Application of CLE41 / 44 small peptide in promoting plant bud regeneration and as a plant tissue culture proliferation promoter

Abstract

The present invention discloses the application of CLE41 / 44 peptide in promoting plant bud regeneration and as a plant tissue culture proliferation promoter, and belongs to the field of plant biotechnology. The present invention finds that CLE41 / 44 peptide or its similar peptide has the application of promoting plant bud regeneration or as a plant tissue culture proliferation promoter, and can improve the bud regeneration ability in plant tissue culture by overexpressing one or more of CLE41 / 44 peptide or its similar peptide encoding genes through gene editing or transgenic, or improve the bud regeneration ability in plant tissue culture by adding one or more of artificially synthesized CLE41 / 44 peptide and KIN peptide to tissue culture medium.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and specifically relates to a small peptide that can regulate plant reprogramming, bud regeneration, and promote plant explant bud proliferation ability, and its application as a plant tissue culture proliferation promoter. Background Art

[0002] Tissue culture is one of the commonly used plant biotechnology methods to achieve asexual reproduction and large-scale propagation of plants. Specifically, under sterile culture conditions, by adjusting the type, content and ratio of plant hormones in the culture medium, mainly including auxins and cytokinins, suitable explants are induced to form embryonic callus, and further undergo callus proliferation and differentiation processes to obtain high-quality regenerated buds. The regenerated buds take root under the action of suitable growth regulators, generally high-concentration cytokinins, and finally a large number of regenerated seedlings are obtained through seedling training and other steps. Obtaining high-quality regenerated buds is a key link that affects the success or failure of plant tissue culture.

[0003] The bud regeneration process commonly used in tissue culture needs to go through two stages: the first step is to form pluripotent embryonic callus under the induction of high concentrations of auxin, and the second step is to initiate bud regeneration under the induction of high concentrations of cytokinin. The bud regeneration process is related to the activity of plant stem cells, but it is different from the development of shoot apical meristem and root apical meristem. It is related to factors such as plant species, genotype, explant type, culture conditions and growth regulators, but the specific regulatory mechanism is still unclear. For tissue culture production, studying new plant regulators that affect bud regeneration has broad application value.

[0004] In addition, genotype is also an intrinsic factor that affects plant callus formation and bud regeneration. Discovering the main and functionally conserved genes that regulate plant bud regeneration and manipulating the expression activity of genes through genetic engineering is a feasible biotechnology means to improve plant bud regeneration ability.

[0005] Growth regulators generally refer to plant hormones. A class of CLAVATA3 / EMBRYO SURROUNDING REGION-RELATED (CLE) peptides with conserved sequences and functions are commonly found in higher plants, referred to as CLE peptides, which are considered to be a new type of polypeptide plant hormone. The known function of CLE peptides is to maintain the activity of stem cells in the meristem region of plants. Currently, CLV3 is the most well-researched. Arabidopsis CLE41 and CLE44 (abbreviated as CLE41 / 44), also known as TRACHEARY ELEMENTDIFFERENTIATION INHIBITORY FACTOR (TDIF), are encoded by two homologous genes CLE41 (AT3G24770) and CLE44 (AT4G13195), respectively. The amino acid sequence of the mature peptides of CLE41 / 44 generated after translation and splicing is consistent, namely HEVPSGPNPISN. Existing studies have shown that CLE41 / 44 controls the activity of procambium cells and affects the differentiation of xylem. The artificially synthesized peptide "RKVPSGPDPIHN" was named KIN. KIN can perform the above functions of the TDIF / CLE peptide. In addition, what other physiological functions they have have not been publicly reported.

[0006] Obtaining high-quality regenerated buds is a key link that affects the success or failure of plant tissue culture. Plant hormones act as growth regulators and play a vital role in the bud regeneration process. Even if factors such as the type, content, and ratio of plant hormones in the culture medium are adjusted, some plants still have difficulty regenerating buds. For tissue culture production, studying the regulatory mechanisms that affect bud regeneration, discovering regulatory genes, and developing new plant regulators have broad application value. Summary of the invention

[0007] The purpose of the present invention is to provide the use of CLE41 / 44 small peptide in promoting plant bud regeneration and as a plant tissue culture proliferation promoter.

[0008] The present invention found that compared with the wild type, the number of regenerated shoots formed by hypocotyl explants of CLE41 / 44 overexpressing plants on shoot induction medium (SIM) was significantly increased, indicating that CLE41 / 44 is a positive regulatory factor controlling Arabidopsis shoot regeneration.

[0009] The present invention found that compared with the control (without exogenously applied small peptides), exogenously applied artificially synthesized CLE41 / 44 small peptides and KIN small peptides significantly promoted Arabidopsis bud regeneration, indicating that the new function of this type of conservative small peptide hormones in promoting plant bud regeneration has universal significance in higher plants.

[0010] Based on the above findings, the present invention provides the use of CLE41 / 44 peptide or its similar peptide in promoting plant bud regeneration. The similar peptide of the CLE41 / 44 peptide is KIN peptide. The promotion of plant bud regeneration is to improve the bud regeneration ability of plants in tissue culture.

[0011] In some embodiments, one or more of the genes encoding the CLE41 / 44 small peptide or its similar peptides can be knocked in or overexpressed by gene editing to enhance the gene expression activity and improve the bud regeneration ability of the plant in tissue culture.

[0012] In some embodiments, the shoot regeneration ability of plants in tissue culture can be improved by adding CLE41 / 44 small peptides and / or KIN small peptides to the tissue culture medium.

[0013] The present invention also provides the use of CLE41 / 44 peptide and / or KIN peptide as a plant tissue culture proliferation promoter, which is specifically to improve the bud regeneration ability of plants in tissue culture by adding CLE41 / 44 peptide and / or KIN peptide into the tissue culture medium.

[0014] The present invention also provides a method for promoting plant shoot regeneration in tissue culture, which comprises using a tissue culture medium containing CLE41 / 44 small peptide and / or KIN small peptide for tissue culture.

[0015] In some embodiments, the plant is a plant containing a gene encoding a CLE41 / 44 small peptide or a homologous protein thereof.

[0016] In some embodiments, the plant is Arabidopsis thaliana.

[0017] In some embodiments, the amino acid sequence of the above-mentioned CLE41 / 44 small peptide is: HEVPSGPNPISN (SEQ ID NO.1).

[0018] In some embodiments, the amino acid sequence of the above-mentioned KIN small peptide is: RKVPSGPDPIHN (SEQ ID NO. 2).

[0019] In some embodiments, the nucleotide sequences of the genes encoding CLE41 / 44 are as follows:

[0020] CLE41 gene: ATGGCAACATCAAATGACCAAACCAATACTAAATCATCACATTCTCGTACTCTTCTCCTTCTCTTCATCTTCTTATCCCTCCTTCTCTTCAGTAGCCTTACAATCCCCATGACTCGTCATCAGTCCACATCTATGGTTGCTCCCTTCA AGAGGGTTCTCCTCGAATCTTCAGTTTCCAGCTTCATCAACAATGGATCTACGTCCAAAGGCTAGCACACGACGCAGCCGCACTTCTAGAAGGAGAGAGTTTGGAAATGATGCTCATGAGGTTCCTAGTGGTCCAAACCCTATTTCCAACTAG (SEQ ID NO.3);

[0021] CLE44 gene: ATGGCAACTACAATTGATCAAACCAGCATCAAGTCATTGCATTTCCATCAAGTCATCCGTTTGATCATCACAATCATCTTCTTAGCTTCTTATTTCTCATTGGCCCTACAAGTTCCATGAATCATCACCTTCATGAATCCTCATCTAAGAACACTATGGCTCCTTC CAAGAGGTTCCTTCTACAACCTTCCACTCCATCTTCATCTACTATGAAAATGCGTCCAACAGCTCACCCTAGACGCAGTGGCACTTCTTCTTCTTCGGCGAGGAAGAAGGAGAGAGTTCAGAGCTGAAGCTCATGAGGTTCCAAGTGGTCCAAACCCTATCTCCAACTAG (SEQ ID NO.4).

[0022] The advantages of the present invention are:

[0023] (1) The present invention discovered a new function of CLE41 / 44 in promoting plant bud regeneration.

[0024] (2) As plant gene editing technology matures, more and more plant genomes are sequenced, making it feasible to knock out, knock in, or overexpress genes in different plants. Knocking in or overexpressing CLE41 / 44 peptides will significantly improve the ability of plant bud regeneration during tissue culture. This application is particularly important for plants that have difficulty regenerating buds from callus.

[0025] (3) The advantages of artificially synthesized CLE41 / 44 peptides and KIN peptides are: easy to obtain, easy to store, easy to prepare, and low cost. The above artificially synthesized peptides are added to the tissue culture medium as a growth regulator to obtain an appropriate amount of high-quality regenerated buds. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the gene expression detection of CLE41 and CLE44 overexpression materials. Real-time fluorescence quantitative PCR (RT-qPCR) was used to detect the expression level of the target gene in the overexpression transgenic materials. WT, 35S:CLE41 and 35S:CLE44 are wild-type Arabidopsis, CLE41 and CLE44 overexpression transgenic materials respectively.

[0027] Figure 2 The figure shows the number of regenerated shoots of CLE41 and CLE44 overexpressing materials and wild type. Col-0 is wild type Arabidopsis and is the control. 35S:CLE41 and 35S:CLE44 are overexpressing transgenic materials of CLE41 and CLE44, respectively. (A) Phenotypic diagram. (B) Statistical diagram. Asterisks represent significant differences. Statistical methods: Dunnett's multiple comparison test, one-way ANOVA (****P<0.0001).

[0028] Figure 3 The figure shows the number of regenerated shoots of CLE41 overexpression materials driven by different specific promoters and wild type. Col-0 is wild type Arabidopsis and is the control. SUC2:CLE41 and IRX3:CLE41 are CLE41 overexpression transgenic materials driven by phloem-specific promoter SUC2 and xylem-specific promoter IRX3, respectively. (A) Phenotypic diagram. (B) Statistical diagram. Asterisks represent significant differences. Statistical methods: Dunnett's multiple comparison test, one-way ANOVA (****P<0.0001).

[0029] Figure 4 The number of regenerated shoots after exogenous application of artificial synthetic CLE41 / 44 peptide and KIN peptide was counted. Asterisks represent significant differences. Statistical methods: Dunnett's multiple comparison test, one-way ANOVA (*P<0.05, **P<0.01, ****P<0.0001). DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0031] Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods and can be carried out according to the described recombinant technology (see Molecular Cloning Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can all be obtained from commercial channels.

[0032] The culture medium and culture conditions used for tissue culture in the following examples are as follows: the CIM medium formula is: 4.4g MS basic salt (containing vitamins); basal medium with vitamins, 0.5g / L methylestersulfonate, 20g / L sucrose, 2.2mM 2,4-D, 0.2mM kinetin and 8g / L agar, pH 5.7; the SIM medium formula is: 4.4g MS basic salt (containing vitamins), 0.5g / L methylestersulfonate, 20g / L sucrose, 5mM kinetin, 0.9mM indole-3-acetic acid and 8g / L agar, pH 5.7; the culture temperature is 22°C, and the photoperiod is 16h light / 8h dark.

[0033] Example 1 Compared with the wild type, the shoot regeneration ability of CLE41 and CLE44 overexpressing plants was significantly enhanced.

[0034] The 35S strong promoter was used to drive CLE41 and CLE44 to obtain transgenic overexpression materials. The regenerated shoot phenotype of the overexpression materials was investigated.

[0035] The method for creating CLE41 and CLE44 overexpression plants involved in Example 1 is as follows: the genomic fragment containing the 5'-end and 3'-end regulatory elements of CLE41 and CLE44 is amplified by PCR, and then cloned into the pPLV26 vector containing the 35S promoter (De Rybel B, van den Berg W, Lokerse AS, et al. A versatileset of ligation-independent cloning vectors for functional studies in plants[J]. Plant physiology, 2011, 156(3): 1292-1299.) by Gibson homologous recombination method. The sequence fidelity is confirmed by sequencing to obtain 35S:CLE41 and 35S:CLE44 overexpression vectors. After the vector is transformed into Agrobacterium, it is transformed into Arabidopsis thaliana by inflorescence dip method. The expression level of the target gene of the obtained transgenic family is detected by RT-qPCR, and finally, stable CLE41 and CLE44 overexpression transgenic families are obtained. The results of RT-qPCR detection are shown in Figure 1 In the overexpression transgenic lines, the expression levels of CLE41 or CLE44 genes were significantly increased.

[0036] The cloning primer sequences are:

[0037] CLE41-OE-F: 5'-AGGACACGGGGCCCCTCGAGATGGCAACATCAAATGACCAAACCAATAC-3',

[0038] CLE41-OE-R: 5'-TGAACGATCGGGGATCGGATCCCTAGTTGGAAATAGGGTTTGGACC-3';

[0039] CLE44-OE-F: 5'-AGGACACGGGGCCCCTCGAGATGGCAACTACAATTGATCAAACCAGC-3',

[0040] CLE44-OE-R: 5'-TGAACGATCGGGGATCGGATCCCTAGTTGGAGATAGGGTTTGGACC-3'.

[0041] The RT-qPCR primer sequences are as follows:

[0042] qRTCLE41-F: TCAAGAGGGTTCTCCTCGAA,

[0043] qRTCLE41-R: TGTGCTAGCCTTTGGACGTA;

[0044] qRTCLE44-F: TTTGGACCACTTGGAACCTC,

[0045] qRTCLE44-R: ACGCAGTGGCACTTCTTCTT.

[0046] All genetic materials were cultured in the dark for 7 days, and 1 cm hypocotyls were taken as explants. After the explants were transferred to CIM medium, they were cultured for another 7 days until callus was formed. The callus was transferred to SIM medium and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph, and count the number of regenerated buds of each explant callus. A regenerated bud was defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that overexpression of CLE41 and CLE44 genes significantly promoted the formation of regenerated buds in Arabidopsis hypocotyl explants on SIM medium ( Figure 2 ).

[0047] Example 2 Compared with the wild type, the shoot regeneration ability of the phloem tissue-specific CLE41 overexpressing plants and the xylem tissue-specific CLE41 overexpressing plants was significantly enhanced.

[0048] Using the CLE41 overexpression transgenic material driven by the phloem tissue-specific promoter SUC2 (SUC2:CLE41) and the CLE41 overexpression transgenic material driven by the xylem-specific promoter IRX3 (IRX3:CLE41), we conducted a phenotypic investigation on the regenerated buds to study whether tissue-specific driven CLE41 overexpression (ectopic expression) can effectively promote the significant enhancement of bud regeneration ability, thereby providing evidence for using CLE41 / 44 to carry out genetic engineering to promote plant bud regeneration.

[0049] The construction of the overexpression vectors SUC2:CLE41 and IRX3:CLE41 involved in Example 2 is described in the literature: Etchells JP, Turner SR. The PXY-CLE41 receptor ligand pair defines a multifunctional pathway that controls the rate and orientation of vascular cell division[J]. Development, 2010, 137(5): 767-774. According to the method in Example 1, an overexpression transgenic line was obtained.

[0050] All materials were cultured in the dark for 7 days, and 1 cm hypocotyls were taken as explants. After the explants were transferred to CIM medium, they were cultured for another 7 days until callus was formed. The callus was transferred to SIM medium and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph, and count the number of regenerated buds of each explant callus. A regenerated bud was defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that tissue-specific overexpression of the CLE41 gene significantly promoted the formation of regenerated buds in Arabidopsis hypocotyl explants on SIM medium ( Figure 3 ).

[0051] The results of Examples 1 and 2 indicate that genetic engineering using CLE41 / 44 can promote plant shoot regeneration.

[0052] Example 3 Exogenous application of artificially synthesized CLE41 / 44 peptide and KIN peptide also promoted Arabidopsis thaliana shoot regeneration.

[0053] The amino acid sequence of the mature peptide of Arabidopsis CLE41 / 44 is consistent, namely "HEVPSGPNPISN", which can be obtained by artificial synthesis. The sequence of the artificially synthesized similar peptide KIN is "RKVPSGPDPIHN". Existing studies have shown that KIN can exercise the function of TDIF / CLE small peptides in regulating the fate of cambium cells. The above genetic evidence shows that the accumulation level of CLE41 / 44 in Arabidopsis (plants) is positively correlated with the ability to regenerate shoots. Therefore, in theory, the application of artificially synthesized small peptides in SIM medium will promote the ability of wild-type Arabidopsis to regenerate shoots.

[0054] Based on this, wild-type Arabidopsis seedlings were cultured in the dark for 7 days, and 1 cm hypocotyls were taken as explants. After the explants were transferred to CIM medium, they were cultured for another 7 days until callus was formed. The calli were transferred to SIM medium containing different concentrations of artificial synthetic peptides (10 μM) and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph, and count the number of regenerated buds in each explant callus. A regenerated bud is defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that exogenous application of artificial synthetic CLE41 / 44 peptides and KIN peptides significantly promoted Arabidopsis bud regeneration ( Figure 4 ). Therefore, the shoot regeneration ability of plants in tissue culture can be promoted by adding artificially synthesized CLE41 / 44 peptides and KIN peptides to the tissue culture medium.

[0055] In summary, these in vivo genetic evidence, i.e., the results of the phenotypic analysis of the regenerated shoots of the overexpressing materials and the exogenous application of CLE41 / 44 small peptides, indicate that CLE41 / 44 small peptides are regulatory factors that promote shoot regeneration. Their amino acid sequences are evolutionarily conserved in higher plants. From the perspective of plant phylogenetic analysis, the present invention provides an implementation method for improving the efficiency of regenerated shoots in tissue culture of different plants by genetic manipulation and exogenous application of artificially synthesized CLE41 / 44 small peptides.

[0056] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. Sequence Listing <110> Shaanxi Normal University Hubei Medical College <120> Application of CLE41 / 44 small peptide in promoting plant bud regeneration and as a plant tissue culture proliferation promoter <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 12 <212> PRT <213> Arabidopsis thaliana <400> 1 His Glu Val Pro Ser Gly Pro Asn Pro Ile Ser Asn 1 5 10 <210> 2 <211> 12 <212> PRT <213> Artificial Sequence <400> 2 Arg Lys Val Pro Ser Gly Pro Asp Pro Ile His Asn 1 5 10 <210> 3 <211> 300 <212> DNA <213> Arabidopsis thaliana <400> 3 atggcaacat caaatgacca aaccaatact aaatcatcac attctcgtac tcttctcctt 60 Met Ala Thr Ile Lys Asp Gln Pro Ile Lys Ser Ile Ala Phe Ser Gln Ser Ile Arg 60 ctcttcatct tcttatccct ccttctcttc agtagcctta caatccccat gactcgtcat 120 Leu Leu His Leu Leu Tyr Pro Pro Phe Ser Ser Ser Ala Leu Gln Pro His Asp Arg His 120 cagtccacat ctatggttgc tcccttcaag agggttctcc tcgaatcttc agttccagct 180 Gln Ser His Ile Met Val Ala Pro Phe Lys Arg Val Ser Ser Glu Ile Phe Ser Ser Ala 180 tcatcaacaa tggatctacg tccaaaggct agcacacgac gcagccgcac ttctagaagg 240 Ser Ile Asn Asn Gly Ile Thr Ser Lys Ala Ser Thr Asp Ala Ala Ala His Phe Arg Lys 240 agagagtttg gaaatgatgc tcatgaggtt cctagtggtc caaaccctat ttccaactag 300 Arg Arg Phe Gly Asn Asp Ala His Glu Val Pro Ser Gly Gln Asn Pro Ile Phe Gln Leu 300 <210> 4 <211> 339 <212> DNA <213> Arabidopsis thaliana <400> 4 atggcaacta caattgatca aaccagcatc aagtcattgc atttccatca agtcatccgt 60 Met Ala Thr Thr Ile Asp Gln Pro His Ile Lys Ser Ile Ala Phe Ser Gln Ser Ile Arg 60 ttgatcatca caatcatctt cttagctttc ttatttctca ttggccctac aagttccatg 120 Leu Asp Ile His Asn His Leu Leu Ser Phe Tyr Phe Ser Ile Gly Pro Thr Lys Phe Met 120 aatcatcacc ttcatgaatc ctcatctaag aacactatgg ctccttccaa gaggttcctt 180 Asn Ile Thr Leu His Glu Pro His Leu Lys Asn Thr Met Ala Pro Phe Lys Arg Val Pro 180 ctacaacctt ccactccatc ttcatctact atgaaaatgc gtccaacagc tcaccctaga 240 Leu Thr Asn Leu Pro Thr Ser Ile Phe Ile Thr Met Lys Met Arg Gln Ser Ser Thr Arg 240 cgcagtggca cttcttcttc ttcggcgagg aagaggagga gagagttcag agctgaagct 300 Arg Gln Trp His Leu Phe Phe Phe Gly Glu Lys Glu Glu Glu Arg Arg Phe Gln Glu Ala 300 catgaggttc caagtggtcc aaaccctatc tccaactag 339

Claims

1. Use of CLE41 / 44 small peptide or its similar peptide in promoting plant bud regeneration, characterized in that: The amino acid sequence of the CLE41 / 44 peptide is: HEVPSGPNPISN; the similar peptide of the CLE41 / 44 peptide is the KIN peptide, and its amino acid sequence is: RKVPSGPDPIHN; The application is: improving the bud regeneration ability of plants in tissue culture by enhancing the expression activity of CLE41 / 44 small peptide; Or the application is: improving the bud regeneration ability of plants in tissue culture by adding CLE41 / 44 small peptide or KIN small peptide to the tissue culture medium.

2. Use of CLE41 / 44 small peptide or its similar peptide as a plant tissue culture proliferation regulator, characterized in that: The amino acid sequence of the CLE41 / 44 peptide is: HEVPSGPNPISN; the similar peptide of the CLE41 / 44 peptide is the KIN peptide, and its amino acid sequence is: RKVPSGPDPIHN; The application is: improving the bud regeneration ability of plants in tissue culture by adding CLE41 / 44 small peptide or KIN small peptide to the tissue culture medium.

3. A method for promoting plant shoot regeneration in tissue culture, characterized in that: The invention uses a tissue culture medium containing CLE41 / 44 small peptide or KIN small peptide for tissue culture; the amino acid sequence of the CLE41 / 44 small peptide is: HEVPSGPNPISN; the amino acid sequence of the KIN small peptide is: RKVPSGPDPIHN.

4. The use according to claim 1 or 2 or the method according to claim 3, characterized in that: The plant is a plant containing a gene encoding a CLE41 / 44 small peptide or a homologous protein thereof.

5. The use according to claim 1 or 2 or the method according to claim 3, characterized in that: The plant is Arabidopsis thaliana.

Images