A recombinant Escherichia coli expressing rhamnosyltransferase and its application

By constructing recombinant E. coli, screening and overexpressing rhamnosyl glycosyltransferase and glucose glycosyltransferase, the problem of synthesis of Centella asiaticin was solved, and the efficient biosynthesis and industrialization of Centella asiaticin was achieved.

CN116004502BActive Publication Date: 2025-07-18JIANGNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310067492.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-17
Publication Date
2025-07-18
Estimated Expiration
2043-01-17

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently synthesize Centella asiaticin, especially the lack of key enzymes that catalyze Centella asiaticin to Centella asiaticin, which limits the application of Centella asiaticin in food, medicine, cosmetics and other fields.

Method used

By sequencing the second-generation transcriptome of Centella asiatica plants, potential rhamnosyl glycosyltransferase were screened out, recombinant E. coli, overexpressing rhamnosyl glycosyltransferase and glucose glycosyltransferase, and fermenting Centella asiatica acid to produce Centella asiatica.

Benefits of technology

The efficient biosynthesis of Centella asiaticin has been achieved, breaking through the existing technical barriers, making the industrialization of Centella asiaticin possible, and providing a brand new biosynthesis method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004502B_ABST
    Figure CN116004502B_ABST
Patent Text Reader

Abstract

The present invention discloses a recombinant Escherichia coli expressing rhamnosyltransferase and its application, belonging to the fields of genetic engineering technology and biomedicine. Rhamnosyltransferases with amino acid sequences shown in any one of SEQ ID NO.6-SEQ ID NO.10, glucosyltransferase UGT73AH1 with reported C-28 glucosyltransferase activity, and glucosyltransferases UGT73C7 or UGT73C8 are co-expressed in the Escherichia coli host BL21(DE3)Δpgi. The fermentation results show that all 5 rhamnosyltransferases screened in the present invention can function, and there is a unique new peak at 0.596 min, and it is consistent with the characteristic ion current of the asiaticoside standard. The present invention breaks through the barriers of the prior art, provides a brand-new method for the biosynthesis of asiaticoside, and makes the industrialization of asiaticoside biosynthesis possible.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a recombinant Escherichia coli expressing rhamnosyltransferase and its application, belonging to the fields of genetic engineering technology and biomedicine. Background Art

[0002] Centella asiatica is the dried whole herb of the Umbelliferae plant. Its chemical components include triterpenoid saponins, triterpenoid acids, polyacetylenes, and volatile oils. At the same time, Centella asiatica is rich in a variety of bioactive substances, and its main components are triterpenoids and their saponin compounds, asiaticoside B, madecassoside, and asiaticoside.

[0003] Triterpenoid compounds are widely present in fungi, ferns, monocotyledonous plants, dicotyledonous plants, and animals, especially in dicotyledonous plants. The main biological activity of the leaf extract of Centella asiatica is these saponins, and asiaticoside has a wide range of biological activities, such as anti-cancer, anti-inflammatory and wound healing, anti-diabetic, antioxidant and liver protection, anti-hepatitis C virus (HCV), and neuroprotection. However, asiaticoside, as an important group of plant secondary metabolites, has a complex structure and a relatively low content in plants. In addition, most of these compounds can be mixed with compounds having similar structures. Therefore, it is difficult to obtain a large amount of triterpenoid monomers through plant extraction or chemical synthesis, which limits their application in multiple fields such as food, medicine, and cosmetics. With the rapid development of sequencing technology, more and more enzymes in the terpene synthesis pathway have been discovered and identified, and the terpene synthesis pathway has been analyzed; in addition, the rapid development of synthetic biology has made the construction of microbial cell factories to produce compounds with great medical value such as terpenes a research hotspot.

[0004] In the past few decades, relatively little progress has been made in the functional characterization of UGT genes involved in the biosynthesis of triterpenoid compounds, which may be related to the fact that plant genomes encode a large number of UGT homologs. At present, the synthesis pathway of asiaticoside has not been fully analyzed, and it is considered that three steps of glycosylation are required from asiatic acid to asiaticoside. Costa et al. reported that UGT73AD1 plays a role in connecting the carboxyl group of glucose in Centella asiatica, and in vitro expression confirmed that UGT73AD1 can specifically glycosylate asiatic acid and madecassic acid. Kim et al. identified the glycosyltransferase UGT73AH1 from Centella asiatica (L.) Urban, which can glycosylate the C28-COOH of asiatic acid to generate the corresponding monoglycoside, but it is not clear whether it has a catalytic effect on other positions C-2α, C-3β, C23-OH. In previous studies, the enzyme for the glucosylation of asiatic acid monoglycoside to asiatic acid diglycoside has been clarified, but the enzyme for the last step of catalyzing asiatic acid diglycoside to asiaticoside is still unknown. Summary of the Invention

[0005] The present invention performs second-generation transcriptome sequencing on Centella asiatica plants, and uses bioinformatics means such as BLAST alignment, protein modeling, molecular docking, and phylogenetic tree analysis to mine potential functional rhamnosyltransferases, and performs expression verification in Escherichia coli. By the form of exogenous addition of the substrate asiatic acid, a recombinant Escherichia coli capable of synthesizing madecassoside is constructed.

[0006] The first object of the present invention is to provide a recombinant Escherichia coli, which uses Escherichia coli as a host, overexpresses rhamnosyltransferase, overexpresses glucosyltransferase, and glycosyltransferase UGT73AH1.

[0007] In an embodiment of the present invention, the rhamnosyltransferase is as follows (a) or (b):

[0008] (a) The amino acid sequence is as shown in any one of SEQ ID NO.6 to SEQ ID NO.10;

[0009] (b) A protein derived from (a) in which one or several amino acids are substituted, deleted or added in the amino acid sequence in (a) and having glucosyltransferase activity.

[0010] In an embodiment of the present invention, the nucleotide sequence of the gene encoding the rhamnosyltransferase is as shown in any one of SEQ ID NO.1 to SEQ ID NO.5.

[0011] In an embodiment of the present invention, the amino acid sequence of the glucosyltransferase is as shown in SEQ ID NO.11 and SEQ ID NO.12.

[0012] In an embodiment of the present invention, the glycosyltransferase UGT73AH1 is derived from Centella asiatica (L.) Urban.

[0013] In an embodiment of the present invention, the amino acid sequence of the glycosyltransferase UGT73AH1 is as shown in SEQ ID NO.13.

[0014] In an embodiment of the present invention, the recombinant Escherichia coli also knocks out the protein-coding gene pgi of glucose phosphate isomerase on the genome.

[0015] In an embodiment of the present invention, the nucleotide sequence of the protein-coding gene pgi of glucose phosphate isomerase is as shown in SEQ ID NO.14.

[0016] In one embodiment of the present invention, the recombinant Escherichia coli expresses rhamnosyltransferase using the pRSFDuet-1 vector, and co-expresses glucosyltransferase and glycosyltransferase UGT73AH1 using pETDuet-1.

[0017] In one embodiment of the present invention, the recombinant Escherichia coli uses Escherichia coli BL21(DE3) as the host.

[0018] The second object of the present invention is to provide a method for synthesizing asiaticoside, and the method is to use the above-mentioned recombinant Escherichia coli as the starting strain and ferment asiatic acid as the substrate to produce asiaticoside.

[0019] In one embodiment of the present invention, the method is to inoculate the seed solution of the above-mentioned recombinant Escherichia coli into a fermentation medium, and culture it with shaking at 35-38 °C and 200-240 rpm until the OD 600 value is 0.6-0.8, add isopropylthiogalactoside to a final concentration of 0.4-0.6 μmol / L, add asiatic acid with a final concentration of 150-250 mg / L after 4-8 h, and continue to culture with shaking at 28-32 °C and 200-240 rpm for 40-60 h.

[0020] In one embodiment of the present invention, the fermentation medium includes 15-25 g / L of glucose, 4-6 g / L of glycerol, 14-18 g / L of K2HPO4·3H2O, 1-3 g / L of KH2PO4, 20-30 g / L of yeast powder, and 10-15 g / L of peptone.

[0021] The third object of the present invention is to provide the application of the above-mentioned recombinant Escherichia coli in the synthesis of asiaticoside or products containing asiaticoside.

[0022] The fourth object of the present invention is to provide the application of rhamnosyltransferase in the synthesis of asiaticoside or products containing asiaticoside.

[0023] In one embodiment of the present invention, the rhamnosyltransferase is as follows (a) or (b):

[0024] (a) The amino acid sequence is as shown in any one of SEQ ID NO.6 to SEQ ID NO.10;

[0025] (b) A protein derived from (a) in which one or several amino acids in the amino acid sequence are substituted, deleted or added and has glucosyltransferase activity.

[0026] The beneficial effects of the present invention:

[0027] (1) In the present invention, the coding genes of rhamnosyltransferases screened from the Centella asiatica transcriptome were respectively ligated to the Escherichia coli expression vector pRSFDuet-1 and induced for expression in the Escherichia coli host BL21(DE3)△pgi. Induction was carried out at 20 °C with 0.5 μmol / L IPTG for 20 h. Cells were collected and sonicated. The results of SDS-PAGE showed that all 5 screened rhamnosyltransferases could be normally expressed.

[0028] (2) In the present invention, the coding genes of 5 rhamnosyltransferases screened from the Centella asiatica transcriptome and the rhamnose isomerase VvRHM derived from Vitis vinifera were respectively ligated to the Escherichia coli expression vector pRSFDuet-1, and the C-28 glucose glycosyltransferase UGT73AH1 reported in the literature and the glucose glycosyltransferase UGT73 (UGT73C7 or UGT73C8) with the function of catalyzing asiatic acid monoglycoside into asiatic acid diglycoside were ligated to the Escherichia coli expression vector pETDuet-1 and transferred into the Escherichia coli host BL21(DE3)△pgi to construct recombinant Escherichia coli. The recombinant Escherichia coli was inoculated into TB medium containing 20 g / L glucose, and the final concentration of the substrate asiatic acid was added to be 200 mg / L. Samples were taken for detection after 24 h of induced expression. It can be seen from the mass spectrometry diagram that all 5 rhamnosyltransferases screened from the transcriptome can play a role, and a unique new peak appears at 0.596 min, which is consistent with the characteristic ion flow of the asiaticoside standard. The present invention breaks through the barriers of the existing technology and provides a brand-new method for the biosynthesis of asiaticoside, making the industrialization of asiaticoside biosynthesis possible. Description of the Drawings

[0029] Figure 1 : SDS-PAGE electrophoresis results of the expression of RRT recombinant Escherichia coli.

[0030] Figure 2 : Liquid phase results of the shake flask fermentation of RRT and VvRHM recombinant Escherichia coli.

[0031] Figure 3 : Mass spectrometry results of the shake flask fermentation of RRT and VvRHM recombinant Escherichia coli. Detailed Embodiments

[0032] (I) Culture Medium

[0033] Seed culture medium (LB): peptone 10 g / L, yeast extract 5 g / L, sodium chloride 5 g / L; 2% (mass fraction) agar powder was added to the solid culture medium.

[0034] Flask fermentation medium: glucose 20 g / L, glycerol 5 g / L, K2HPO4·3H2O 16.4 g / L, KH2PO4 2.31 g / L, yeast powder 24 g / L, peptone 12 g / L. Among them, 20 g / L glucose is sterilized separately and mixed before inoculation.

[0035] (II) PCR reaction system and amplification conditions

[0036] Reaction system: forward primer (10 μM) 1 μL, reverse primer (10 μM) 1 μL, template DNA 20 ng, 2×PhantaMax Master Mix 25 μL, double-distilled water added to 50 μL.

[0037] Amplification conditions: pre-denaturation at 95 °C for 3 min; then 30 cycles (95 °C for 15 s, 55 °C for 15 s, 72 °C for 15 s), and continued extension at 72 °C for 10 min.

[0038] (III) Preparation of competent Escherichia coli

[0039] The Escherichia coli BL21 was genetically edited using the CRISPR / Cas9 system to construct Escherichia coli BL21(DE3)△pgi. The pTarget plasmids used for knockout were all constructed by PCR-mediated site-directed mutagenesis technology, and the template pTarget plasmids were from the laboratory collection. Primers P21pgi-F and P21pgi-R were used to construct the pTarget-pgi plasmid, and PPGI-UPARM-F / R and PPGI-downARM-F / R were used to construct the homologous arms for knockout. The specific operation methods refer to the literature: Li Q, Sun B, Chen J, et al. A modified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli [J]. Acta Biochimica et Biophysica Sinica, 2021, 53(5): 8.

[0040] P21pgi-F:

[0041] AGTTGCTGGCGCTGATTGGCATCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CT;

[0042] P21pgi-R:

[0043] AAACGATGCCAATCAGCGCCAGCACTAGTATTATACCTAGGACTGAGCTAG;

[0044] 21 - PGI - UPARM - F: cctcgtgtcaggggatccattttc;

[0045] 21 - PGI - UPARM - R: tgatccggcaaacaaaccaccgctggtagccacggcgcggttttcagtgc;

[0046] 21 - PGI - DOWNARM - F: gctaccagcggtggtttgtttgccggatcattgagcaggaatatcgtgatcagg;

[0047] 21 - PGIDOWNARM - R: tttacccaaaaacatttcgggcg;

[0048] Using the strain BL21(DE3)Δpgi as the starting strain, streak the glycerol tube on the corresponding LB plate and incubate overnight at 37°C (about 12 h). After 12 h, pick the flat, round and vigorously growing bacteria and inoculate them into a 50 mL shake flask containing 5 mL of LB medium. Culture at 37°C and 220 rpm for about 8 - 10 h; transfer with an inoculum volume ratio of 1% to a 250 mL conical flask containing 50 mL of LB; culture at 37°C and 220 rpm for about 2 h until OD 600 = 0.6 - 0.8; transfer the bacterial solution to a 50 mL centrifuge tube, place it on ice for about 10 - 15 min; centrifuge at 4000 rpm and 4°C for 5 min to remove the supernatant; add 5 mL of solution A to resuspend; centrifuge at 4000 rpm and 4°C for 5 min to remove the supernatant; add 5 mL of solution B to resuspend the bacteria, aliquot at 100 μL per portion and store at -80°C.

[0049] (IV) Transformation of Escherichia coli

[0050] Thaw the Escherichia coli competent cells on ice; take 10 μL of the recombinant product and add it to 100 μL of the competent cells, let it stand on ice for 30 min; heat shock in a 42°C water bath for 45 s, and let it stand on ice for 2 min; add 1 mL of LB medium and incubate at 37°C and 220 rpm for 60 min; centrifuge at 4000 rpm for 2 min, remove 900 μL of the supernatant, resuspend the bacteria with the remaining medium, and spread on the plate with the corresponding resistance.

[0051] (V) Extraction of asiaticoside: After the fermentation is completed, take 2 ml of the fermentation broth and add the same volume of methanol. Vigorously shake and mix well, then centrifuge at 14000 r / min for 10 min. After taking the supernatant, filter it through a 0.22 μm organic phase filter membrane and use Shimadzu UPLC - IT - TOF / MS for product detection.

[0052] (6) HPLC determination of asiaticoside: Chromatographic separation was carried out using a Thermo Fisher C18 column (4.6 mm × 250 mm, 5 μm); the column oven temperature was set at 40 °C; the injection volume was 10 μL; the mobile phases were as follows: phase A was ultrapure water (added with 0.1% trifluoroacetic acid), and phase B was acetonitrile (added with 0.1% trifluoroacetic acid); the total flow rate was 1 mL / min, the elution mode was isocratic elution, the ratio of phase A to phase B was 70:30, and the detector wavelength was 210 nm.

[0053] Example 1 Screening of Rhamnosyltransferases with Potential Functions

[0054] The transcriptome data of Centella asiatica was subjected to BLAST alignment with 50 rhamnosyltransferases from different sources with known functions in the literature. The results showed that 5 isozymes were basically homologous to the rhamnosyltransferase genes with known functions in the literature, with an E value of 0. At the same time, there were 5 that could be annotated as rhamnosyltransferases in the KEGG enrichment analysis of the Centella asiatica transcriptome.

[0055] Table 1 Rhamnosyltransferases with High Similarity

[0056]

[0057] Example 2 Amplification of Glycosyltransferase Genes and Construction of Recombinant Escherichia coli Expressing Rhamnosyltransferase

[0058] A primer pair (Table 2) was designed to amplify the rhamnosyltransferase sequences screened in Example 1. Using the cDNA reverse-transcribed from Centella asiatica as a template, PCR amplification was carried out respectively. Primer Star MasterMix (Takara) high-fidelity pfu enzyme was selected, and the conditions were pre-denaturation at 95 °C for 3 min; 30 cycles in the amplification stage, carried out according to 95 °C for 15 s, 60 °C for 15 s, 72 °C for 1 min; extension at 72 °C for 5 min. The PCR products were purified to obtain the target fragments RRT1 - RRT5. At the same time, the vector pRSFDuet-1 was amplified by PCR and the product was purified using the primer pair VvRHM-F and VvRHM-R. The purified fragments RRT1 - RRT5 were respectively recombined with the vector pRSFDuet-1 backbone by Gibson assembly to obtain recombinant vectors, which were then transformed into Escherichia coli JM109. The obtained vectors were sent to Sangon Biotech in Shanghai for sequencing, and the correctly sequenced recombinant plasmids pRSFDuet-1–RRT1 to pRSFDuet-1–RRT5 were obtained, which were respectively transformed into Escherichia coli BL21(DE3)△pgi to obtain recombinant Escherichia coli BL21(DE3)△pgi / pRSFDuet-1–RRT1 to BL21(DE3)△pgi / pRSFDuet-1–RRT5.

[0059] Design primers for amplifying rhamnose isomerase VvRHM from Vitis vinifera (Table 2). Using the synthetic sequence as a template, perform PCR amplification. Select the high-fidelity pfu enzyme Primer Star MasterMix (Takara). The conditions are pre-denaturation at 95 °C for 3 min; 30 cycles in the amplification stage, carried out as 95 °C for 15 s, 56 °C for 15 s, 72 °C for 1 min; extension at 72 °C for 5 min. Purify the PCR product. Perform PCR amplification and product purification on the vector pRSFDuet-1. Recombine the purified fragment VvRHM and the vector pRSFDuet-1 backbone by Gibson assembly to obtain a recombinant vector, and transform Escherichia coli JM109. Send the obtained vector to Shanghai Sangon for sequencing. After correct alignment, transform it into Escherichia coli BL21(DE3)Δpgi to obtain recombinant Escherichia coli BL21(DE3)Δpgi / pRSFDuet-1–VvRHM.

[0060] Table 2 Primers used for constructing the glucosyltransferase expression vector

[0061]

[0062] Example 3 Induced expression of rhamnosyltransferase

[0063] Using the strain BL21(DE3)Δpgi / pRSFDuet-1 transformed with the empty vector pRSFDuet-1 as a control, streak the series of recombinant Escherichia coli constructed in Example 2 on an LB plate containing 50 μg / mL kanamycin and culture at 37 °C for 12 h. Pick a single colony and transfer it into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and culture with shaking at 37 °C and 220 rpm for 12 h. Transfer according to an inoculation amount of 1% by volume to 25 mL of TB liquid medium containing 50 μg / mL kanamycin and culture with shaking at 37 °C and 220 rpm until the OD 600 value reaches 0.6 - 0.8, add isopropyl β-D-thiogalactoside (IPTG) to a final concentration of 0.5 μmol / L, and continue to culture with shaking at 16 °C and 220 rpm for 20 h.

[0064] After the culture is completed, aspirate 1 mL of the bacterial solution to measure the final OD 600 value. Take 1 mL of the bacterial solution, centrifuge at 5000×g for 1 min to collect the cells, and resuspend the cells with 1 mL of 0.1 M PBS buffer at pH 7.4. Centrifuge at 5000×g for 1 min to wash the cells to remove the residual culture medium. Resuspend the cells with 0.1 M PBS buffer at pH 7.4, and control the final OD of the resuspended bacterial solution600 The value is 5. The cells were disrupted using an ultrasonic cell disruptor. After disruption, the disrupted solution was collected and centrifuged at 12,000×g for 2 min. The supernatant was collected, which was the crude enzyme solution of rhamnosyltransferase. The SDS-PAGE results are shown in Figure 1 .

[0065] Example 4 Inducing Recombinant Escherichia coli to Ferment and Produce Asiaticoside

[0066] (1) Constructing Recombinant Escherichia coli for Producing Asiaticoside

[0067] The glucosyltransferase UGT73C7 with the amino acid sequence shown in SEQ ID NO.11 was ligated between the XbaI and EcoRI restriction sites of the vector pETDuet-1, and the glucosyltransferase UGT73AH1 with the amino acid sequence shown in SEQ ID NO.13 was ligated between the NdeI and XhoI restriction sites of the vector pETDuet-1 to construct a recombinant vector, which was then transformed into Escherichia coli JM109. The obtained vector was sent to Shanghai Sangon for sequencing, and the correctly sequenced recombinant plasmid pETDuet-1-UGT73AH1-UGT73C7 was obtained.

[0068] The glucosyltransferase UGT73C8 with the amino acid sequence shown in SEQ ID NO.12 was ligated between the XbaI and EcoRI restriction sites of the vector pETDuet-1, and the glucosyltransferase UGT73AH1 with the amino acid sequence shown in SEQ ID NO.13 was ligated between the NdeI and XhoI restriction sites of the vector pETDuet-1 to construct a recombinant vector, which was then transformed into Escherichia coli JM109. The obtained vector was sent to Shanghai Sangon for sequencing, and the correctly sequenced recombinant plasmid pETDuet-1-UGT73AH1-UGT73C8 was obtained.

[0069] The recombinant plasmid pETDuet-1-UGT73AH1-UGT73C7 or pETDuet-1-UGT73AH1-UGT73C8 was transformed into a series of recombinant Escherichia coli constructed in Example 2 to obtain recombinant Escherichia coli BL21(DE3)Δpgi / pRSFDuet-1–RRT1 / pETDuet-1-UGT73AH1-UGT73C7 to BL21 (DE3)Δpgi / pRSFDuet-1–RRT5 / pETDuet-1-UGT73AH1-UGT73C7, BL21 (DE3)Δpgi / pRSFDuet-1–RRT1 / pETDuet-1-UGT73AH1-UGT73C8 to BL21 (DE3)Δpgi / pRSFDuet-1–RRT5 / pETDuet-1-UGT73AH1-UGT73C8, BL21 (DE3)Δpgi / pRSFDuet-1-VvRHM-RRT / pETDuet-1-UGT73AH1-UGT73C7, BL21(DE3)Δpgi / pRSFDuet-1-VvRHM-RRT / pETDuet-1-UGT73AH1-UGT73C8.

[0070] (2) Shake flask fermentation for the production of asiaticoside

[0071] Using BL21(DE3)Δpgi / pRSFDuet-1 / pETDuet-1 transformed with the empty vector pRSFDuet-1 and pETDuet-1 as the control strain, a series of recombinant Escherichia coli constructed in step (1) were streaked on an LB plate containing 50 μg / mL kanamycin and 50 μg / mL ampicillin and cultured at 37°C for 12 h. Single colonies were picked and transferred into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL ampicillin and cultured with shaking at 37°C and 220 rpm for 12 h. Transferred according to an inoculation amount of 1% by volume into 25 mL of TB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL ampicillin and cultured with shaking at 37°C and 220 rpm until the OD 600 value reached 0.6 - 0.8, IPTG was added to a final concentration of 0.5 μmol / L, and after 6 h, the substrate asiatic acid with a final concentration of 200 mg / L was added, and the culture was continued with shaking at 30°C and 220 rpm for 48 h, and samples were taken for detection at 24 h.

[0072] After the fermentation, 2 ml of fermentation liquid was added with the same volume of methanol, and after vigorous shaking and mixing, centrifuged at 14000 r / min for 10 min. The supernatant was filtered with a 0.22 μm organic phase filter membrane and then the product was detected using Shimadzu UPLC-IT-TOF / MS. Figure 2 , 3 It can be seen that UGT73AH1, glucose glycosyltransferase (UGT73C7 or UGT73C8) and the 5 rhamnose glycosyltransferases screened in Example 1 can be co-expressed to prepare asiaticaside by fermentation. A unique new peak appears at 0.596 min, which is consistent with the characteristic ion current of the asiaticaside standard, confirming that the substance is asiaticaside.

[0073] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Escherichia coli, characterized in that, Using Escherichia coli as the host, knockout the protein-coding gene of glucose phosphate isomerase on the genome pgi , overexpress rhamnose glycosyltransferase, overexpress glucose glycosyltransferase and glycosyltransferase UGT73AH1 ; The amino acid sequence of the rhamnosyltransferase is shown as any one of SEQ ID NO.6 to SEQ ID NO.10; the amino acid sequence of the glucosyltransferase is shown as SEQ ID NO.11 or SEQ ID NO.12; the glycosyltransferase UGT73AH1 is derived from Centella asiatica Centella asiatica (L.) Urban ; the nucleotide sequence of the glucosephosphate isomerase protein-encoding gene pgi is shown as SEQ ID NO.

14.

2. The recombinant Escherichia coli according to claim 1, characterized in that, Express rhamnosyltransferase using the pRSFDuet-1 vector and co-express glucosyltransferase and glycosyltransferase using the pETDuet-1 vector UGT73AH1 。 3. The recombinant Escherichia coli according to claim 1 or 2, characterized in that, Using Escherichia coli BL21 (DE3) as the host.

4. A method for synthesizing asiaticoside, characterized in that, The method uses the recombinant Escherichia coli described in claim 1 or 2 as the starting strain and asiatic acid as the substrate to ferment and produce madecassoside.

5. The method according to claim 4, wherein The method is to inoculate the seed solution of the recombinant Escherichia coli described in claim 1 or 2 into a fermentation medium, and shake-culture until the OD 600 value is 0.6 - 0.8, add isopropyl thiogalactoside, and add asiatic acid with a final concentration of 150 - 250 mg / L 4 - 8 h later, and continue to shake-culture for 40 - 60 h.

6. Use of the recombinant Escherichia coli described in claim 1 or 2 in the synthesis of madecassoside or products containing madecassoside.

7. Use of rhamnosyltransferase in the synthesis of asiaticoside or products containing asiaticoside, characterized in that, The amino acid sequence of the rhamnosyltransferase is as shown in any one of SEQ ID NO.6 to SEQ ID NO.10.

Citation Information

Patent Citations

  • Engineering bacteria for producing L-rhamnose, and construction method and application of engineering bacteria

    CN110527692A

  • Triterpene glycosylation

    WO2019224321A1