombination repair gene expression or protein level reduction, as well as the exercise of normal homologous recombination repair function, including deletions, point mutations, frameshift mutations, reduced gene expression (gene site methylation) and other mutations. These mutations are mutations that can be detected by any regular sequencing test. Without being limited by any certain theory, inhibiting the ENDOD1 endonuclease protein or enhancing the single-strand fusion repair (SSA) function can enhance the death of homologous recombination defective tumor cells.

[0056] Human tumor cells sensitive to inhibition of ENDOD1 endonuclease function carry an integrated hepatitis B virus (HBV) genome or express HBx, and these cells disrupt the function of the homologous recombination repair factor (CRL4WDR70) (see: Ren, L., et al., The Antiresection Activity of the X Protein Encoded by Hepatitis Virus B. Hepatology, 2019. 69). Silencing the ENDOD1 endonuclease protein expression gene significantly leads to rapid death of HBV-positive or HBx-expressing cells; while inhibition of ENDOD1 endonuclease function has no equivalent toxic effect on hepatocytes that are negative for HBV and do not express the HBx gene. Consistent with the cytological results, the tumor model of HBV-positive cells is completely inhibited by silencing the ENDOD1 endonuclease gene in vivo. Silencing the expression of the ENDOD1 endonuclease gene can effectively reduce the titer of HBV antigen and viral load in mouse serum.

[0057] The therapeutic range of ENDOD1 nuclease inhibitory drugs or SSA enhancers includes human lung cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer (viral or non-viral liver cancer), ovarian cancer, cervical cancer, lymphoma, leukemia, prostate cancer, melanoma, endometrial cancer, glioma, sarcoma and cholangiocarcinoma, as well as abnormal physiological indicators caused by tumor growth, and symptoms of the respiratory system, circulatory system, nervous system, digestive system, hematopoietic system, and motor system.

[0058] ENDOD1 endonuclease inhibitory drugs or SSA enhancers can treat tumors with homologous recombination defects in the above tumor types.

[0059] ENDOD1 endonuclease inhibitory drugs or SSA enhancers can treat tumors with mutations or functional defects in tumor suppressor genes such as TP53 and PTEN in the above-mentioned tumor types.

[0060] ENDOD1 endonuclease inhibitory drugs or SSA enhancers can treat tumors in the above tumor types that are insensitive to radiation and chemotherapy.

[0061] ENDOD1 endonuclease inhibitory drugs or SSA enhancers can treat tumors with obvious expression of ENDOD1 endonuclease gene and single-strand fusion repair (SSA) factors in the above tumor types.

[0062] The range of tumors for which ENDOD1 endonuclease inhibitory drugs or SSA enhancers are applicable includes, but is not limited to, breast cancer, ovarian cancer, prostate cancer, gastric cancer, osteosarcoma and other tumors with homologous recombination repair defects (BRCA1, BRCA2, PTIP, ARID1A, ARID1B, Fanconi gene, WDR70, etc.).

[0063] The range of tumors for which ENDOD1 endonuclease inhibitory drugs or SSA enhancers are applicable includes, but is not limited to, colorectal cancer and other tumors with base excision repair defects (MLH1, MSH2 mutations or functional defects).

[0064] The range of tumors for which ENDOD1 endonuclease inhibitory drugs or SSA enhancers are applicable includes, but is not limited to, skin cancer and melanoma tumors with nucleotide excision repair defects (XPA, XPB, XPC, XPD, XPE and XPF mutations or functional defects).

[0065] The range of tumors for which ENDOD1 endonuclease inhibitory drugs or SSA enhancers are applicable includes, but is not limited to, viral infections with HBV positivity or HBx expression, liver cancer and cholangiocarcinoma, and hepatobiliary diseases caused by HBV virus infection.

[0066] The range of tumors for which ENDOD1 endonuclease inhibitory drugs or SSA enhancers are applicable also includes other types of tumors such as lung cancer, cervical cancer, lymphoma, leukemia, prostate cancer, melanoma, endometrial cancer, glioma, etc. These tumors have DNA damage response and repair defects, including but not limited to tumors with the following DNA damage response and DNA repair gene mutations, such as BRCA1, BRCA2, PTIP, CHK1, CHK2, ATM, ATR, MLH1, MSH2, WDR70, FANCA, FANCC, FANCD2, FANCF, EMSY, XPA, XPB, XPC, XPD, XPE, XPF, DNA ligase I, DNA ligase II, DNA ligase III, DNA ligase IV, etc.; or tumor suppressor gene mutations such as TP53, PTEN, CDKN2A, APC, p16INK4A, p14ARF, LKB1, FBXW, VHL and WT-1, etc.

[0067] Another purpose of the present invention is to reduce or eradicate HBV infected cells or hepatitis cells expressing HBx gene, reduce serum viral antigen titer and viral load of HBV carrier patients, and reduce infectivity. The method comprises administering an effective amount of ENDOD1 endonuclease inhibitor or SSA enhancer to the patient.

[0068] Here, the above-mentioned ENDOD1 endonuclease inhibitory drugs include any agent that can reduce, lower, hinder, damage and prevent ENDOD1 endonuclease activity in cells relative to control solvents; or any agent that can reduce or reduce the ENDOD1 endonuclease gene expression level and protein level. In particular, the ENDOD1 endonuclease protein includes different protein activity regulatory regions, so the relevant drugs should also include agents that can inhibit the activity of the region, and the protein activity region includes signal peptide processing, protein cleavage, subcellular localization of the nucleus, Golgi and nuclear membrane, as well as ENDOD1 endonuclease degradation and ubiquitination. Specifically, these drugs also include agents that can reduce, slow down, damage and prevent ENDOD1 endonuclease activity protein regions.

[0069] The target of ENDOD1 endonuclease inhibitory drugs is to inhibit the function of ENDOD1 endonuclease, including reducing or completely eliminating ENDOD1 endonuclease gene expression and / or protein levels, or inhibiting its endonuclease enzymatic activity, interfering with its DNA damage repair function, blocking its protein cleavage, processing and maturation, disrupting its subcellular localization, disrupting its ubiquitination regulation, or interfering with the biological functions of ENDOD1 endonuclease protein cleavage and maturation. These drugs also include agents that can reduce, slow down, damage and prevent the active protein region of ENDOD1 endonuclease.

[0070] Here, the above-mentioned SSA enhancers include any agent that can upregulate and improve the activity of single-stranded DNA fusion repair (SSA) in cells relative to the control solvent; or any agent that can upregulate, reduce or lower the gene expression level and protein level of single-stranded DNA fusion repair (SSA). In particular, SSA enhancers include different protein activity regulatory regions, so the relevant drugs should also include agents that can enhance the activity of this region. The protein activity region includes protein maturation, subcellular localization of the nucleus, chromatin and DNA breakpoints, as well as phosphorylation, acetylation, degradation and ubiquitination of SSA regulatory factors. Specifically, these drugs also include agents that can affect the single-stranded DNA fusion repair (SSA) active protein regions such as RAD52, MRE11 and RAD54B. ENDOD1 endonuclease inhibitors or SSA enhancers can be any form of small molecules, antibodies and antibody fragments, gene editing, peptides, and antisense compositions.

[0071] Specifically, ENDOD1 endonuclease inhibitory drugs can be a class of molecules that target ENDOD1 endonuclease mRNA and DNA, and act to reduce and prevent ENDOD1 endonuclease protein expression. Specifically, ENDOD1 endonuclease-related drugs can interfere with the nucleic acid sequence of DNA or RNA of ENDOD1 endonuclease, such as siRNA, shRNA, dsRNA, miRNA, amiRNA, antisense oligonucleotides, or use CRISPR / CAS9 or derivative methods to achieve gene editing or gene knockout to reduce the expression level of ENDOD1 endonuclease or its regulatory genes. Such drugs can be in modified or unmodified form. Such modified drugs may include modified nucleotides, sugar groups, modified backbone carriers and any previous modifications. For example, modifications include but are not limited to R2'O-Me modification, nucleotide 2'-fluorine (2'-F) modification, nucleotide analog replacement and backbone phosphorylation modification.

[0072] The present invention also provides a siRNA or shRNA for inhibiting the expression of the ENDOD1 gene, which is a single-stranded or double-stranded RNA molecule of 12 to 100 nucleotides, wherein one strand contains 12 to 24 continuous or discontinuous sequences that can match a certain segment of nucleotides of the ENDOD1 gene. Preferably, the siRNA for inhibiting the expression of the ENDOD1 gene is a single-stranded or double-stranded RNA with a length of 18 to 28 nucleotides. More preferably, the siRNA for inhibiting the expression of the ENDOD1 gene has a nucleotide sequence selected from the group consisting of SEQ ID No. 2-No. 353 sequences.

[0073] The present invention also identifies nucleotide targeting sequences for disrupting the genomic structure and gene expression of ENDOD1 endonuclease by CRISPR / CAS9, including but not limited to:

[0074] 5'-CCAGCGCGAGCCAGCGCGCGG-3'

[0075] 5'-CAGCCTCTTCGCCCTGGCTGG-3'

[0076] 5'-TGTCACATTCGCCAAAGCCGG-3'

[0077] 5'-CCCGGGTGCTGTAGAGGGTGG-3'

[0078] The above-mentioned ENDOD1 endonuclease inhibitory drugs or SSA enhancers, including compositions containing them, are used to treat tumors and related diseases. ENDOD1 endonuclease inhibitory drugs or SSA enhancers can be used in combination with other anti-tumor treatment methods with synergistic effects (such as anticancer drugs, surgery, transplantation and radiotherapy). Furthermore, the synergistic use with other drugs includes all agents and administration methods that can increase the anti-cancer effect when used in combination. The above-mentioned synergistic agents include any cancer treatment method, including but not limited to drugs, combination of therapies, and medication techniques (such as surgery, radiotherapy, etc.). Specific anti-cancer therapies include but are not limited to the combination and single use of surgery, radiotherapy, chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, adjuvant therapy and immunotherapy.

[0079] The combination therapy can be that the two drugs are taken separately in sequence or simultaneously, or the ENDOD1 endonuclease inhibitor or SSA enhancer is combined with other targeted anticancer drugs to form a pharmaceutical composition.

[0080] The combination or composition of the above-mentioned ENDOD1 endonuclease inhibitor or SSA enhancer further includes the combination with platinum (including but not limited to cisplatin, carboplatin, oxaliplatin, seraplatin, picoplatin, nedaplatin, Triplatin, Lipoplatin), camptothecin, mitomycin and other DNA toxic anticancer drugs. The combination can be taken together or one after the other.

[0081] The combination or composition of the above-mentioned ENDOD1 endonuclease inhibitor or SSA enhancer further includes PARP inhibitors, DNAPK inhibitors, HDAC inhibitors, ATMi inhibitors, vinca alkaloids, anti-tumor alkaloids, monoclonal antibodies, and anti-metabolism drugs. The combination can be taken together or one after the other.

[0082] The combination or composition of the above-mentioned ENDOD1 endonuclease inhibitor or SSA enhancer further includes a combination with radiotherapy, including but not limited to 67 Cu, 67 Ga, 90 Y, 131 I, 177 LU, 186 Re, 188 Re,α_Particle emitter, 211 At, 213 Bi, 225 Ac,Auger-electron emitter, 125 I, 212 Pb, and111 The combination drug can be taken simultaneously with the radiotherapy, or can be taken one before and the other after an interval.

[0083] Further, examples of anti-tumor alkylating agents include, but are not limited to, nitrogen mustard, cyclophosphamide, methyldioxyethylamine or mucin (HN2), uracil or uracil, mustard gas, sarcolytic, chloramphenicol, ifosfamide, bendamustine, nitrosoureas, carmustine, lomustine, streptozotocin, alkyl sulfonates, butyl dimesylate, thiotepa, promazine, hexamethylmelamine, triazine, dacarbazine, mitozolomide and temozolomide. The combination can be taken together or taken one after the other.

[0084] Further examples of anticancer monoclonal antibodies include, but are not limited to, necitumumab, dinutuximab, nivolumab, blinatumab, pembrolizumab, ramucirumab, obinutuzumab, adotrastuzumabemtansine, pertuzumab, brentuximab, ipilimumab, ofatumumab, catumaxomab, bevacizumab, cetuximab, tositumomab-Il31, ibritumomab tiuxetan, alemtuzumab, gemtuzumab, trastuzumab and rituximab, vinca alkaloids and derivatives thereof. The combination can be taken together or taken one after the other at intervals.

[0085] Further, the combination or composition of the above-mentioned ENDOD1 endonuclease inhibitory drug or SSA enhancer includes, but is not limited to, antimetabolite agents. For example, agents include, but are not limited to, fluorouracil, cladribine, capecitabine, 6-mercaptopurine, pemetrexed, fludarabine, gemcitabine, hydroxyurea, methotrexate, nelarbine, clofarabine, cytarabine, decitabine, deazaaminopterin, 5-fluorouracil deoxyribonucleoside, and 6-thioguanine.

[0086] Further combinations or compositions of the above-mentioned ENDOD1 endonuclease inhibitory drugs or SSA enhancers include, but are not limited to, cell immunotherapy, antibody therapy or cytokine therapy. ENDOD1 endonuclease inhibitory drugs act synergistically with immunotherapy. Examples of cell immunotherapy include, but are not limited to, dendritic cell therapy and Sipuleucel-T. Examples of antibody therapy include, but are not limited to, necitumumab, dinutuximab, nivolumab, blinatumab, pembrolizumab, ramucirumab, obinutuzumab, adotrastuzumab emtansine, pertuzumab, brentuximab, ipilimumab, ofatumumab, catumaxomab, bevacizumab, cetuximab, tositumomab-Il31, ibritumomab tiuxetan, alemtuzumab. Examples of cytokine therapy include, but are not limited to, interferons (e.g., IFNa, IFNp, IFNy, IFNX) and interleukins. In some embodiments, immunotherapy includes one or more immune checkpoint inhibitors. Examples of immune checkpoint proteins include, but are not limited to, CTLA-4 and its ligands CD80 and CD86, PD-1 and its ligands PD-L1 and PD-L2, and 4-1BB. The combination can be taken together or one after the other.

[0087] Further, other examples of anticancer therapies include, but are not limited to, acetylcholine (e.g., ZYTIGA), ABVD, ABVE, ABVE-PC, AC, AC-T, ADE, ado-trastuzumab antansina (e.g., KADCYLA), afatinib diacetate (e.g., GILOTRIF), aldesleukin (e.g., PROLEUKIN), alemtuzumab (e.g., CAMPATH), anastrozole (e.g., ARIMIDEX), arsenic trioxide (e.g., TRISENOX), asparaginase (e.g., ERWINAZE), axitinib (e.g., INLYTA), azacitidine (e.g., MYLOSAR, VIDAZA), BEACOPP, belinostat (e.g., BELEODAQ), bendamustine hydrochloride (e.g., TREANDA), BEP, bevacizumab, and tamoxifen. zumab (e.g., AVASTIN), bicalutamide (e.g., CASODEX), bleomycin (e.g., BLENOXANE), blinatumomab (e.g., BLINCYTO), bortezomib (e.g., VELCADE), bosutinib (e.g., BOSULIF), brentuximab (e.g., ADCETRIS), busulfan (e.g., BUSULFEX, MYLERAN), cabazitaxel (e.g., JEVTANA), cabozantinib malate (e.g., COMETRIQ), CAF, capecitabine (e.g., XELODA), CAPOX, carboplatin (e.g., PARAPLAT, PARAPLATIN), carboplatin-paclitaxel, carfilzomib (e.g., KYPROLIS), carbomycin (e.g., BECENUM, BICNU, CARMUBRIS), carbomycin implants (e.g., GLIADEL WAFER, GLIADEL), ceritinib (e.g., ZYKADIA), cetuximab (e.g., ERBITUX), chloramphenicol (e.g., AMBOCHLORIN, AMBOCLORIN, LEUKERAN, LINFOLIZIN), chloramphenicol prednisone, CHOP, cisplatin (e.g., PLATINOL, PLATINOL-AQ), clofatin (e.g., CLOFAREX, CLOLAR), CMF, COPP, COPP-AB V, crizotinib (e.g., XALKORI), CVP, cyclophosphamide (e.g., CLAFEN, CYTOXAN, NEOSAR), cytarabine (CYTOSAR-U, TARABINE PFS), dabrafenib (e.g., TAFINLAR), dacarbazine (e.g., DTIC-DOME), actinomycin (e.g., COSMEGEN), dasatinib (e.g., SPRYCEL),daunorubicin hydrochloride (e.g., CERUBIDINE), decitabine (e.g., DACOGEN), degarelix, denileukin diftitox (e.g., ONTAK), denosumab (e.g., PROLIA, XGEVA), dinutuximab (e.g., UNITUXIN), docetaxel (e.g., TAXOTERE), doxorubicin hydrochloride (e.g., ADRIAMYCIN PFS, ADRIAMYCIN RDF), doxorubicin hydrochloride liposome (e.g., DOXIL, DOX-SL, EV ACET, LIPODOX), enzalutamide (e.g., XT ANDI), epirubicin hydrochloride (e.g., ELLENCE), EPOCH, erlotinib hydrochloride (e.g., TARCEVA), etoposide (e.g., TOPOSAR, VEPESID), etoposide phosphate (e.g., ETOPOPHOS), everolimus (e.g., AFINITOR DISPERZ, AFINITOR), exemestane (e.g., AROMAS IN), FEC, fludarabine phosphate (e.g., FLUDARA), fluorouracil (e.g., ADRUCIL, EFUDEX, FLUOROPLEX), irinotecan, irinotecan plus bevacizumab, irinotecan plus cetuximab, oxaliplatin triplet, oxaliplatin, FU-LV, fulvestrant (e.g., FASLODEX), gefitinib (e.g., IRESSA), gefitinib hydrochloride (e.g., GEMZAR), gefitinib plus cisplatin, gefitinib plus oxaliplatin, goserelin acetate (e.g., ZOLADEX), Hyper-CVAD, ibrutinib (e.g., ZEVALIN), ibrutinib (e.g., IMBRUVICA), ICE, idelalisib (e.g., ZYDELIG), ifosfamide (e.g., CYFOS, IFEX, IFOSFAMIDUM), imatinib mesylate (e.g., GLEEVEC), imiquimod (e.g., ALDARA), ipilimumab (e.g., YER VO Y), irinotecan hydrochloride (e.g., CAMPTOSAR),ixabepilone (e.g., IXEMPRA), lanreotide acetate (e.g., SOMATULINE DEPOT), lapatinib ditosylate (e.g., TYKERB), lenalidomide (e.g., REVLIMID), lenvatinib (e.g., LENVIMA), letrozole (e.g., FEMARA), leucovorin calcium (e.g., WELLCOVORIN), leuprolide acetate (e.g., LUPRON DEPOT, LUPRON DEPOT-3MONTH, LUPRON DEPOT-4MONTH, LUPRON DEPOT-PED, LUPRON, VIADUR), liposomalcytarabine (e.g., DEPOCYT), lomustine (e.g., CEENU), mechlorethamine hydrochloride (e.g., MUSTARGEN), megestrol acetate (e.g., MEGACE), mercaptopurine (e.g., PURINETHOL, PURIXAN), methotrexate (e.g., ABITREXATE, FOLEX PFS, FOLEX, METHOTREXATE LPF, MEXATE, MEXATE-AQ), mitomycin C (e.g., MITOZYTREX, MUTAMYCIN), mitoxantrone hydrochloride, MOPP, nelarabine (e.g., ARRANON), nilotinib (e.g., TASIGNA), nivolumab (e.g., OPDIVO), obinutuzumab (e.g., GAZYVA), OEPA, ofatumumab (e.g., ARZERRA), OFF, olaparib (e.g., LYNPARZA), omacetaxine mepesuccinate (e.g., SYNRIBO), OPPA, oxaliplatin (e.g., ELOXATIN), paclitaxel (e.g., TAXOL), paclitaxel SYNRIBO), paclitaxel nanoparticles (e.g., ABRAXANE), PAD, palbociclib (e.g., IBRANCE), pamidronate disodium (e.g., AREDIA), panitumumab (e.g., VECTIBIX), panobinostat (e.g., FARYDAK), pazopanib hydrochloride (e.g., VOTRIENT), pegaspargase (e.g.,ONCASPAR), alfa-2b pegylated interferon (e.g., PEG-INTRON, SYLATRON), pembrolizumab (e.g., KEYTRUDA), pemetrexed disodium (e.g., ALIMTA), pertuzumab (e.g., PERJETA), plerixafor (e.g., MOZOBIL), pomalidomide (e.g., POMALYST), ponatinib hydrochloride (e.g., ICLUSIG), pralatrexate (e.g., FOLOTYN), prednisone, procarbazine hydrochloride (e.g., MATULANE), radium 223 dichloride (e.g., XOFIGO), raloxifene hydrochloride (e.g., EVISTA, KEOXIFENE), ramucirumab (e.g., CYRAMZA), R-CHOP, recombinant human papillomavirus bivalent vaccine (e.g., CERVARIX), recombinant human papillomavirus (e.g., HPV) monovalent vaccine (e.g., GARD AS IL 9), nonavalent vaccine (e.g., HPV) quadrivalent vaccine (gg, GARDASIL), recombinant leukocyte interferon alfa-2b (e.g., INTRON A), regorafenib (e.g., STIVARGA), rituximab (e.g., RITUXAN), romidepsin (e.g., ISTODAX), ruxolitinib phosphate (e.g., JAKAFI), siltuximab (e.g., SYLVANT), sipuleucel-t (e.g., PROVENGE), sorafenib tosylate (e.g., NEXAVAR), STANFORD V, sunitinib malate (e.g., SUTENT), TAC, tamoxifen citrate (e.g., NOVALDEX), temozolomide (e.g., f METHAZOLASTONE, TEMODAR), temsirolimus (e.g., TORISEL), thalidomide (e.g., SYNOVIR, THALOMID), thiotepa, topotecan hydrochloride (e.g., HYCAMTIN), toremifene (e.g., FARESTON), tositumomab and radioactive iodine (I131) plus tositumomab (e.g., BEXXAR), TPF, trametinib (e.g., MEKINIST), trastuzumab (e.g., HERCEPTIN), VAMP, vandetanib (e.g., CAPRELSA), VEIP, vemurafenib (e.g.,ZELBORAF), vinblastine sulfate (e.g., VELBAN, VELSAR), vincristine sulfate (e.g., VINCAS AR PFS), vincristine sulfate liposome (e.g., MARQIBO), vinorelbine tartrate (gg, NAVELBINE), vismodegib (e.g., ERIVEDGE), vorinostat (e.g., ZOLINZA), XELIRI, XELOX, ziv-aflibercept (e.g., ZALTRAP), zoledronic acid (e.g., ZOMETA), or any combination thereof.

[0088] Furthermore, anticancer therapies can be selected from epigenetic and transcriptional regulatory factors, including but not limited to DNA alpha transferase inhibitors, histone acetylation inhibitors (HDAC inhibitors), lysine methyltransferase inhibitors), anti-mitotic drugs (e.g., taxanes and vinca alkaloids), hormone receptor modulators (e.g., estrogen receptor modulators and androgen receptor modulators), cell signaling pathway inhibitors, cell signaling pathway inhibitors, protein stability regulators (e.g., protease inhibitors), Hsp90 inhibitors, glucocorticoids, trans-retinoic acid compounds, and other differentiation promoting factors.

[0089] Specifically, ENDOD1 endonuclease inhibitors or SSA enhancers can be independently used in any anticancer therapy, including but not limited to surgery, radiotherapy, transplantation (stem cell transplantation, bone marrow suppression), immunotherapy and chemotherapy.

[0090] Specific tumors to which the above-mentioned ENDOD1 endonuclease inhibitory drug or SSA enhancer treatment regimen can be applied include, but are not limited to, lung cancer (e.g., bronchial carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), lung adenocarcinoma); renal cancer (e.g., nephroblastoma, also known as Wilms' tumor, renal cell carcinoma); acoustic neuroma; adenocarcinoma; adrenal cancer; anal cancer; hemangioma (e.g., lymphangioma, lymphangiocndothcliosarcoma, angiosarcoma) adnexal cancer; benign monoclonal gammopathy; gallbladder cancer; bladder cancer; breast cancer (e.g., breast adenocarcinoma, breast papillary carcinoma, breast medullary carcinoma); brain cancer (e.g., meningioma, glioma, glioma (e.g., astrocytoma, oligodendroglioma, medulloblastoma); bronchogenic carcinoma; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma, cervical squamous cell carcinoma); gallbladder cancer; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial cancer; ependymoma; endothelial sarcoma (e.g., Kaposi sarcoma, multiple idiopathic hemorrhagic sarcomas); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., esophageal adenocarcinoma, Barrett's esophageal adenocarcinoma); Ewing's sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); hypereosinophilia; gallbladder cancer; gastric cancer (e.g., gastric adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head Neck cancer (e.g., head and neck squamous cell carcinoma), oral cancer (e.g., oral squamous cell carcinoma), pharyngeal cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, larynx cancer); heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma; hypopharyngeal cancer; inflammatory myofibroblastic tumor; immune cell amyloidosis; liver cancer (e.g., hepatocellular carcinoma (HCC), malignant hepatoma); leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myelodysplastic disease (MPD) (e.g., polycythemia vera (PV), essential thrombocythemia (ET), non-primary myeloid metaplasia (AMM), myelofibrosis (MF), chronic idiopathic myeloid fibrosis, chronic myeloid leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES), neuroblastoma; neurofibromas (e.g., neurofibromatosis (Nr) type 1 or 2, schwannomatosis); neuroendocrine cancers (e.g., gastrointestinal neuroendocrine tumors (GEP-NET), benign tumors); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g., ovarian cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer; intraductal papillary mucinous neoplasm (IPMN); islet cell tumor; penile cancer (e.g., penile scrotal Paget's disease); pinealoma; primitive neuroectodermal tumor; plasma cell tumor; paraneoplastic syndrome; intraepithelial neoplasia; prostate cancer;Rectal cancer; Rhabdomyosarcoma; Salivary gland cancer; Skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); Small intestinal cancer (e.g., appendix cancer); Soft tissue sarcomas (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); Sebaceous gland cancer; Small intestinal cancer; Sweat gland cancer; Synovial tumor; Testicular cancer (e.g., seminoma, testicular embryonal carcinoma); Thyroid cancer (e.g., papillary thyroid carcinoma, papillary thyroid carcinoma (PTC), medullary thyroid cancer); Urethra cancer; Vaginal cancer; Vulvar cancer (e.g., Paget's disease of the vulva).

[0091] Specifically, for the treatment of cancer with ENDOD1 endonuclease inhibitors or SSA enhancers, "treatment" refers to reversing, alleviating, or delaying the occurrence or progression of cancer. Specifically, treatment can be performed after one or more signs or symptoms of the disease have developed or can be observed; it can also be performed in diseases without symptoms or signals. For example, susceptible people can be treated before symptoms appear (for example, based on a history of symptoms and / or exposure to pathogens). Treatment can also be continued after symptoms disappear, for example, to delay and / or prevent recurrence.

[0092] Specifically, "administration" of ENDOD1 endonuclease inhibitory drugs or SSA enhancers in the treatment of cancer refers to implanting, orally administering, absorbing, injecting, inhaling or introducing any other means of the DO inhibitory drugs or SSA enhancers described herein, or their components into the body or body of the subject.

[0093] In the present invention, the term "administering" refers to implanting, orally administering, absorbing, injecting, inhaling or introducing in any other manner the ENDOD1 endonuclease inhibitory drug or SSA enhancer described herein, or a composition thereof, into the body or body of the subject.

[0094] The term "single-strand DNA fusion repair", or single strand annealing (SSA), refers to a repair method that is mainly mediated by RAD52 and requires single-stranded DNA and homologous sequences. Its regulatory pathway also includes factors such as RAD52, MRE11, RAD54B and RPA.

[0095] The term "inhibit" refers to the ability of a compound to reduce, slow, stop and / or prevent the activity of a specific biological process in a cell relative to the activity of the vector. "Control" or "prevent" means that the activity is inhibited, hindered, controlled or prevented, and the degree of reduction compared to the control activity is at least 5%. 10%. 15%. 20%. 25%. 30%, 35%. 40%. 45%. 50%. 55%, 60%. 65%. 70%, 75%. 80%. 85%, 90%. 95% or 100%. Specifically, "inhibit, hinder, control or prevent" means that the expression of the target of the inhibitor is reduced by at least 5%. 10%. 15%. 20%. 25%. 30%, 35%. 40%. 45%. 50%. 55%, 60%. 65%. 70%, 75%. 80%. 85%, 90%. 95% or 100% compared to the control. Specifically, "inhibit, inhibit, control or prevent" means that the target activity of the inhibitor (such as biological enzyme activity) is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% compared to the control.

[0096] "Effective dose" refers to a dose that can induce the expected biological response. This response can be understood by conventional techniques in the art. The effective dose of the components of the present invention may vary according to the following factors: the expected biological endpoint, the pharmacokinetics of the compound, the treatment environment, the method of administration, the age and health factors of the treated subject. The effective dose includes, but is not limited to, the dose necessary to slow down, reduce, inhibit, improve, and reverse one or more cancer-related symptoms. Specifically, "effective dose" refers to the dose at which an agent (such as an ENDOD1 inhibitory drug or an SSA enhancer) can cause tumor cells to reduce ENDOD1 expression and / or activity. The effective dose range for "reducing ENDOD1 expression and / or activity" includes any multiple between 2 and 100 times, and any value between 100% and 1%. Specifically, the effective dose in cancer treatment refers to a dose that achieves a lack of expression of ENDOD1 protein and / or its protein activity in tumor cells.

[0097] If two or more inhibitors are administered to a subject, the effective amount may be a combined selected amount. When a first inhibitor is used with a second and optionally a third inhibitor, the selective amount of the first inhibitor may be different. When two or more inhibitors are used simultaneously, the effective amount of each inhibitor may be the same or different when used alone. If the expected effect can be achieved at a lower dose, the effective amount of each drug may be less than the effective amount when used alone. Specifically, when the subject is better able to tolerate one or more inhibitors, and a higher dose can provide greater therapeutic benefits, the effective amount of each drug may be greater than the effective amount when used alone. Specifically, according to one or more administrations for one or more days (depending on the mode of administration), the effective amount of a compound may vary from about 0.001 mg / kg to about 1000 mg / kg. In certain embodiments, the effective dose ranges from about 0.001 mg / kg to about 1000 mg / kg, ranging from about 0.01 mg / kg to about 750 mg / kg. From about 0.1 mg / kg to about 500 mg / kg, from about 1.0 mg / kg to about 250 mg / kg, from about 10.0 mg / kg to about 150 mg / kg. One of ordinary skill in the art can empirically determine an appropriate therapeutically effective amount.

[0098] "Subjects" or "patients" or "subjects" include, but are not limited to, humans and animals that are capable of developing cancer, or any disease that is directly or indirectly related to cancer. Research subjects include mammals. Such as humans, dogs, cows, horses, pigs, sheep, goats, cats, rats, rabbits, mice and transgenic non-human animals. Specifically, "subjects" or "patients" or "subjects" include companion animals, such as dogs, cats, rabbits and rats. Specifically, "subjects" or "patients" or "subjects" include livestock, such as cows, pigs, sheep, goats and rabbits. Specifically, "subjects" or "patients" or "subjects" include purebred or show animals, such as horses, pigs, cows and rabbits. Specifically, "subjects" or "patients" or "subjects" are humans, for example, humans who have or may have a risk of cancer.

[0099] The compounds described in this patent can be administered to the subject in any order. The first therapeutic agent, such as an ENDOD1 inhibitor, can be administered to the subject with a second therapeutic agent (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour. 2 hours, 4 hours, 6 hours. 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours. 1 week. 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks or 12 weeks before), accompanied or subsequently (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks later). Therefore, the ENDOD1 inhibitor can be administered separately, sequentially or simultaneously with the second therapeutic agent (such as a chemotherapeutic agent described herein).

[0100] The compounds described herein can be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intraventricular, and transdermal. Interaction specifications. Rectal, intravaginal, intraperitoneal, topical (e.g., powders, ointments, salves, and / or drops), mucosal, nasal, oral, sublingual; intratracheal instillation, bronchial instillation, and / or inhalation; and / or oral spray, nasal spray, and / or aerosol. Specifically, the routes within the scope of consideration include oral, intravenous injection (e.g., systemic intravenous injection), regional administration through blood and / or lymphatic supply, and / or direct administration to the site of lesions or suspected lesions. Specifically, the most suitable route of administration depends on a variety of factors, including the nature of the formulation (e.g., stability in the gastrointestinal environment) and / or the condition of the subject (e.g., whether the subject can tolerate oral administration). The specific amount of the desired compound (to achieve an effective amount) will vary from subject to subject, for example, depending on the species, age and health of the subject, the severity of side effects or individual biological system disorders, the characteristics of the specific compound, the mode of administration, etc. The desired dose can be administered three times a day, twice a day, once a day, every other day, every three days, every week, every two weeks, every three weeks or every four weeks. Specifically, the desired dose can be administered multiple times (e.g., twice, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen or more times). Specifically, the effective amount of the compound administered once or multiple times to a 70 kg adult per day may include about 0.0001 mg to about 3000 mg, about 0.0001 mg to about 2000 mg, about 0.0001 mg to about 1000 mg. The compound may be present in an amount of about 0.001 mg to about 1000 mg, about 0.01 mg to about 1000 mg, about 0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to about 100 mg, about 10 mg to about 1000 mg, or about 100 mg to about 1000 mg per unit dosage form.

[0101] Specifically, the compounds provided herein can be delivered at a dosage level sufficient to be delivered from about 0.001 mg / kg to about 100 mg / kg, from about 0.01 mg / kg to about 50 mg / kg, preferably from about 0.1 mg / kg to about 40 mg / kg, preferably from about 0.5 mg / kg to about 30 mg / kg, from about 0.01 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 10 mg / kg of the subject's body weight, more preferably from about 1 mg / kg to about 25 mg / kg, once or more per day to obtain the desired therapeutic effect. It should be noted that the dosage ranges described herein provide guidance for administering the provided pharmaceutical ingredients to adults. The specific amount given to children or adolescents can be determined by a physician or a person skilled in the art, and may be less than or equal to the amount given to adults.

[0102] In the present invention, the term "ENDOD1 endonuclease" refers to the gene (NCBI gene ID, 23052), mRNA (NM_015036.3) and protein (NP_055851.1) of human ENDOD1 endonuclease.

[0103] In the scheme of the present invention, the ENDOD1 endonuclease inhibitory drug can be administered by parenteral routes such as oral administration or injection, or can be administered by biological media such as lentivirus and adenovirus.

[0104] On the other hand, another object of the present invention is to determine the cell biological screening methods and strategies for ENDOD1 nuclease inhibitory drugs, including but not limited to the cell biological methods described in the present invention, including using immunofluorescence or fluorescent fusion proteins to determine the aggregation ability of functional proteins in cells at DNA breakpoints after treatment with ionizing rays or chemotherapeutic drugs, such as reduced signals of ENDOD1 nuclease, MRE11, gH2AX, 53BP1 and single-stranded DNA generation, and enhanced aggregation signals of RAD52, ATM-pSerine1981, BLM, etc.

[0105] On the other hand, another object of the present invention is to determine the screening methods and strategies for ENDOD1 inhibitory drugs, including the in vitro endonuclease activity assay method, the cellular level SSA dysfunction screening method, and the ENDOD1 gene expression inhibitor screening method of the present invention. Specific assay signals include, but are not limited to, fluorescence, biotin, absorbance, chemiluminescence, electrical signals, radiography, etc., and their derivative assay methods include enzyme activity competitive inhibition, flow cytometry, scintillation proximity detection (SPA), fluorescence polarization detection (FPA), surface plasmon resonance technology, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] Figure 1, Human ENDOD1 endonuclease gene and protein sequence characteristics

[0107] (AB) The coding sequences of mRNA (NM_015036.3) and protein (NP_055851.1) of human ENDOD1 endonuclease gene (23052); (C) The protein domains include signal peptide, endonuclease and active sites (residues C190, C224 and C269), and transmembrane regions I-III; (D) The structure of ENDOD1 endonuclease gene, including 2 exons and 1 intron sequence; (E) The evolutionary tree of ENDOD1 endonuclease gene drawn by Genetree software, its homologous genes exist in higher eukaryotes, but not in lower eukaryotes such as yeast, fruit flies and nematodes;

[0108] Figure 2 , Characteristics and post-translational modifications of human ENDOD1 endonuclease

[0109] (A) CRISPR / CAS9 gene editing of the ENDOD1 endonuclease gene. The gRNA target is shown in A1. The underlined nucleotides are PAM sequences. A2 shows the structure of the CAS9-gRNA gene editing plasmid used; (B) Three small interfering RNA sequences used for silencing the ENDOD1 endonuclease gene (B1) and the silencing effect (B2). si001 is a commonly used siRNA in this study. The * is a non-specific band; (C) Western blotting was used to determine the protein product of ENDOD1 endonuclease in RPE-1 cells. The main band size is about 55Kd (full length, a). The * is a non-specific band; (D) RPE-1 cell lines with ENDOD1 endonuclease gene knockout (2F4) or mutation (2F6) obtained by CAS9-gRNA gene editing. 2F4 is a complete knockout, and no ENDOD1 endonuclease protein bands can be detected by Western blotting. 2F6 is a protein processing mutation, only band a is expressed, while bands b and c are missing; (E) Immunoblotting detection of siRNA (si001) gene silenced RPE-1 cells. ENDOD1 endonuclease protein bands a, b, c, d, and e are all weakened; (F) Ubiquitination modification experiments prove that the protein subtype e of ENDOD1 endonuclease is produced by ubiquitination modification, including polyubiquitination modification of lysine 48 (K48) and lysine 63 (K63); (G) The position of the ENDOD1 endonuclease signal peptide (residue 22) predicted by bioinformatics software (PrediSci), LEG-RL is a possible protease cleavage site; (H) NetSurfP-2.0 software predicts the low-order region (disorder) of ENDOD1 endonuclease, and finds that residues 300-325 are potential protease cleavage sites, which together with the enzymatic activity of the residue LEG-RL sequence produce ENDOD1 endonuclease b, c, and d subtypes;

[0110] Figure 3 Human ENDOD1 endonuclease binds to DNA damage sites

[0111] (A) Immunofluorescence showed that ENDOD1 endonuclease is mainly localized in the cytoplasm and nuclear membrane in normal growing cells. After DNA damage (ionizing radiation irradiation), ENDOD1 endonuclease can enter the DNA breakpoints within 40 minutes to form ENDOD1 endonuclease aggregation points, which persist until 2 hours after irradiation. Nuclear DNA was counterstained with DAPI; (B) Immunofluorescence showed that ENDOD1 endonuclease could also enter DNA breakpoints to form aggregation points after treatment with camptothecin (CPT) and hydroxyurea (HU); (C) Immunofluorescence showed that ENDOD1 endonuclease could co-localize with γH2AX at DNA damage aggregation points after ionizing radiation, as shown by arrows; (D) Chromatin immunoprecipitation experiments showed that ENDOD1 endonuclease bound at 0.5, 1, and 2.5 Kb from the DNA breakpoint; (E) Chromatin immunoprecipitation experiments of single-stranded DNA binding factor (RPA32) showed that RPA32 had no obvious defects after silencing ENDOD1 endonuclease, but under the condition of co-silencing of homologous recombination repair factor (WDR70), the binding of RPA to DNA breakpoints could be eliminated; (F) Chromatin separation experiments showed that the a, b, c, and d forms of ENDOD1 endonuclease could bind tightly to chromatin;

[0112] Figure 4 , Human ENDOD1 endonuclease participates in DNA repair

[0113] (A) After silencing the ENDOD1 endonuclease gene in RPE-1 cells, DNA breaks on pcDNA3-NHEJ, pcDNA3-HR, and pcDNA3-SSA plasmids were induced by I-Sce1 to determine the DNA breakpoint repair efficiency. Silencing the ENDOD1 endonuclease gene slightly inhibited the nonhomologous end joining (NHEJ) and homologous recombination (HR) repair functions, and more importantly, promoted the single-strand DNA fusion (SSA) function; (B) As shown in Figure A, the DNA break repair efficiency was tested in RPE-1 wild-type, 2F4, and 2F6 cells; (C) Transfection of doxycycline-inducible wild-type ENDOD1 endonuclease plasmid (Wt) in ENDOD1 endonuclease gene knockout 2F4 cells corrected the above repair abnormalities; while the introduction of endonuclease-inactivated ENDOD1 endonuclease plasmids (ND, nuclease dead; ΔEND: endonuclease deleted) had no correction function. This indicates that ENDOD1 endonuclease regulates DNA repair by its endonuclease activity; (D) RPE-1 cells silenced ENDOD1 endonuclease and / or SSA functional gene (RAD52) to test DNA break repair efficiency. RAD52 silencing can reverse SSA hyperfunction caused by ENDOD1 endonuclease deficiency; (EF) Immunofluorescence showed that knocking out (E) or silencing (F) ENDOD1 endonuclease gene in RPE-1 cells can increase the accumulation of RAD52 at DNA breakpoints, indicating that ENDOD1 endonuclease inhibits SSA repair efficiency by reducing the recruitment of RAD52 to DNA damage sites. Compared with wild-type RPE-1, 2F4 and 2F6 both have RAD52 hyperfunction defects. E1, F1: Immunofluorescence staining pictures, white circles indicate the position of the cell nucleus. E2, F2: Counts of RAD52 accumulation at damage sites. Cell DNA was counterstained with DAPI. Unless otherwise specified, the statistical methods described in the article used two-tailed T test to verify the P value, and P ≤ 0.05 was considered to be significantly different. NS: no statistical difference;

[0114] Figure 5 , the regulatory mechanism of ENDOD1 endonuclease on other DNA repair factors

[0115] (A) Silencing ENDOD1 endonuclease gene expression inhibits IR-induced γH2AX and 53BP1 aggregation points; (B) RPE-1 cells (2F4 and 2F6) with knockout or mutation of ENDOD1 endonuclease cannot form IR-induced FK2 aggregation points; (C) Silencing ENDOD1 endonuclease gene expression enhances IR-induced ATM autophosphorylation (pS1981) aggregation points; (D-E) Silencing ENDOD1 endonuclease gene expression inhibits IR-induced BLM (D) and MRE11 (E) aggregation points;

[0116] Figure 6 , ENDOD1 endonuclease cleavage effect on damaged DNA

[0117] (A) ENDOD1 endonuclease-STREP tag protein purified from BL21 bacteria. Including full-length ENDOD1 endonuclease (FL), residues 22-233 and 1-344 fragments. SN: cell lysate; Pu: component of purified ENDOD1 endonuclease; (B) 0.5 μg of purified ENDOD1 endonuclease endonuclease domain fragment (22-344 residues) was added to 0.37 μg of DNA double-stranded fragment or DNA / RNA hybrid chain in enzyme digestion buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml BSA, pH 7.9). DNA double strands include three forms: blunt end (30bp), 3' (28bp) and 5'-overhang (28bp); (C) 0.5 μg of purified ENDOD1 endonuclease protein was added to 0.2 μg of various treated pEGFP-C3 plasmid DNA and digested in vitro in enzyme digestion buffer (37°C, 16 hours). ENDOD1 endonuclease can cut plasmids with structural damage, such as UV damage, DNA double strand breaks (5' and 3' overhang), and oxidative damage (hydrogen peroxide treatment). HTRA2 purified protein was used as a control without nuclease activity;

[0118] Figure 7 , ENDOD1 endonuclease gene knockout or silencing does not affect the proliferation of normal non-tumor cells

[0119] (A) ENDOD1 endonuclease gene was silenced (siEN) in normal somatic cells (RPE-1, MRC-5, GES-1 and L02) and their proliferation curves were measured; (B) Proliferation curves of ENDOD1 endonuclease wild-type and gene-edited RPE-1 cells (2F4 and 2F6);

[0120] Figure 8 , ENDOD1 endonuclease gene silencing inhibits tumor cell proliferation

[0121] (AB) The tumor cells shown were transfected with ENDOD1 endonuclease-specific siRNA (si001), and the proliferation rate was measured. Tumor cells showed two characteristics: sensitive (A) and insensitive (B). The cell proliferation fold at the experimental endpoint was calculated for MDA-MB-231, NCI-H1299, and HL60 cells; (C) Crystal violet staining was performed on some of the tested cells at the experimental endpoint, and the dark color showed the remaining living cells; (D) Immunoblotting showed the silencing effect of siENDOD1 in insensitive cells (HO8910-PM, SW480, GES-1, and L02); (E) ENDOD1 was silenced in SKOV3 cells, and doxycycline was used to induce overexpression of siENDOD1 wild-type or nuclease-inactive (ND) cells that were resistant to siENDOD1, and the cell proliferation fold was detected; (F) ENDOD1 endonuclease and RAD52 siRNA were transfected in SKOV3 cells at the same time, and the cell proliferation fold was measured;

[0122] Fig. 9 The combined lethal effect of ENDOD1 endonuclease and DNA damage response and homologous recombination repair genes

[0123] (A) The proliferation capacity of RPE-1 and 2F4 cells was measured after treatment with DNA damage response factor inhibitors or gene silencing. Live cells were stained with crystal violet; (B) The proliferation capacity and combined lethal effect of ENDOD1 endonuclease and homologous recombination repair genes such as BRCA1, BRCA2, BLM, MRE11, CTIP, EXO1, ARID1A / RID1B and WDR70 were measured after co-silencing; (C) Quantification of the combined lethal effect of ENDOD1 endonuclease and the indicated DNA repair genes. The vertical axis represents the proliferation fold of cells at the end point of the experiment (12 days); (D) The combined lethal effect of 3 different ENDOD1 endonuclease siRNAs co-silencing the BRCA1 gene on RPE-1 cells; (E) The combined lethal effect of silencing BRCA1, FANCD2 or FANCC genes in knockout cells (2F4) was measured;

[0124] Fig.10 The combined lethal effect of ENDOD1 endonuclease and tumor suppressor gene

[0125] (A) TP53 gene was silenced in RPE-1 cells or 2F4 cells with silenced ENDOD1 endonuclease, and the surviving cells were stained with crystal violet 12 days later; (B) ENDOD1 endonuclease and TP53 were simultaneously silenced in a tumor cell line with high TP53 level (HO8910-PM), and the proliferation fold and crystal violet staining at the experimental end point were measured; (C) Wild-type TP53 expression plasmid (oeTP53) was simultaneously transfected into cells with silenced ENDOD1 gene and TP53 gene homozygous and mutant (NCI-H1975), and gene complementation was performed, and the proliferation fold and crystal violet staining at the experimental end point were measured; (D) Tumor suppressor gene PTEN was silenced in RPE-1 and 2F4 cells, and the proliferation fold and crystal violet staining at the experimental end point were measured;

[0126] Fig.11 Correlation analysis between gene mutation of tumor cells and cytotoxicity of ENDOD1 endonuclease gene silencing

[0127] (A) Immunoblotting assay to detect the protein level of ENDOD1 endonuclease in the normal and tumor cell lines shown; (B) The protein level of ENDOD1 endonuclease in normal human tissues shown in the Human Protein Atlas database; (C) The expression level of ENDOD1 endonuclease in human tumor tissues from various sources in the Human Protein Atlas database; (D) The inhibitory effect of ENDOD1 endonuclease gene silencing on tumor cells with TP53 and other gene mutations (such as BRCA1, BRCA2, etc.) is significantly higher than that on non-mutated tumor cells. The differences between the groups were verified using a two-tailed T test, and P≤0.05 was considered significant.

[0128] Fig.12 , ENDOD1 endonuclease gene silencing enhances chemotherapy

[0129] Normal cells (RPE-1) and tumor cells (A549) were treated with targeted inhibitors such as CPT, cisplatin, and DNAPK after silencing ENDOD1 endonuclease, and their proliferation curves were measured;

[0130] Fig.13 The therapeutic effect of ENDOD1 endonuclease gene silencing on mouse tumor-bearing model

[0131] (A) Nude mouse subcutaneous tumor models of SKOV3, HCC1937 and OVCAR-8TR cells were established, and control or ENDOD1 endonuclease-specific siRNA (si001) was injected twice a week to measure tumor volume. All three cell lines carry TP53 or BRCA1 gene mutations; (B) The inhibition rate (T / C%) of silencing the ENDOD1 gene on the three tumor models;

[0132] Fig.14 Combined lethal effects of ENDOD1 endonuclease inhibition and active hepatitis B virus on cells

[0133] (A) The combined lethal effect of co-silencing of ENDOD1 endonuclease and WDR70 on HBV-negative hepatocytes (L02); (B) ENDOD1 endonuclease gene was silenced in HBV-positive (T43) or negative cells (L02), and their proliferation capacity was measured. PARP inhibitor (olaparib, 0.5uM) was used as a positive control for T43 cytotoxicity; (C) A nude mouse subcutaneous tumor model of T43 was established, and control or ENDOD1 endonuclease siRNA was injected in vivo twice a week to measure tumor volume (C1). At the experimental endpoint, the control and ENDOD1-silenced tumors were dissected and separated (C2); (D) A group of tumor dissection samples at the experimental endpoint; (E) HepG2.2.15 was inoculated through the tail vein of nude mice, and the ELISA method was used to determine the titer of HBV antigen (HBsAg) in the serum at the indicated time points; (F) HepG2.2.15 was inoculated through the tail vein of nude mice, and the titer of HBV viral DNA in the serum at the indicated time points was determined using a method using fluorescent quantitative PCR to determine the HBV copy number in the blood;

[0134] Fig.15 , In vitro ENDOD1 endonuclease activity titration

[0135] Flow chart of the competitive inhibition method for screening small molecule inhibitors of ENDOD1 endonuclease activity: ENDOD1 protein, linear double-stranded DNA substrate and small molecule inhibitor library are added to a 384-well PCR skirt plate. After enzyme cleavage reaction, fluorescent quantitative PCR premix containing primers is added, and fluorescent quantitative PCR is performed to detect the remaining amount of DNA substrate and enzyme cleavage efficiency to screen effective small molecule inhibitors. DETAILED DESCRIPTION

[0136] The following non-limiting examples are used to further illustrate and understand the essence of the present invention. It should be understood that the proportion changes of the components shown and the operation methods are obvious to those skilled in the art and therefore also fall within the scope of the present invention.

[0137] In the process of studying the DNA damage response mechanism, the present invention unexpectedly found that the endonuclease encoded by the ENDOD1 endonuclease gene has the function of inhibiting RAD52-mediated SSA repair, and has little effect on other DNA repair mechanisms. Literature reports believe that ENDOD1 endonuclease is a tumor suppressor gene, and silencing the gene function can promote tumor proliferation (see: Qiu, J., et al., Identification of endonuclease domain-containing 1 as a novel tumor suppressor in prostate cancer. BMC Cancer, 2017.17(1): p.360.). However, our study unexpectedly found that inhibition of ENDOD1 endonuclease function can show strong synthetic lethality with DNA damage response defects (such as ATM, CHK1), DNA repair defects (such as BRCA1, BRCA2, MRE11, FANC and hepatitis B virus positive, etc.), and can also be synthetically lethal with cells with tumor suppressor gene mutations (such as TP53, PTEN), and can effectively kill tumor cells with these defects; in in vivo tumor models with the above gene mutations or functional defects, inhibition of ENDOD1 endonuclease function can curb the progression of these tumors. In contrast, in non-tumor cells with normal DNA damage response, DNA repair mechanism and tumor suppressor gene function such as TP53, inhibition of ENDOD1 endonuclease function, or even complete knockout of ENDOD1 endonuclease gene, has no synthetic lethal effect at all and does not affect the proliferation of these cells. Moreover, inhibiting the expression or function of ENDOD1 endonuclease can make tumor cells with or without the above defects more sensitive to cytotoxic therapy (radiotherapy or chemotherapy), which has a synergistic sensitization effect, while the same drug treatment has no toxic effect on normal cells. Therefore, these studies have proved that ENDOD1 endonuclease can kill tumor cells in combination with defects in DNA damage response, DNA repair mechanism and tumor suppressor genes, and is a new broad-spectrum anti-tumor drug target.

[0138] The types and sources of the cell lines in the following examples are shown in Table 1, and the sources are ATCC, the cell bank of the Chinese Academy of Sciences, or the Institute of Biology of the Chinese Academy of Sciences in Chengdu. ENDOD1 endonuclease gene-edited RPE-1 cells (2F4 and 2F6) were constructed by Liu Cong's laboratory at the West China Second Hospital of Sichuan University. Nude mice (BALB / c-Nude strain, SPF grade, female, from the Experimental Animal Center of Sichuan University) were used in the experiments of the present invention.

[0139] The bacterial strains used in the examples are commonly used strains such as DH5a and BL21. Plasmids such as pET28a, pLVX-IRES-ZsGreen1, pcDNA3, pLVX-Tet3G, pLVX-TRE3G, and various wild types and mutants used for molecular cloning and cell expression of ENDOD1 endonuclease were manufactured by Liu Cong's laboratory at West China Second Hospital, Sichuan University. The plasmid of the I-Sce1DNA break induction system was provided by Professor Chen Jun of Zhejiang University. The CRISPR / CAS9 gene editing system used was constructed by Beijing Weishanglide Biotechnology Co., Ltd. Small interfering RNA (siRNA) was synthesized by Shanghai Ruibo Biotechnology Co., Ltd. Molecular cloning primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.

[0140] The proteins used in the examples were Lipofectamine 3000 (Invitrogen, L3000015), rabbit anti-human ENDOD1 endonuclease antibody (Abcam, Ab121293), RAD52 (LSBio, LS-C176555 / 122111), ATM-pSerine1981 (Cell Signaling, 526S), FK2 (Enzo, BML-PW8810), 53BP1 (bethyl, A300-272A), γH2AX (Millipore, 05-636), MRE11 (Cell Signaling, 526S), and γH2AX (Millipore, 05-636). Signaling, 4895), BLM (Bethyl, A300-110A-2), BRCA1 (Bethyl, A300-001A), RPA32-pSerine33 (Novus, NB100-544), cisplatin (131102, Supertrack Bio-pharmaceutical), hydroxycamptothecin (Selleck, S2423), hydroxyurea (Selleck, S1896), ATM inhibitor (Ku55933, Sel Selleck, S1092), MRE11 inhibitor (Mirin, Selleck, S8096), CHK2 inhibitor (BML-277, Selleck, S8632), DNAPK inhibitor (NU7026, Selleck, S2893), CGK733 (Selleck, S7136), ATR inhibitor (Caffeine, Sigma, C1778-5VL), 4-OHT ((Z)-4-hydroxytamoxifen) and other various reagents are used in the experiments of the present invention. Common reagent doses: IR, 8Gy; CPT, 0.0125uM; HU, 0.2mM; Cisplatin, 2ug / mL; 4-OHT, 300nM. The transfection plasmid dose is 0.25ug / 100,000 cells; the transfection siRNA dose is 0.2ug / 100,000 cells.

[0141] The information on the genomic mutation sites of the cell lines mentioned in the examples are all provided by literature or ATCC.

[0142] Hepatitis B virus surface antigen diagnostic kit (S10910113, Shanghai Kehua Bioengineering Co., Ltd.), hepatitis B virus (HBV) nucleic acid amplification (PCR) fluorescence quantitative detection kit (S20030059, Haikehua Bioengineering Co., Ltd.) and other various reagents are all used for the experiments in this invention and not for other purposes.

[0143] Table 1. Cell lines used and culture conditions

[0144]

[0145]

[0146] The gene names, IDs, genomes and chromosome locations involved in the present invention are shown in Table 2.

[0147] Table 2. Gene list

[0148] Gene NCBI Gene ID Genomic location ENDOD1 23052 11q21 TP53 7157 17p13.1 RAD52 5893 12p13.33 MRE11 4361 11q21 RAD54B 25788 8q22.1 RPA2(RPA32) 6118 1p35.3 RPA1(RPA70) 6117 17p13.3 ATM 472 11q22.3 ATR 545 3q23 CHEK1(CHK1) 1111 11q24.2 CHEK2(CHK2) 11200 22q12.1 DNAPK 5591 8q11.21 MLH1 4292 3p22.2 MSH2 4436 2p21-p16.3 XRCC1 7515 19q13.31 XRCC3 7517 14q32.33 BRCA1 672 17q21.31 BRCA2 675 13q13.1 PAXIP1 (PTIP) 22976 7q36.2 WRN 7486 8p12 FANCA 2175 16q24.3 FANCD2 2177 3p25.3 EMSY 56946 11q13.5 ARID1A 8289 1p36.11 ARID1B 57492 6q25.3 WDR70 55100 5p13.2 PTEN 5728 10q23.31 CDKN2A (p16, p14) 1029 9p21.3 APC 324 5q22.2 STK11 6794 19p13.3 FBXW7 55294 4q31.3 WT-1 7490 11p13

[0149] The terms or abbreviations used in the following examples are as follows:

[0150] IRIF (ionizing radiation-induced foci): radiation-induced foci, i.e. DNA damage sites;

[0151] AA (amino acid): amino acid (residue);

[0152] Kb (kilobase): kilobase pair;

[0153] bp (base pair): base pair

[0154] ul: microliter;

[0155] nM: nanomolar;

[0156] uM: micromolar;

[0157] Kd: kilodaltons;

[0158] Input: internal control;

[0159] ChIP: chromatin immunoprecipitation;

[0160] Ub: ubiquitin;

[0161] siScramble: random siRNA control;

[0162] NHEJ: nonhomologous end joining;

[0163] HR: homologous recombination;

[0164] SSA: single-stranded DNA fusion;

[0165] Ctrl: control;

[0166] Example 1. Characteristics of human ENDOD1 endonuclease gene and protein.

[0167] Experimental methods: The ENDOD1 endonuclease gene and protein sequences were searched through the NCBI database, and the evolutionary tree of the ENDOD1 endonuclease gene in different species and the protein functional domain of the ENDOD1 endonuclease were drawn using bioinformatics software. The ENDOD1 endonuclease gene was edited using CRISPR / CAS9 technology to obtain ENDOD1 endonuclease gene knockout or mutant cell lines; the ENDOD1 endonuclease gene was silenced using siRNA technology to knock down the expression of the ENDOD1 endonuclease gene. The proteins of RPE-1 cells were extracted, separated by SDS-PAGE electrophoresis, and transferred to polyvinylidene difluoride membranes. The ENDOD1 endonuclease protein level was detected using specific rabbit anti-human ENDOD1 endonuclease and goat anti-rabbit HRP secondary antibodies.

[0168] CRISPR / Cas9 Gene Editing

[0169] The gRNA target sequence located in exon 1 of the ENDOD1 endonuclease gene was designed: 5'-CAGCCTCTTCGCCCTGGCTGG-3', and cloned into the pCAG1-CAS9-U6-sgRNA vector. It was transfected into RPE-1 cells using the lipo3000 transfection kit, and 3 μg / mL puromycin was added 48 hours later to select transfected positive cells. Positive cell monoclones were isolated and ENDOD1 endonuclease gene knockout or mutant cell lines were screened by protein immunoblotting.

[0170] siRNA interference technology

[0171] Design and synthesis of RNA interference (RNAi) targets for the ENDOD1 endonuclease gene:

[0172] siENDOD1-001:5'-GCAAGCGGATTGGCTACAA-3';

[0173] siENDOD1-002:5'-GGATGAAGAACGAATGGTA-3';

[0174] siENDOD1-003:5'-GTGGCCACATTTACTCTCA-3';

[0175] The specific implementation of intracellular silencing of ENDOD1 endonuclease gene is as follows: ultrapure water (Invitrogen, 10977-015) is used to dissolve ENDOD1 endonuclease siRNA powder and control siRNA powder (Guangzhou Ruibo), and the storage solution (5nM) is prepared and stored at -40℃. The transfection mixture in each well of the 24-well plate is specifically prepared as follows: 5ul siRNA (5nM) and 3ul Lipofectin 3000 (Invitrogen, L300015) are added to 30ul serum-free medium opti-MEM in sequence, mixed and allowed to stand for 15min, and evenly added to the 24-well plate. 470ul complete medium is added to the cells in the 24-well plate in advance. After transfection for 24 hours, the medium is replaced with 1ml complete medium. After 48 hours, the samples are collected, the cells are dissolved in SDS sample buffer, and the silencing efficiency is detected by protein immunoblotting.

[0176] Western blotting

[0177] Equal amounts of cells (about 500,000) were collected, washed twice with PBS, centrifuged at 500 x g each time, and the cell pellets were collected. 100 μl of SDS loading buffer (50 mM Tris-HCl [pH 6.8], 2% SDS, 0.1% bromophenol blue, 100% glycerol, 5% β-mercaptoethanol) was added to lyse the cells and treated in a metal bath at 100°C for 5 minutes. Proteins were separated by polyacrylamide gel electrophoresis (80 V / 15 minutes and then 150 V / 55 minutes), and then the proteins were blotted onto polyvinylidene difluoride membranes (150 mA / 3 hours). The membrane was blocked in blocking buffer (10mM Tris-HCl [pH7.5], 150mM NaCl, 0.1% Tween, 5% BSA) for 1 hour, rabbit anti-human ENDOD1 endonuclease antibody (1:1000) was added, and after incubation at room temperature for 4 hours, it was washed 3 times with washing buffer (10mM Tris-HCl [pH7.5], 150mM NaCl, 0.1% Tween), each for 10 minutes. The membrane was then incubated in blocking buffer containing goat anti-rabbit HRP secondary antibody (1:3000) for 1 hour, and washed 3 times, each for 10 minutes. The ECL luminescent solution was used for color development, and the image was collected by BIO-RAD gel imaging system (chemidoc XRS).

[0178] Experimental results:

[0179] 1. The mRNA sequence of human ENDOD1 endonuclease gene is as follows Figure 1 As shown in A, the coding region (ORF) has a total of 1503 nucleotides. The ENDOD1 endonuclease protein sequence is shown in Figure 1 B, a total of 501 amino acids. The ENDOD1 endonuclease protein domain is shown in Figure 1 C, including a signal peptide (1-22 amino acid residues (AA)), an endonuclease domain (49-257AA), and three transmembrane sequences (I: 345-364AA, II: 411-435AA, and III: 455-482AA). Cysteine ​​C190, C224, and C269 are conserved active sites of the His-Cys endonuclease family. The ENSEMBL database shows that the ENDOD1 endonuclease genomic locus contains two exons and one intron ( Figure 1 D). Genetree software analyzed the evolutionary relationship of ENDOD1 endonuclease gene in different species and found that its homologous genes exist in higher eukaryotes such as corals, fish, vertebrates and humans, but not in lower eukaryotes such as yeast, fruit flies and nematodes ( Figure 1 E).

[0180] 2. Characteristics and post-translational modifications of human ENDOD1 endonuclease.

[0181] Western blotting to determine the protein product of ENDOD1 endonuclease in RPE-1 cells ( Figure 2 C), and its main band electrophoresis size is about 55Kd. Protein electrophoresis shows that the protein of ENDOD1 endonuclease has 4 modified or cleaved isoforms, namely 47Kd (residues 23-500, b), 42Kd (residues 23-340, c), 35Kd (residues 23-290, d) and a covalently modified form of >90Kd (e). and a covalently modified form of >90Kd (e). CISPR / CAS9 gene editing ( Figure 2 A) or siRNA gene silencing ( Figure 2 B), all electrophoretic forms of ENDOD1 endonuclease disappeared or decreased ( Figure 2 DE). Ubiquitin or its K48R, K63R mutants and the ENDOD1 endonuclease expression plasmid lacking the signal peptide (Flag-ΔN22-ENDOD1 endonuclease) were transferred into RPE-1 cells, and it was found that ENDOD1 endonuclease isoform e was produced by covalent modification of ubiquitination ( Figure 2 F). The protein structural characteristics of ENDOD1 endonuclease were analyzed by bioinformatics software such as PrediSci and NetSurfP-2.0, and it was found that residues 300-325 are the low-order region of the protein and are also potential protease cleavage sites ( Figure 2 GH), which can work together with the enzymatic cleavage activity of the LEG-RL signal peptide sequence near residue 22 to produce the b, c, and d isoforms of the ENDOD1 endonuclease protein.

[0182] Example 2: Human ENDOD1 endonuclease is involved in DNA repair.

[0183] Experimental methods: Immunofluorescence, chromatin immunoprecipitation (ChIP) and nuclear-cytoplasmic fractionation were used to characterize the subcellular localization and distribution of ENDOD1 endonuclease protein. ChIP experiments were carried out in DiVA cells. The expression of AsiSI-ER endonuclease was induced by 4-OHT, and DNA breaks were generated at chromosome Chr1:89,458,595-89,458,603. After 4-OHT induction for 4 hours, the corresponding proteins were precipitated using specific antibodies (anti-ENDOD1 endonuclease or anti-Flag). The enrichment level of the protein at the DNA break site was determined by PCR amplification. The cell component separation experiment (cytoplasm / nuclear membrane / chromatin) was described in the literature (see: Yu, Z., Z. Huang, and MJBPLung, Subcellular Fractionation of Cultured Human Cell Lines. Bio Protocol, 2013.3 (9)), and a step of 0.1% Triton-X100 was added to dissolve the nuclear membrane and Golgi apparatus.

[0184] Immunofluorescence

[0185] The cells were fixed and cultured on glass slides by conventional cell culture, fixed with 4% PFA for 10 minutes, washed with PBS, and then perforated with 0.3% Triton / PBS. The primary antibody was diluted proportionally in blocking buffer (2% BSA, 0.3% Triton / PBS), and the cells were incubated at 37°C for 3 minutes and washed twice with PBS. The secondary antibody was diluted proportionally in blocking buffer (2% BSA, 0.3% Triton / PBS), and the cells were incubated again at 37°C for 30 minutes and washed twice with PBS. After sealing with antifade dye containing DAPI (Vector Laboratories), the slides were observed under an upright fluorescence microscope (Olympus, BX51) and pictures were collected. The number of foci in the cell nucleus (DAPI staining) was counted, and the counting results were visualized by Graphpad Prism (v8.4.0.671) software. The differences between the groups were tested using a two-tailed T test, and P≤0.05 was considered to be significantly different.

[0186] Chromatin immunoprecipitation (ChIP)

[0187] About 5 million cells were collected and cross-linked in a final concentration of 1% formaldehyde for 15 min. 2.5 M glycine was added to terminate the cross-linking. The cells were washed twice with PBS and resuspended in 300 ul ChIP lysis buffer (50 mM HEPES [pH 7.4]; 140 mM NaCl; 1% TritonX100; 0.1% NaDeoxycholate; protease inhibitors). The cells were lysed at 4°C for 30 min. After centrifugation at 10,000 x g, the pellet was washed once in 1 ml ChIP lysis buffer and resuspended in 300 ul ChIP lysis buffer. The DNA was sheared at about 500 bp by a Biorupter ultrasonic disruptor. The pellet was centrifuged at 21,000 x g and discarded. After incubation with antibodies for 1 h, protein G magnetic beads (Invitrogen) were added, or anti-Flag M2 magnetic beads (Sigma) were directly added, and incubated overnight at 4°C. The magnetic beads were washed twice with ChIP lysis buffer, ChIP high salt lysis buffer (50mM HEPES [pH 7.4]; 500mM NaCl; 1% Triton X100; 0.1% NaDeoxycholate), ChIP washing buffer (10mM Tris [pH 8.0]; 250mM LiCl; 0.5% NP-40; 0.5% NaDeoxycholate; 1mM EDTA), and TE buffer (10mM Tris-HCl [pH 8.0]; 1mM EDTA), and then added with ChIP elution buffer (50mM Tris [pH 8.0]; 1% SDS; 10mM EDTA) for reverse crosslinking at 65°C for 1 hour. The eluted liquid was purified and recovered in 30ul of water using a DNA purification kit (Omega), and 5ul was taken for quantitative analysis.

[0188] Nuclear and cytoplasmic separation

[0189] About 2 million cells were collected, washed twice with PBS, and resuspended in 200 μL lysis buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 0.1% Triton, protease inhibitor). After incubation on ice for 5 minutes, centrifugation was performed at 1500 x g for 5 minutes, and the supernatant and precipitate were collected separately. The supernatant is the cell membrane and cytoplasmic proteins, and 50 μL 5 X SDS loading buffer was directly added to extract the proteins. The precipitate was washed once in 1 mL of lysis buffer A without Triton, centrifuged at 1500 x g for 5 minutes, and resuspended in 200 μL lysis buffer A. After incubation on ice for 5-10 minutes, centrifugation was performed at 1500 x g for 5 minutes. The supernatant is the nuclear membrane part, and 50 μL 5 X SDS loading buffer was directly added to extract the proteins. The precipitate was washed once in 1 mL of lysis buffer A without Triton, centrifuged at 1500x g for 5 minutes, and then resuspended in 200 μL of lysis buffer B (3mM EDTA, 0.2mM EGTA, 1mM dithiothreitol, protease inhibitor), incubated on ice for 10 minutes, and centrifuged at 2000x g for 5 minutes. The supernatant is soluble nuclear protein, and 50 μL 5 X SDS loading buffer was directly added to extract protein. The precipitate was washed once in 1 mL of lysis buffer B, centrifuged at 13000x g for 1 minute, the supernatant was discarded, and the precipitate was dissolved in 100 μL SDS loading buffer. All samples were treated in a metal bath at 100℃ for 5 minutes and detected by protein immunoblotting. Total: total cell protein, the loading amount is 2.5% of the total; Membrane: nuclear membrane and Golgi apparatus, etc., the loading amount is 10% of the total; Chromatin: chromatin protein, the loading amount is 10% of the total.

[0190] Experimental results:

[0191] In order to analyze the biological function of ENDOD1 endonuclease, the present invention confirms through a series of biological experiments that ENDOD1 endonuclease aggregates and activates at DNA damage sites, participates in DNA repair, and ensures the stability of genetic material.

[0192] 1. Human ENDOD1 endonuclease directly binds to DNA damage sites

[0193] When DNA is damaged, proteins involved in DNA repair become activated and aggregate to the damaged site. This aggregation can be demonstrated by immunofluorescence staining to show the changes in the localization of various signals and repair factors after DNA damage. Immunofluorescence showed that ENDOD1 endonuclease is mainly localized in the cytoplasm and nuclear membrane in normally growing cells. After DNA damage (ionizing radiation), ENDOD1 endonuclease can enter the DNA breakpoint within 40 minutes to form ENDOD1 endonuclease aggregation points, which will persist until 2 hours after irradiation ( Figure 3 A). ENDOD1 endonuclease can also form aggregation points after treatment with DNA replication poisons (CPT and HU), indicating that ENDOD1 endonuclease is also involved in the elimination of DNA replication errors ( Figure 3 B). In addition, the aggregation points of ENDOD1 endonuclease at DNA breaks can co-localize with the classic marker protein (γH2AX) of DNA damage sites ( Figure 3 C), indicating that after DNA damage, ENDOD1 endonuclease is actively recruited to DNA breakpoints as a repair factor.

[0194] 2. ENDOD1 endonuclease directly binds to the DNA breakpoint end

[0195] In the ChIP experiment, ENDOD1 endonuclease binds at 0.5Kb, 1Kb, and 2.5Kb from the DNA breakpoint ( Figure 3 D), further proving that ENDOD1 endonuclease directly aggregates to the end of the DNA damage site. ChIP experiments also proved that one of the functions of ENDOD1 endonuclease at DNA breakpoints is to participate in DNA end resection: although silencing ENDOD1 endonuclease alone did not reduce the enrichment of single-stranded DNA binding protein (RPA32) near the breakpoint, in the case of defects in other end resection regulatory factors (such as WDR70), silencing ENDOD1 endonuclease can aggravate the enrichment of RPA32 to DNA breakpoints, resulting in complete inhibition of RPA32 recruitment ( Figure 3 E) These experiments demonstrate that the combined loss of homologous recombination repair and ENDOD1 endonuclease function results in severe DNA repair defects.

[0196] Through the separation experiment of cytoplasm-nuclear membrane-chromatin components, it was proved that the a, b, c, and d forms of ENDOD1 nuclease protein can be tightly bound to chromatin, and the distribution of ENDOD1 nuclease on chromatin accounts for 25% of the total protein ( Figure 3 F).

[0197] Together, these results suggest that ENDOD1 endonuclease protein actively responds to cellular DNA damage and is recruited to DNA breakpoints, participating in the response regulation of DNA repair.

[0198] Example 3: Human ENDOD1 endonuclease inhibits SSA repair function.

[0199] Experimental methods: I-Sce1 endonuclease was used to induce DNA breaks (see: Liu, J., et al., Development of novel visual-plus quantitative analysis systems for studying DNA double-strand break repairs in zebrafish. J Genet Genomics, 2012. 39(9): p.489-502.), and the relative efficiency of HR, NHEJ and SSA repair was determined by fluorescence quantitative PCR. Functional complementation experiments were performed on ENDOD1 endonuclease-deficient cells (2F4) using wild-type (pLVX-TRE3G-ENDOD1 endonuclease, i.e., ENDOD1 endonuclease) or mutant ENDOD1 endonuclease plasmids (pLVX-TRE3G-ENDOD1 endonuclease inactive, i.e., ND; pLVX-TRE3G-ENDOD1 endonuclease deleted, i.e., ΔEND) inducible by doxycycline. Immunofluorescence experiments were used to determine the ability of various related DNA repair factors to accumulate at DNA damage sites in cells deficient in ENDOD1 nuclease after DNA damage (IR).

[0200] Determination of DNA break repair efficiency

[0201] The pcDNA3-NHEJ, pcDNA3-HR, and pcDNA3-SSA plasmids were digested in vitro with I-Sce1 endonuclease (NEB) (16°C, 16 hours), and 2 volumes of anhydrous ethanol and 1 / 20 volume of 3M sodium acetate were added to precipitate the DNA. The recovered DNA was adjusted to a concentration of 1 μg / μL. The cells were first treated with siRNA or other methods, and 24 hours later, the linearized pcDNA3-NHEJ, pcDNA3-HR, and pcDNA3-SSA plasmids were transfected (Lipo3000) into the differently treated cells, and the cells (about 1 million) were collected after 24 hours of continuous culture. The total cell DNA was recovered using a high-purity DNA extraction kit (Roche), and real-time fluorescence quantitative PCR (BIO-RAD) was performed to analyze the efficiency of different repair pathways.

[0202] Construction and expression of ENDOD1 endonuclease and its mutant plasmid

[0203] The ENDOD1 endonuclease gene and its corresponding mutants ND and ΔEND were obtained by DNA synthesis (Shanghai Sangon Biotechnology Co., Ltd.), and subcloned into the pLVX-TRE3G vector through the EcoR1 site after PCR amplification. The corresponding plasmids were co-transfected (Lipo3000) with pLVX-Tet3G into cells, and doxycycline (200 ng / mL) was used to induce the expression of the corresponding genes after 24 hours of culture.

[0204] Experimental results:

[0205] DNA breakage damage is mainly repaired through three pathways: non-homologous end joining (NHEJ), homologous recombination (HR) and single-stranded DNA fusion (SSA), and is regulated by a variety of repair factors, among which the degree of DNA end cutback to form single-stranded DNA is an important regulatory event for selecting these repair pathways. Based on the findings in Example 2, more experiments have shown that ENDOD1 endonuclease is directly recruited to DNA breakpoints and regulates DNA end cutback, and is an important molecule for regulating the selection of repair pathways.

[0206] 1. ENDOD1 endonuclease inhibits the SSA repair pathway

[0207] By in vitro I-Sce1 digestion of pcDNA3-NHEJ, pcDNA3-HR, and pcDNA3-SSA plasmids to form linearized plasmids with site-specific DNA breaks, and transfecting them into RPE-1 cells with silenced ENDOD1 endonuclease gene, the repair efficiency of the three pathways of DNA breakpoints can be measured. It was found that silencing of ENDOD1 endonuclease gene can slightly inhibit non-homologous end joining (NHEJ) and homologous recombination (HR) repair functions, and more importantly, promote the function of single-stranded DNA fusion (SSA) ( Figure 4 A). Similarly, the repair efficiency of I-Sce1-induced DNA breaks was tested in RPE-1 wild-type, 2F4, and 2F6 cells, and it was found that the repair efficiency of SSA in ENDOD1 endonuclease-deficient 2F4 and 2F6 cell lines was significantly higher than that in wild-type RPE-1 cells ( Figure 4 B) These results suggest that the ENDOD1 endonuclease factor can inhibit the SSA repair pathway at the site of DNA damage.

[0208] 2. ENDOD1 endonuclease effectively inhibits the SSA repair pathway through its endonuclease function

[0209] Transfection of 2F4 cells with ENDOD1 endonuclease knockout with a doxycycline-inducible wild-type ENDOD1 endonuclease plasmid (Wt) reduced SSA levels to the level of normal cells; however, introduction of endonuclease-inactivating ENDOD1 endonuclease mutant plasmids (ND and ΔEND) had no corresponding correction function ( Figure 4 C), indicating that ENDOD1 endonuclease inhibits the SSA repair pathway by its endonuclease activity.

[0210] 3. ENDOD1 endonuclease inhibits SSA function by regulating RAD52

[0211] RAD52 is an important protein that regulates SSA repair. To analyze the specific function of ENDOD1 endonuclease in the SSA pathway, ENDOD1 endonuclease and / or SSA functional gene (RAD52) were silenced in RPE-1 cells, and their repair functions after I-Sce1-induced DNA breaks were tested. It was found that RAD52 silencing could completely reverse the SSA hyperfunction caused by ENDOD1 endonuclease deficiency ( Figure 4 D), indicating that the function of ENDOD1 endonuclease in inhibiting SSA depends on RAD52.

[0212] Immunofluorescence experiments showed that ENDOD1 endonuclease gene knockout ( Figure 4 E) or silence ( Figure 4 F) RPE-1 cells showed a higher level of IR-induced RAD52 aggregation formation, further demonstrating that ENDOD1 endonuclease inhibits the repair function of RAD52 at DNA breakpoints. Compared with wild-type RPE-1, 2F4 and 2F6 both had defects in RAD52 hyperfunction, indicating that in addition to the main band (55Kd) of ENDOD1 endonuclease protein, its post-translational processing and b, c, d isoforms are also involved in the regulation of RAD52 and SSA.

[0213] 4. Regulatory effects of ENDOD1 endonuclease on other DNA repair factors

[0214] The expression of ENDOD1 endonuclease gene was silenced in RPE-1 cells for 48 hours and then IR was performed to measure the accumulation level of various DNA repair factors at the damage site. Figure 5 A) FK2( Figure 5 B) BLM Figure 5 D) and MRE11( Figure 5 E) The aggregation level in RPE-1 cells with silenced or edited ENDOD1 endonuclease was lower than that in wild-type cells, while the aggregation ability of ATM autophosphorylation was increased in defective cells ( Figure 5C) These results suggest that ENDOD1 endonuclease regulates DNA repair together with MRE11, FK2, BLM, γH2AX and 53BP1, while antagonizing the autophosphorylation function of ATM.

[0215] It can be seen that the main function of ENDOD1 endonuclease is to participate in DNA break repair, and to work synergistically with MRE11, γH2AX and 53BP1 to inhibit the SSA pathway regulated by RAD52, and this process depends on its endonuclease activity.

[0216] Example 4: ENDOD1 endonuclease has endonuclease activity.

[0217] Experimental methods:

[0218] Expression and purification of ENDOD1 endonuclease-STREP protein

[0219] The full-length ENDOD1 endonuclease gene and its mutants were amplified by PCR and subcloned into the pGEX4T1-2strep vector and transformed into the BL21 Escherichia coli strain. The bacteria carrying the ENDOD1 endonuclease plasmid were cultured at 37°C to the logarithmic growth phase (OD = 0.6), and 1mM IPTG was added to induce protein expression. The bacteria were collected by centrifugation after further culture at 18°C ​​for 16 hours. The cells were resuspended in NETN lysis buffer (100mM NaCl, 20mM Tris-Cl [pH 8.0], 0.5mM EDTA 0.5% Nonidet P-40), and the cells were disrupted by ultrasound and centrifuged at 21000x g to collect the supernatant. Strep-Tactin XT magnetic beads (iba) pre-washed with NETN lysis buffer were added to the supernatant, incubated at 4°C for 2 hours, and the supernatant was discarded. The magnetic beads were washed 5 times with NETN lysis buffer, and the purified protein was extracted by adding SDS loading buffer. The purified protein was detected by protein immunoblotting.

[0220] DNA cleavage reaction in vitro

[0221] DNA double-stranded fragments (28-30 bp) or DNA / RNA hybrid chains (30 bp) were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The pEGFP plasmid was cut with restriction endonucleases ApaI, BamHI, and SmaI to obtain plasmids with DNA double-strand breaks (5', 3' overhangs and blunt ends), and then exposed to ultraviolet light (1200 J / m 2) and hydrogen peroxide (0.03%, 1h) to obtain damaged plasmids. The treated DNA was recovered using a DNA purification kit and subjected to restriction digestion reaction. The total reaction volume was 20 μl: 50 mM Tris-HCl [pH 7.9], 100 mM NaCl, 10 mM MgCl2, 100 μg / ml BSA, 0.5 μg ENDOD1 protein, 0.2 μg (plasmid) or 0.4 μg (synthetic double-stranded DNA fragment) substrate, and after in vitro digestion at 37°C for 16 hours (plasmid) or 4 hours (synthetic double-stranded DNA fragment), agarose gel or sequencing gel electrophoresis was performed, and DNA was stained with Gel-Stain dye and images were collected.

[0222] Experimental results: ENDOD1 endonuclease has a classic endonuclease domain. To verify its endonuclease activity, we used bacteria to express and purify ENDOD1 endonuclease-STREP protein, including ENDOD1 endonuclease full length (FL) and polypeptide fragments (1-344, 22-344) ( Figure 6 A) and tested its enzyme cleavage reaction on different types of DNA. 0.5 μg of the nuclease domain fragment of ENDOD1 (22-344 residues) and 0.37 μg of double-stranded DNA fragments (blunt ends, 3' and 5'-overhang) or DNA / RNA hybrid chains were digested in vitro in enzyme cleavage buffer (37°C, 2 hours). The ENDOD1 fragment can cleave these nucleic acid substrates to form smaller fragments ( Figure 6 B). 0.5 μg of purified ENDOD1 endonuclease (1-344 residues and full length (FL)) was added to 0.2 μg of various pEGFP-C3 plasmid DNAs and digested in vitro in buffer (37°C, 16 hours). The results showed that ENDOD1 endonuclease can cleave DNA molecules with structural damage, such as UV damage, DNA double-strand breaks (5' and 3' overhangs), and oxidative damage (hydrogen peroxide treatment), but has no cleavage effect on intact plasmids ( Figure 6 C).

[0223] Example 5: ENDOD1 endonuclease gene function inhibition specifically attacks tumor cells but does not affect the proliferation of normal non-tumor cells.

[0224] Experimental method: knock out or silence the ENDOD1 endonuclease gene in normal or tumor cells, and continuously passage or silence the cells to measure their proliferation curve. Most cell experiments last for 21 days. Count the number of surviving cells at the indicated time points and the end of the experiment and record them in a graph. Calculate the proliferation rate based on the cell counting results: proliferation rate = (N t -N0) / N t *100%, where Nt is the absolute value of the cell count at the end of the experiment, and N0 is the initial cell inoculation number. The proliferation rates of the control group and the experimental group at the end of the experiment for all the tested cell lines were tested by two-tailed t-test. P<0.05 was considered to be statistically significant.

[0225] Crystal violet staining:

[0226] Dissolve 10g of crystal violet (Solarbio, C8470) powder in methanol to prepare a 10% storage solution. At the end of the cell experiment, fix the cells with methanol for 10 minutes and air dry. Dilute the crystal violet storage solution with PBS at a ratio of 1:10 to prepare the working solution. After fixation, stain the cell samples with the working solution for 10 minutes, wash with water, and air dry. Observe and scan the stored images.

[0227] Experimental results:

[0228] DNA damage response is an important mechanism for eukaryotic cells to maintain genome stability. When the damage cannot be repaired normally, it will lead to cell death. Example 3 has confirmed that silencing of the ENDOD1 endonuclease gene leads to abnormal regulation of the SSA pathway by RAD52, affecting DNA repair and possibly affecting cell survival. Therefore, we used cell proliferation experiments to determine the effect of ENDOD1 endonuclease on the proliferation ability of different types of cells, and found that silencing of the ENDOD1 endonuclease gene has a specific inhibitory effect on tumor cells, but does not affect the survival of normal cells, indicating that inhibition of ENDOD1 endonuclease function has potential tumor treatment effects. The specific results are as follows:

[0229] 1. Knockout or silencing of the ENDOD1 endonuclease gene does not affect the proliferation of normal non-tumor cells

[0230] The proliferation curves of normal somatic cells (RPE-1, MRC-5, GES-1 and L02) were measured after silencing or knocking out the ENDOD1 endonuclease gene expression for 21 days ( Figure 7 AB). It can be seen that there is no statistical difference in the proliferation rate between wild-type ENDOD1 endonuclease and non-tumor cells with gene function inhibition (NS).

[0231] 2. ENDOD1 endonuclease gene silencing inhibits tumor cell proliferation

[0232] Figure 8 As shown in A, after silencing ENDOD1 endonuclease, the proliferation of various tumor cells showed complete or partial inhibition, and even cell death, with statistical differences; the proliferation of a small number of tumors was not affected after silencing ENDOD1 endonuclease ( Figure 8AC). Furthermore, it was demonstrated that ENDOD1 gene expression could be effectively silenced in cells insensitive to ENDOD1 endonuclease (HO8910-PM, SW480, GES-1, and L02) ( Figure 8 D), indicating that these cells are not resistant to siENDOD1 due to difficulties in gene transfection, but rather exhibit survival differences due to other genetic mechanisms.

[0233] 3. The toxicity of reduced ENDOD1 endonuclease function to tumor cells depends on endonuclease activity

[0234] In SKOV3 cells, ENDOD1 endonuclease was silenced (si001) and doxycycline-inducible and si001-resistant ENDOD1 endonuclease wild-type or endonuclease mutant (ND) was transfected. It was found that ENDOD1 endonuclease wild-type plasmid could rescue the cytotoxicity of si001, while ENDOD1 endonuclease plasmid with loss of endonuclease function had no rescue ability ( Figure 8 E), indicating that the toxicity of ENDOD1 endonuclease to tumor cells requires functional ENDOD1 endonuclease activity.

[0235] 4. The toxicity of reduced ENDOD1 endonuclease function to tumor cells depends on the increase of SSA activity

[0236] In SKOV3 cells, it was found that simultaneous silencing of RAD52 gene expression could reduce the toxicity of ENDOD1 silencing to SKOV3. Figure 8 F). This indicates that the toxicity of ENDOD1 endonuclease to tumor cells depends on the function of RAD52, and also indicates that the hyperactivity of SSA function can mediate the toxicity of ENDOD1 endonuclease to tumor cells.

[0237] Therefore, Example 5 shows that tumors can be specifically treated or prevented by administering a sufficient dose of ENDOD1 endonuclease inhibitory drugs to the treated subject, but they have no killing effect on normal non-tumor cells. The same principle also applies to drugs that can increase the activity of SSA (SSA enhancers), because it can be predicted that ENDOD1 inhibitory drugs can effectively enhance the activity of SSA, and killing tumors depends on the increase in the activity of SSA (such as RAD52), and increasing the level of SSA repair can also obtain a cytotoxic effect similar to that of inhibiting ENDOD1 endonuclease function or gene expression. Therefore, it can be inferred that other SSA enhancers should also have the same therapeutic effect.

[0238] Example 6: The combined lethal effect of ENDOD1 endonuclease and DNA damage response and homologous recombination repair genes.

[0239] Experimental methods: ENDOD1 endonuclease was silenced together with other functional genes or used in combination with enzyme inhibitors in RPE-1 and 2F4 cells, and cell proliferation ability was determined by cell counting or crystal violet staining.

[0240] Experimental results:

[0241] Most tumor cells have defects in DNA damage repair. To study the mechanism by which ENDOD1 endonuclease gene deletion specifically inhibits tumor cell proliferation, the present invention uses gene silencing or enzyme inhibitors to interfere with the function of DNA damage response or repair factors to simulate DNA response defects in tumor cells. It is found that ENDOD1 endonuclease gene silencing and defects in most DNA damage response factors including ATM, CHK1 and homologous recombination repair factors are jointly lethal. The specific results are as follows:

[0242] 1. ENDOD1 endonuclease gene silencing and DNA damage response factors cause combined lethality.

[0243] RPE-1 and 2F4 cells were treated with inhibitors of DNA damage response factors, including ATM kinase inhibitor (Ku55933, 20uM); PIKK inhibitor (CGK733, 1ug / ml); ATR inhibitor (Caffeine, 10ug / ml); DNAPK kinase inhibitor (NU7026, 1uM); CHK2 kinase inhibitor (BML-277, 1uM); MRE11 nuclease inhibitor (Mirin 20uM); or siRNA was used to silence CHK1 expression. Live cell staining was performed 12 days later, and it was found that silencing of the ENDOD1 nuclease gene combined with ATM inhibitors, MRE inhibitors and CHK1 silencing was lethal to RPE-1 cells ( Fig. 9 A). These results suggest that inhibition of ENDOD1 endonuclease function could have a selective therapeutic effect on tumors with ATM, MRE11, and CHK1 gene mutations or dysfunctions.

[0244] Therefore, the ENDOD1 endonuclease inhibitory drug ENDOD1 or SSA enhancer can be administered to the subject at a sufficient dose to treat or prevent tumors with DNA response defects, including tumors with ATM, ATR, CHK1, CHK2, DNAPK gene mutations, gene expression or function defects, or tumors with CDC25A, CDC25B, CDC25C, Cyclin E, CyclinB1, and Cyclin D1 overexpression characteristics.

[0245] 2. ENDOD1 endonuclease gene silencing and homologous recombination repair factors combined to cause lethality.

[0246] The proliferation capacity of RPE-1 cells was determined by silencing the expression of ENDOD1 endonuclease gene and silencing DNA repair genes such as BRCA1, BRCA2, BLM, MRE11, CTIP, EXO1, MSH1, ARID1A / RID1B and WDR70. Fig. 9 BC). ENDOD1 endonuclease showed combined lethality when combined with BRCA1, BRCA2, CTIP, EXO1, ARID1A / RID1B and WDR70 genes, but had no significant combined lethality with BLM. In addition, three specific ENDOD1 endonuclease siRNAs could produce combined lethality with siBRCA1 ( Fig. 9 D), 2F4 cells knocked out of ENDOD1 endonuclease also caused lethality in combination with BRCA1 and FANCD2 / FANCC gene silencing ( Fig. 9 E). The combined lethal effect of ENDOD1 endonuclease and homologous recombination repair factors was further confirmed. These evidences indicate that inhibiting ENDOD1 endonuclease gene expression or protein function can selectively treat tumors with homologous recombination gene mutations or dysfunctions such as BRCA1, BRCA2, FANC, CTIP, EXO1, ARID1A / RID1B and WDR70.

[0247] Therefore, the ENDOD1 endonuclease inhibitor or SSA enhancer can be administered to the subject at a sufficient dose to treat or prevent tumors with DNA damage repair defects, including homologous recombination repair defects, base excision repair defects, nucleotide excision defects, single-strand DNA break repair defects, and tumors with gene mutations or functional defects related to these repair mechanisms. These tumors include but are not limited to the following characteristics: mutations, gene expression or functional defects of genes such as DNA ligase I, DNA ligase II, DNA ligase III, DNA ligase IV, BRCA1, BRCA2, PTIP, WRN, Fanconi, EMSY, ARID1A, ARID1B and WDR70; or overexpression of oncogenes that inhibit DNA repair function, such as CDK12; or liver cancer or cholangiocarcinoma with hepatitis B virus infection and viral gene expression.

[0248] Example 7: The combined lethal effect of ENDOD1 endonuclease and tumor suppressor gene.

[0249] Experimental methods: ENDOD1 endonuclease and TP53 functional gene were silenced together in RPE-1 or tumor cells, and the cell proliferation ability was measured. TP53 expression plasmid was transferred into tumor cells, and the expression of ENDOD1 endonuclease gene was silenced at the same time. Cell counting or crystal violet staining was used to measure the rescue effect of the restored functional TP53 gene on the cytotoxicity of ENDOD1 endonuclease.

[0250] Experimental results:

[0251] 1. The combined lethal effect of ENDOD1 endonuclease and tumor suppressor gene TP53

[0252] A large number of studies have shown that TP53, PTEN, etc. are important tumor suppressor genes, which are mutated or inactivated in 60-80% of human tumors. To further understand the mechanism by which silencing the ENDOD1 endonuclease gene specifically inhibits tumor cell proliferation, cell survival was measured after silencing the ENDOD1 endonuclease and TP53 genes in RPE-1 wild-type cells or silencing TP53 in ENDOD1 endonuclease gene knockout (2F4) cells. It was found that ENDOD1 endonuclease dysfunction caused cells to be highly sensitive to the loss of TP53 gene function ( Fig.10 A). Similarly, silencing ENDOD1 endonuclease and TP53 simultaneously in a cell line with high TP53 levels (HO8910-PM) revealed that the cells lost their viability and proliferation ability ( Fig.10 B) This indicates that intact ENDOD1 endonuclease gene function is essential for maintaining viability in tumor cells with TP53 mutations or loss of function.

[0253] 2. Restoring TP53 function in TP53 mutant cells can suppress the cytotoxic effect of silencing ENDOD1 endonuclease

[0254] Furthermore, by plasmid transfection to express wild-type TP53, it was found that the cell line (NCI-H1975) with homozygous mutation of TP53 gene and sensitive to silencing of ENDOD1 endonuclease gene became no longer sensitive, indicating that restoring TP53 function can effectively eliminate the cytotoxic effect of ENDOD1 endonuclease function inhibition on tumor cells that have lost TP53 function ( Fig.10 C). These experiments further demonstrate that the loss of TP53 gene function directly leads to the sensitivity of tumor cells to ENDOD1 endonuclease function inhibition, and also suggest that ENDOD1 endonuclease function inhibition can have a selective therapeutic effect on tumors with TP53 gene mutations or dysfunction.

[0255] 3. The combined lethal effect of other tumor suppressor genes and ENDOD1 endonuclease gene silencing

[0256] The PTEN tumor suppressor gene was silenced in RPE-1 and 2F4 cells, and it was found that 2F4 had a relatively high sensitivity to PTEN silencing ( Fig.10 D). This indicates that inhibition of tumor suppressor genes other than TP53 can also be combined with inhibition of ENDOD1 endonuclease function to cause lethality.

[0257] Therefore, a sufficient dose of ENDOD1 endonuclease inhibitory drugs or SSA enhancers can be administered to the subject to treat or prevent tumors with mutations in tumor suppressor genes such as TP53 and PTEN, or defects in gene expression or function.

[0258] Example 8. Analysis of the correlation between tumor cell gene mutation and ENDOD1 endonuclease gene silencing cytotoxicity.

[0259] Experimental methods:

[0260] The protein levels of ENDOD1 endonuclease in human normal and tumor cell lines were detected by immunoblotting. The protein abundance of ENDOD1 endonuclease in normal and tumor tissues was collected from the Human Protein Atlas database.

[0261] Calculation of proliferation inhibition rate

[0262] The calculation formula of the inhibition rate of tumor cell proliferation shown in Table 3 is: inhibition rate = (1-Nt / Nc)%; wherein Nt represents the cell count of the drug group at the experimental endpoint, and Nc represents the cell count of the control group at the experimental endpoint.

[0263] Experimental results:

[0264] 1. Western blotting detected that ENDOD1 endonuclease protein was ubiquitously expressed in normal (RPE-1,) and tumor cell lines (SKOV-3, NCI-H1975, NCI-H1299, HL60, MRC-5, RPE-1, MDA-MB-231, U2OS, MDA-MB-468, Raji, OVCAR-8TR) of different tissue origins. Fig.11 A).

[0265] 2. The Human Protein Atlas database shows that ENDOD1 endonuclease shows medium to high levels of protein expression in most normal tissues ( Fig.11 B); ENDOD1 endonuclease also had significant protein expression levels in more than half of the tumor tissues ( Fig.11C), including glioma, thyroid cancer, colorectal cancer, head and neck cancer, gastric cancer, pancreatic cancer, lung cancer, kidney cancer, prostate cancer, breast cancer, endometrial cancer, ovarian cancer, melanoma and skin cancer, etc. The expression ratio of ENDOD1 endonuclease is low in some tumors (such as testicular cancer and lymphoma).

[0266] 3. Table 3 shows the cytotoxicity of ENDOD1 endonuclease to the 25 tumor cells tested and the gene mutations carried by the cells. Statistical analysis showed that tumor cells with TP53 or other gene mutations (BRCA1, BRCA2, or with HBV, HPV virus, etc.) are much more sensitive to silencing of ENDOD1 endonuclease gene than tumor cells without these mutations ( Fig.11 D). SPSS software was further used to analyze the Pearson correlation coefficient between TP53 mutation and other types of tumor gene mutation and ENDOD1 gene silencing inhibition rate, and it was found that the two were highly correlated (PearsonCorrelation: 0.708, p<0.0001), indicating that tumor cells with these mutations are much more sensitive to ENDOD1 gene silencing than non-mutated cells.

[0267] Table 3. Mutation characteristics of various human normal and tumor cell lines and the inhibition rate of cell proliferation after ENDOD1 endonuclease gene silencing. (wt: wild type; mu: mutant; null: complete deletion mutation; homo: homozygous mutation)

[0268]

[0269]

[0270]

[0271] Example 9: Sensitization effect of ENDOD1 endonuclease function inhibition on tumor chemotherapy.

[0272] Experimental methods:

[0273] 10,000 cells (RPE-1 or A549) were seeded in 24-well plates, and ENDOD1 endonuclease gene silencing experiments were performed 24 hours later, and drug treatment was continued (drug concentrations are shown in Fig.12 ). The cell proliferation fold was calculated at the end point of the experiment (14 days).

[0274] Experimental results:

[0275] Normal cells (RPE-1) silenced by ENDOD1 siRNA were insensitive to chemotherapy drugs, ENDOD1 gene silencing or combined treatment ( Fig.12, left), but tumor cells (A549) are more sensitive to chemotherapy drugs, and their sensitivity to camptothecin (CPT), cisplatin, and DNAPK inhibitor (Nu7062) is greatly improved after silencing ENDOD1 endonuclease ( Fig.12 ,right).

[0276] Therefore, giving the subject a sufficient dose of ENDOD1 endonuclease inhibitory drugs can sensitize low-dose chemoradiotherapy and be used to treat tumors that have no effective clinical response to radiation or chemotherapy alone. Potential combination therapy drugs include platinum, mitomycin C, camptothecin, PARP inhibitors, DNAPK inhibitors, radioisotopes, vinca alkaloids, anti-tumor alkylating drugs, monoclonal antibodies, and antimetabolites. These treatment methods can be used simultaneously or sequentially to reflect a synergistic effect, making the treatment effect better than the method of using drugs that inhibit ENDOD1 function or anti-tumor drugs alone.

[0277] Example 10: The therapeutic effect of ENDOD1 endonuclease gene silencing on mouse tumor-bearing model.

[0278] Experimental methods:

[0279] Nude mouse tumor model

[0280] Preclinical animal tumor bearing experiments were conducted at the Experimental Animal Center of West China Second Hospital, Sichuan University (SPF grade). Athymic male nude mice aged 1 week were isolated and observed for one week (purchased from Nanjing Model Animal Research Center) and randomly divided into 3 groups. Each mouse was inoculated with tumor cells in the axilla and groin, with the number of inoculation being 4x10 6 .

[0281] In vivo gene silencing

[0282] The volume of the inoculated tumor is about 100 mm 3 In vivo gene silencing of ENDOD1 endonuclease was performed. The specific implementation was as follows: ultrapure water (invitrogen, 10977-015) was used to dissolve ENDOD1 endonuclease in vivo siRNA powder and control siRNA powder (Guangzhou Ruibo), and the working solution (1ug / ul) was prepared and stored at -40℃. 10% glucose was prepared with ultrapure water, filtered, and stored at -40℃ for use. In vivo gene silencing was administered by tail vein injection, and the frequency of administration was 2 times / week. The injection solution must be injected immediately after preparation. The specific preparation of the injection solution for each mouse is as follows: 50ul of siRNA and 50ul of 10% glucose were mixed to make 1 solution, 25ul of ultrapure water and 50ul of 10% glucose and 25ul of in vivo transfection reagent (Engreen, 18668-11-1) were mixed to make 2 solutions, and then allowed to stand for 2min, and 1 solution and 2 solutions were mixed and allowed to stand for 15min.

[0283] Tumor measurements and statistical analysis

[0284] The tumor size was measured from the start date of drug administration, with a measurement frequency of 3-5 days. The length and width of the tumor surface were measured with a vernier caliper. After the experiment, the data were sorted out, and the drug effect was calculated and evaluated according to the following standards in accordance with the "Technical Guidelines for Non-clinical Research of Cytotoxic Anti-tumor Drugs": Tumor volume calculation formula: V = 1 / 2 × a × b2. Where a and b represent the length and width of the tumor surface, respectively. Tumor efficacy evaluation formula: relative tumor proliferation rate T / C% = TRTV / CRTV*100%. T / C% <40% can be used to judge that the treatment method is effective. The lower the T / C% value, the more significant the efficacy. Among them, TRTV represents the RTV of the treatment group; CRTV represents the RTV of the negative control group. RTV represents the relative tumor volume (RTV), and its calculation formula is: RTV = Vt / V0. Where V0 is the initial tumor volume, and Vt is the tumor volume at the observation time point. In this experiment, Vt is the mouse tumor volume corresponding to the set experimental endpoint.

[0285] In this example, the difference between the control group and the experimental group at the experimental endpoint was compared using a two-tailed T-test. P>0.05 indicated a significant difference between the two groups. The experimental period was set to 21 days. According to ethical requirements, if the mouse tumor volume was greater than or equal to 2000mm before the 21-day experimental endpoint was reached, 3 The mice also need to be killed to terminate the experiment on this sample.

[0286] Experimental results:

[0287] The growth of mouse tumors in the ENDOD1 endonuclease silencing experimental group was significantly inhibited compared with the control group. The animal model effectively proved that ENDOD1 endonuclease gene silencing can produce significant inhibitory effects on a variety of TP53 deficiency (SKOV3, HCC1937, OVCAR-8TR), BRCA1 deficiency (HCC1937, BRCA1 homozygous mutation) ( Fig.13 A), the inhibition rates (T / C%) were SKOV3, 15.2%; HCC1937, 23.7%; OVCAR-8TR, 25.7% (T / C%≤40% indicates that the drug has a significant therapeutic effect on tumors) ( Fig.13 B).

[0288] Therefore, a sufficient dose of ENDOD1 endonuclease inhibitory drugs can be administered to the subject to treat tumors with corresponding gene, heredity, or protein function defects.

[0289] Example 11. The therapeutic effect of inhibiting the endonuclease function of ENDOD1 on active hepatitis B virus.

[0290] Previous findings have shown that the hepatitis B virus-encoded oncogene (HBx) inhibits homologous recombination repair by destroying the CRL4WDR70 ubiquitin enzyme (see: Ren, L., et al., The Antiresection Activity of the X Protein Encoded by Hepatitis Virus B. Hepatology, 2019.69). This example demonstrates that inhibition of ENDOD1 endonuclease function can control HBV infection indicators by measuring the sensitivity of HBV-positive cells to silencing of the ENDOD1 endonuclease gene.

[0291] Experimental methods:

[0292] Cell proliferation assay:

[0293] 50,000 cells were seeded in a 24-well plate, and the gene silencing experiment was started 24 hours later. The experimental period was set to 21 days, and the cells were subcultured every 3 days. ENDOD1 endonuclease siRNA transfection experiment was performed 24 hours after each subculture. The cell counter was used to accurately count and record the number of cells during subculture, and the proliferation curve was drawn at the end point of the experiment.

[0294] HBV positive cell animal model experiment:

[0295] The evaluation of the treatment effect of hepatitis B virus patients can be carried out by detecting the virus copy number and surface antigen (HBsAG) in the serum.

[0296] Three 6-week-old athymic female nude mice were used. Each mouse was inoculated with HepG2.2.15 cells in the axilla and groin to establish the HBV mouse infection model. The number of cells inoculated was 8x10 6 After inoculation of cells, blood was collected from the tail vein at different time points, and the hepatitis B virus (HBV) nucleic acid amplification (PCR) fluorescence quantitative detection kit was used to monitor the changes in HBV copy number in the blood. When the copy number rose to the highest value in serum, about 4000UI / ml, the ENDOD1 endonuclease gene was silenced in vivo.

[0297] The specific implementation is as follows: Dissolve ENDOD1 endonuclease in vivo siRNA powder and control siRNA powder (Guangzhou Ruibo) in ultrapure water (invitrogen, 10977-015), prepare working solution (1ug / ul) and store at -40℃. Prepare 10% glucose in ultrapure water, filter, and store at -40℃ for future use. In vivo gene silencing is administered by tail vein injection, with a frequency of 2 times / week. The injection solution must be injected immediately after preparation.

[0298] The specific preparation of injection solution for each mouse is as follows: 50ul of siRNA and 50ul of 10% glucose are mixed to make solution 1, 25ul of ultrapure water, 50ul of 10% glucose and 25ul of in vivo transfection reagent (Engreen, 18668-11-1) are mixed to make solution 2, let stand for 2min, mix solution 1 and solution 2, and let stand for 15min.

[0299] Blood was collected from the tail vein on days 1, 2, 3, 4, 5, 7, 9, 15, and 20 to monitor the number of HBV genome copies in the serum, and the ELISA method was used to detect changes in HBsAg titer. After drug withdrawal on the 16th day, the number of copies and HBsAg titer in the serum were continued to be monitored for five days. Titer curves were made at the result time points. Unless otherwise specified, all intergroup differences in the cell experiment and the animal experiment in this embodiment were calculated using the t-test two-tailed test. P>0.05 shows that there are significant differences between the two groups.

[0300] Experimental results:

[0301] 1. The combined lethal effect of silencing ENDOD1 endonuclease and WDR70

[0302] ENDOD1 endonuclease and / or WDR70 were silenced in normal hepatocytes (L02) and the cell proliferation curve was measured. It was found that ENDOD1 gene silencing had no obvious toxicity to L02 cells, but it could be combined with siWDR70 to inhibit cell proliferation ( Fig.14 A). This suggests that inhibition of ENDOD1 endonuclease and WDR70 function has a combined lethal effect.

[0303] 2. Cytotoxic effect of silencing ENDOD1 endonuclease on HBV-positive cells

[0304] The expression of ENDOD1 endonuclease gene was silenced in hepatocytes (T43) with integrated HBV genome, and the ability of cell clone formation was determined ( Fig.14 B), found that ENDOD1 gene silencing can effectively eliminate T43 cells, while the clone formation of normal liver cells (L02) under the same treatment is completely unaffected. Nude mice were subcutaneously inoculated with T43 to establish a tumor model, and it was found that ENDOD1 gene silencing can effectively inhibit the growth of T43 tumors ( Fig.14 C), indicating that inhibition of ENDOD1 endonuclease function can eliminate HBV-positive cells with CRL4WDR70 functional defects.

[0305] 3. Silencing ENDOD1 endonuclease reduces HBV infection indicators

[0306] HepG2.2.15 was inoculated into the tail vein of nude mice, and the titer of HBV antigen (HBsAg) in the serum at the indicated time points was determined by ELISA, and the titer of HBV viral DNA in the serum was determined by fluorescence quantitative PCR. The experiment found that in vivo silencing of ENDOD1 endonuclease could reduce the HBV-DNA content and HBsAg antigen OD value in the serum of model mice from ~1.5 (at this time, the HBsAg antigen content in the serum reached the highest value, indicating that the virus entered a stable high-level active replication period in the HepG2.2.15 cell liver cancer mouse model) to about 0.05, close to or below the clinical negative (>0.05, at this time the OD value is the lowest detection threshold) index. Within 5 days of stopping the in vivo silencing of ENDOD1 endonuclease, the HBV copy number and HBsAg expression in the mouse serum remained in a stable negative range. The results of these cytological and animal experiments showed that silencing of ENDOD1 endonuclease in vivo can permanently eliminate host cells infected with HBV, suggesting that downregulating the function of ENDOD1 endonuclease can eliminate liver cells carrying HBV or expressing HBx in HBV-infected patients, thereby achieving true clinical cure for hepatitis B virus.

[0307] Therefore, the hepatitis B virus serum antigen index and virus titer can be reduced by giving the treated subject a sufficient dose of ENDOD1 endonuclease inhibitory drugs, thereby eradicating or controlling the infection of hepatitis B virus. The treatment method can also be used in combination with a variety of antiviral treatment methods or form a composition, such as antiviral metabolic drugs, gene therapy, DNA therapy, RNA therapy, targeted therapy, adjuvant therapy and immunotherapy, etc. These treatment methods can be used simultaneously or sequentially, so that the treatment effect is better than the method of using drugs that inhibit ENDOD1 function or antiviral drugs alone.

[0308] Example 12: Screening process for ENDOD1 endonuclease inhibitors.

[0309] Experimental methods

[0310] Small molecule inhibitors that inhibit ENDOD1 endonuclease activity were screened by competitive inhibition. 0.1 μg of bacterially expressed ENDOD1 protein and 100 ng of linear double-stranded DNA substrate (sequence:

[0311] ATTCTCAGCCTGAAAGCCAGGTTCTAGAGGATGATTCTGGTTCTCACTTCAGTATGCTATCTCGACACCTTCCTAATCTCCAGACGCACAAAGAAAATCCTGTGTTGGATGTTGTGTCCAATCCTGAACAAACAGCTGGAGAAGAACGAGGAGACGGTAATAGTGGGTTCAATGAACATTTGAAAGAA) and small molecule inhibitor library or DMSO control were reacted in Cut Smart buffer at 37°C for 16 hours. An equal volume of 2x fluorescent quantitative PCR premix (Promega, containing specific primers with DNA substrate as template, sequence F: 5'-ATTCTCAGCCTGAAAGCCAGG-3'; R: 5'-TTCTTTCAAATGTTCATTGAA-3') was added to each well using a mechanical multichannel pipette (eppendorf), and fluorescent quantitative PCR was performed to detect the remaining amount of DNA substrate and enzyme cleavage efficiency to screen effective small molecule inhibitors.

[0312] Experimental Results

[0313] Screening and development of ENDOD1 inhibitors can be achieved through the following aspects: inhibiting the expression level of ENDOD1 and / or its regulatory genes; inhibiting the endonuclease activity of ENDOD1 protein, blocking its DNA repair activity, destroying its subcellular localization, destroying its ubiquitination, phosphorylation and other post-translational modifications; interfering with the biological functions of ENDOD1 and its regulatory proteins such as shearing and signal peptide maturation, etc.

[0314] By inhibiting the endonuclease activity of ENDOD1 protein, such as Fig.15 The figure shows the flow chart of ENDOD1 inhibitor screening. By gradually reducing the ENDOD1 protein concentration and using fluorescent quantitative PCR to detect the enzyme cleavage efficiency, the remaining amount of DNA substrate should be negatively correlated with the ENDOD1 protein concentration. This method can be used as an in vitro drug screening system for ENDOD1 endonucleases.

Claims

1. Use of an ENDOD1 endonuclease inhibitor in the manufacture of a drug for treating and / or preventing tumors, wherein the inhibitor can inhibit the gene expression, activity or function of ENDOD1 endonuclease, the endonuclease is an endonuclease encoded by the ENDOD1 gene, the endonuclease inhibitor is a double-stranded siRNA that inhibits the expression of the ENDOD1 gene, and the tumor has DNA homologous recombination, DNA damage response, DNA damage repair or / and TP53 tumor suppressor gene mutation, gene expression or function defects, The nucleotide sequence of one strand of the double-stranded siRNA for inhibiting ENDOD1 gene expression is selected from: siENDOD1-001: 5'-GCAAGCGGATTGGCTACAA-3' or its complementary sequence, siENDOD1-002: 5'-GGATGAAGAACGAATGGTA-3' or its complementary sequence and siENDOD1-003: 5'-GTGGCCACATTTACTCTCA-3' or its complementary sequence, The tumor is lung cancer, breast cancer, liver cancer, ovarian cancer, cervical cancer, lymphoma, leukemia or / and sarcoma, wherein: The lung cancer and ovarian cancer are TP53 mutations.

2. The use according to claim 1, wherein the tumor containing a DNA homologous recombination gene mutation, gene expression or functional defect includes a tumor with a BRCA1, BRCA2, WRN, Fanconi, EMSY, MRE11, NBS1, BLM, PTIP, ARID1A, ARID1B and WDR70 gene mutation, gene expression or functional defect.

3. The use according to claim 1, wherein the tumor comprises a tumor characterized by hepatitis B virus infection.

4. The use according to claim 1, further comprising using the ENDOD1 endonuclease inhibitor in combination with one or more other anti-tumor drugs or forming a composite composition for use.

5. The use according to claim 4, wherein the one or more other anti-tumor drugs are selected from chemotherapeutic drugs.

6. The use according to claim 5, wherein the chemotherapeutic drug is selected from platinum, mitomycin C, camptothecin, PARP inhibitors, DNAPK inhibitors, TKI, radioisotopes, vinca alkaloids, antitumor alkylating drugs and antimetabolites.

Images