Application of a synthetic lethal gene pair for colorectal cancer

Abstract

The present invention belongs to the field of biomedicine, and provides an application of a synthetic lethal gene pair for colorectal cancer, which can be applied to the precise treatment of colorectal cancer carrying APC mutations. The synthetic lethal gene pair is APC and GFER obtained by screening based on machine learning algorithms and molecular cell biology experiments. The present invention discovers for the first time that the synthetic lethal gene pair APC and GFER can be used for the treatment of colorectal cancer. It has been proven that the use of the synthetic lethal gene pair of APC and GFER can effectively kill colorectal cancer cells without damaging normal cells. On this basis, the synthetic lethal gene pair of APC and GFER can also be used to prepare and develop drugs for the treatment of colorectal cancer. The present invention provides a new idea for the clinical development of colorectal cancer treatment at the molecular level, and at the same time provides a new drug target for the treatment of colorectal cancer.

Description

Technical Field

[0001] The present invention specifically relates to an application of a colorectal cancer synthetic lethal gene pair, and belongs to the field of biomedicine. Background Art

[0002] Globally, colorectal cancer is the third most common malignant tumor and the second most common cause of death from malignant tumors. According to the GLOBOCAN project of the WHO Cancer Research Center, there were approximately 1.8 million new cases of colorectal cancer and approximately 880,000 deaths worldwide in 2018. Colorectal cancer is closely related to the level of socioeconomic development. The popularity of Western lifestyles, changes in diet, and reduced physical activity are the main reasons for its continued rise worldwide. Globally, 31% of colorectal cancers occur in people over 75 years old. Therefore, the aging of the population has a relatively obvious impact on the incidence of colorectal cancer.

[0003] From 1990 to 2017, the global incidence of colorectal cancer increased by 9.5%, while the mortality rate decreased by 13.5%. The changes in different regions of the world are not consistent, showing huge differences. The incidence rate in East Asia increased the most, reaching 85%, and the Central America and Andean Latin America regions increased by 70% and 65% respectively. On the contrary, the regions with the highest economic development levels have shown a downward trend, with a decrease of 14% in North America and 7% in Oceania. Regions with low incidence rates have higher mortality rates.

[0004] In the 10 years from 2005 to 2014, the per capita expenditure on colorectal cancer in my country increased by nearly 2 times, and the proportion of patients diagnosed with colorectal cancer in the late stage increased. The research report pointed out that the clinical epidemiological characteristics of colorectal cancer in my country are reflected in: a high proportion of men, 90% of adenocarcinoma, an increase in the use of CT and colonoscopy, and the treatment method is still mainly surgery, which has a heavy burden on medical expenses. Therefore, it is urgent to develop new targets and drugs for the treatment of colorectal cancer. Summary of the invention

[0005] To solve the above technical problems, the present invention provides the application of a synthetic lethal gene pair for colorectal cancer, which provides a new method for clinical development of colorectal cancer treatment at the molecular level, and also provides a new drug target for the treatment of colorectal cancer.

[0006] The technical solution provided by the present invention is as follows:

[0007] A colorectal cancer synthetic lethal gene pair is used in the preparation of a drug for treating colorectal cancer. A preparation for knocking down or knocking out APC gene expression and a GFER inhibitor are used to prepare a drug for treating colorectal cancer.

[0008] Furthermore, GFER inhibitors specifically killed colorectal cancer cells carrying APC gene mutations.

[0009] Furthermore, the concentration of the GFER inhibitor is greater than 45 μM.

[0010] Furthermore, the CRISPR / Cas9 knockout method was used to screen stably transfected APC knockout cell lines.

[0011] Furthermore, the APC sgRNA DNA oligo sequence is:

[0012] Sequence 1: 5'CACCGGCCCGGCTTCCATAAGAACGG 3' (SEQ ID No. 1);

[0013] Sequence 2: 5'CACCGGCCCGGCTTCCATAAGAACGG 3' (SEQ ID No. 2).

[0014] Furthermore, the APC knockout cell lines were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and 1% penicillin-streptomycin.

[0015] Furthermore, the incubator contained 5% CO2 and the temperature was 37°C.

[0016] Furthermore, the GFER inhibitor is MitoBloCK-6.

[0017] Beneficial Effects

[0018] Almost all current treatments for colorectal cancer are based on a "one-size-fits-all" principle and can only provide limited survival benefits. Fortunately, synthetic lethal anticancer strategies may provide another approach for personalized treatment of colorectal cancer. The concept that simultaneous loss of two genes is lethal to a cell, while loss of one gene is non-lethal, can be used to selectively eliminate tumors with genetic aberrations. Based on synthetic lethal anticancer strategies, we use machine learning and molecular biology methods to prepare synthetic lethal gene pairs for colorectal cancer. The present invention provides a new method for the clinical development of colorectal cancer treatment at the molecular level, and also provides new drug targets for the treatment of colorectal cancer.

[0019] Compared with the prior art, the advantages of the present invention are that the synthetic lethal gene pairs involved in the present invention are gene pairs with high synthetic lethality prediction values ​​obtained based on biomedical multi-omics big data and through machine learning algorithms, and have high reliability. The synthetic lethal gene pairs involved in the present invention are gene pairs whose synthetic lethality effects are further verified by molecular biology experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1APC wild-type and mutant HCT116 cells were treated with different concentrations of GFER inhibitors;

[0021] Figure 2 To treat APC wild-type and mutant colorectal cancer cells with GFER inhibitors. DETAILED DESCRIPTION

[0022] Example 1

[0023] Machine learning prediction analysis based on multi-omics data of colorectal cancer

[0024] Multi-omics data include colorectal cancer gene expression data (512 samples), gene mutation data (408 samples), gene methylation data (203 samples) and copy number variation data (466 samples). These data are all from the GDC-TCGA database. Experimental data collection comes from literature mining (5859 pairs of synthetic lethal gene pairs). In the machine learning process, the training set and the test set are grouped in a 9:1 ratio. Based on these data, the random forest algorithm in machine learning is used to predict synthetic lethal genes. First, we used multi-omics data to construct features, then trained the synthetic lethal gene pairs in the experimental verification data set, and then classified the candidate gene pairs. Finally, we obtained the synthetic lethal gene pairs APC (NCBI ACCESSION: M74088, full length 8972bp, SEQ ID No. 3) and GFER (NCBI ACCESSION: NM_005262, gene full length: 2365bp, SEQ ID No. 4) in colorectal cancer. In order to verify their specific killing ability against colorectal cancer cells, we carried out the following experiments using molecular biology.

[0025] Example 2

[0026] Colorectal cancer cell lines and their culture

[0027] The human HCT116 cell line (WT-HCT116) was stored in our laboratory. Since the HCT116 cell line is an APC wild-type cell, we used the CRISPR / Cas9 knockout method to screen the stably transfected APC knockout HCT116 cell line and obtained APCKO-HCT116 (APC sgRNA DNA oligo sequence: sequence 1: 5'CACCGGCCCGGCTTCCATAAGAACGG 3'; sequence 2: 5'CACCGGCCCGGCTTCCATAAGAACGG 3'). The steps for constructing the colorectal cancer APC KO-HCT116 stable transfectant were as follows: (1) Design the APC sgRNA DNA oligo sequence (the specific sequence is as above). (2) Amplify and use FastDigest BSMBI endonuclease to digest the linearized lentiCRISPR v2 vector, and cut the gel to recover the 12000 bp target vector fragment. (3) After annealing the DNA oligo expressing sgRNA, connect it to the linearized lenti CRISPR v2 vector and transform it into competent Escherichia coli for amplification and culture. At the same time, amplify the packaging plasmids psPAX2 and pMD2G of the lentiviral vector, and extract the plasmids using the endotoxin-free plasmid extraction kit. Use the three-plasmid system to package the APC knockout lentiviral vector in HEK293T cells, and use the lentiviral vector to infect HCT116 cells. (4) After the lentiviral vector infected HCT116 cells for 48 hours, use 2μg / mL puromycin for continuous screening for 10 days, trypsin digestion to collect the surviving cells after screening, and dilute the cells into 100μL single cells by limiting dilution method, and use 96-well plates for single cell cloning culture. (5) After 3-4 weeks of continuous culture, the APC knockout HCT116 cell stable strain was obtained. All cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (both purchased from Wisent, San Bruno, Canada) in an incubator containing 5% CO 2 at 37° C.

[0028] Example 3

[0029] CCK8 assay to determine the effect of GFER inhibitors on the viability of different colorectal cancer cells

[0030] WT-HCT116 and KO-HCT116 cell lines were analyzed for cell viability using the Cell Counting Kit-8 (CCK8, APExBIO, USA). Cells were seeded at 8 × 10 3The cells were then incubated with 6 different concentrations of GFER inhibitors (the main component of which is MitoBloCK-6) (0, 10, 20, 30, 40 and 50 μM). After 24 hours of treatment, 10 μL of CCK-8 reagent was added to each well and then cultured for another 2 hours. All experiments were performed in triplicate. The absorbance was analyzed at 450 nm using a microplate reader (purchased from BioTek, USA), and the wells without cells were used as blanks.

[0031] Example 4

[0032] Cell clone formation assay

[0033] WT-HCT116 and KO-HCT116 cell lines were seeded in DMEM containing 10% FBS at a density of 2 × 10 3 The density of cells / well was cultured into six-well plates for 24 hours. Cells were treated with different concentrations of GFER inhibitors (0, 10, 20, 30, 40 and 50 μM). These treated cells were then resuspended in DMEM containing 10% FBS and cultured at 5% CO2, 37°C for 10 days to form cell clone colonies. The culture plates were washed with pre-cooled PBS. The cell clone colonies were fixed with 4% paraformaldehyde at room temperature. Subsequently, they were stained with 1% crystal violet for 30 minutes at room temperature. Images were acquired using a camera.

[0034] Example 5

[0035] To determine whether APC and GFER have synthetic lethality, we treated HCT116 cells with different APC mutation status with GFER inhibitors and performed CCK8 assays and cell cloning assays.

[0036] CCK8 was used to detect the survival rate of HCT116 cells after treatment with GFER inhibitors (0, 10, 20, 30, 40 and 50 μM). The results showed that APC knockout HCT116 cells were more sensitive to GFER inhibitors (P<0.05) ( Figure 1 ), and its survival activity was significantly inhibited.

[0037] Cell cloning experiments showed that, first, the growth rate of HCT116 cells did not change significantly after APC knockout. Second, after treatment with 45μM GFER inhibitor, there was no significant inhibitory effect on the survival of APC wild-type HCT116 cells. Third, in the case of APC knockout, after treatment of KO-HCT116 cells with 45μM GFER inhibitor, the activity of HCT116 cells was significantly inhibited (P<0.05), and the vast majority of colorectal cancer cells were killed ( Figure 2). These results demonstrate the preparation and application of a synthetic lethal gene pair for colorectal cancer.

[0038] The principle of killing colorectal cancer cells in the present invention is based on the synthetic lethal anticancer strategy. Through the mutation of the APC gene in colorectal cancer, combined with the inhibition of GFER expression, the purpose of specifically killing cancer cells can be achieved, showing a good anticancer effect.

Claims

1. Use of a preparation for knocking out the APC gene and a GFER inhibitor in the preparation of a drug for treating colorectal cancer, characterized in that: The GFER inhibitor is MitoBloCK-6; the GFER inhibitor specifically kills colorectal cancer cells carrying APC gene mutations; the concentration of the GFER inhibitor is greater than 45 μM.

2. The use according to claim 1, characterized in that: Screening of stably transfected APC knockout cell lines using CRISPR / Cas9 knockout assay.

3. The use according to claim 1, characterized in that: APC knockout cell lines were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and 1% penicillin-streptomycin.

4. The use according to claim 3, characterized in that The incubator contained 5% CO2 and the temperature was 37°C.

Images