A method for constructing a tumor cell pyroptosis model based on dual-color fluorescence labeling

Abstract

The present invention provides a method for constructing a tumor cell pyroptosis model based on dual-color fluorescent labeling, the method comprising: constructing a PB vector plasmid that labels the cell pyroptosis effector gene GSDME and the histone gene H2B with dual-color fluorescent protein; screening a B16 tumor cell pyroptosis cell line that stably expresses GSDME and H2B labeled with dual-color fluorescent protein; using a Caspase-3-activated drug to stimulate the B16 tumor cell pyroptosis cell line labeled with GSDME and H2B with dual-color fluorescent protein, and visualizing the B16 tumor cell pyroptosis process and cell activity detection by fluorescence microscopy. On the one hand, the present invention can intuitively visualize the changes in cell nucleus and cell morphology when tumor cell pyroptosis occurs; on the other hand, the B16 tumor cell pyroptosis cell line model established by the present invention can be used as a powerful tool for screening drugs that induce cell pyroptosis, providing a means for further exploring the immunological molecular mechanism of visualizing cell pyroptosis.

Description

Technical Field

[0001] The present invention relates to the technical field of bio-optical molecular imaging, and in particular to a method for constructing a tumor cell pyroptosis model based on dual-color fluorescent labeling. Background Art

[0002] Pyroptosis, a pro-inflammatory form of programmed cell death, exhibits a typical "bulging" morphology, with rapid cell membrane lysis and the release of a large amount of intracellular immunogenic substances. Gasdermin (GSDM) family proteins are key effector molecules that induce pyroptosis, and GSDME protein is one of its members. The expression level of GSDME protein determines whether cells undergo apoptosis or pyroptosis. Tumor cells expressing high levels of GSDME protein can activate GSDME protein through granzyme B and Caspase-3 cleavage, producing N-terminal-GSMDE aggregates that create holes in the cell membrane, inducing tumor cell pyroptosis, reprogramming the immune status of the tumor microenvironment, and stimulating the body's anti-tumor immune response.

[0003] Chemotherapy is the most common form of cancer treatment. Pyroptosis is considered an effective means of enhancing the anti-tumor efficacy of chemotherapy drugs. Chemotherapy drugs trigger pyroptosis in tumor cells, thereby stimulating the body's anti-tumor immune response. Therefore, manipulating tumor cell pyroptosis has great potential for cancer treatment. Because the immunological prognosis of tumor cell pyroptosis differs from other cell death modes such as apoptosis and necrosis, constructing a tumor cell pyroptosis model is beneficial for exploring the molecular immunological mechanisms induced by tumor cell pyroptosis.

[0004] Existing literature reports that pyroptotic tumor cell lines stably expressing GSDME can be obtained through lentiviral transfection. However, the use of viral vectors is cumbersome, requires a strict experimental environment, and is expensive. Furthermore, these pyroptotic tumor cell lines lack suitable molecular markers for visualization and imaging, making it impossible to visualize the dynamic changes in the nucleus and cytoplasm during pyroptosis. Summary of the Invention

[0005] The present invention provides a method for constructing a tumor cell pyroptosis model based on dual-color fluorescent labeling, so as to at least solve the technical problem in the prior art that the dynamic change information of the cell nucleus and cytoplasm during cell pyroptosis cannot be visualized.

[0006] The present invention provides a method for constructing a tumor cell pyroptosis model based on dual-color fluorescent labeling, the method comprising:

[0007] Construct a PB vector plasmid that contains dual-color fluorescent proteins to label the pyroptosis effector gene GSDME and the histone gene H2B;

[0008] Screening of B16 tumor cell pyroptosis cell lines stably expressing dual-color fluorescent protein-tagged GSDME and H2B;

[0009] Caspase-3 activating drugs were used to stimulate the pyroptosis of B16 tumor cells labeled with dual-color fluorescent proteins GSDME and H2B. Fluorescence microscopy was used to visualize the pyroptosis process of B16 tumor cells and detect cell activity.

[0010] In one embodiment, the dual-color fluorescent protein is mCerulean and mCherry.

[0011] In one embodiment, the construction of a PB vector plasmid for labeling the pyroptosis effector gene GSDME and the histone gene H2B with a dual-color fluorescent protein comprises:

[0012] Use restriction enzymes to cut the PB vector and linearize it;

[0013] The GSDME fragment was labeled with mCerulean to obtain the GSDME-mCerulean fragment; the H2B fragment was labeled with mCherry to obtain the H2B-mCherry fragment;

[0014] The GSDME-mCerulean fragment and the H2B-mCherry fragment were constructed into a PB vector to obtain a PB vector plasmid containing dual-color fluorescent protein labeled GSDME-mCerulean and H2B-mcherry.

[0015] In one embodiment, the GSDME-mCerulean fragment and the H2B-mCherry fragment are connected by an IRES-linker so that two fluorescent protein-tagged molecules can be expressed independently;

[0016] The base sequence of the IRES is:

[0017] .

[0018] In one embodiment, the screening of a B16 tumor cell pyroptosis cell line stably expressing dual-color fluorescent protein-labeled GSDME and H2B comprises:

[0019] The PB vector plasmid containing GSDME-mCerulean and H2B-mcherry and a helper plasmid expressing PBase transposase were co-transfected into B16 tumor cells in which the GSDME gene was knocked out;

[0020] The transfected tumor cells were cultured, and monoclonal cell lines of B16 tumor cells with pyroptosis that stably expressed dual-color fluorescent proteins were screened by targeted digestion.

[0021] In one embodiment, the transfected tumor cells are placed in RPMI1640 medium containing 10% fetal bovine serum and cultured at 37° C. containing 5% CO 2 .

[0022] In one embodiment, the site-directed digestion method for screening out a monoclonal cell line of B16 tumor cells stably expressing dual-color fluorescent protein and exhibiting pyroptosis comprises:

[0023] The transfected B16 tumor cells were digested and plated into a 96-well plate. After culturing for several days, monoclonal cell clusters expressing dual-color fluorescent protein were screened under a fluorescence microscope and transferred to a new well plate for culture.

[0024] After culturing for several days, monoclonal cell clusters with dual-color fluorescence were screened under a fluorescence microscope. Each well contained only one cell with dual-color fluorescence.

[0025] In one embodiment, the luminescence rate of the screened B16 pyroptotic cell line stably expressing the dual-color fluorescent protein markers GSDME-mCerulean and H2B-mcherry is above 95%.

[0026] In one embodiment, the method of using a Caspase-3 activating drug to stimulate a dual-color fluorescently labeled B16 tumor cell pyroptosis cell line, and visualizing B16 tumor cell pyroptosis and cell activity by fluorescence microscopy, comprises:

[0027] The pyroptosis process of B16 tumor cells was observed by long-term dynamic imaging using dual-color fluorescent-labeled B16 tumor cell lines screened by Caspase-3 activated Raptinal drug stimulation.

[0028] Caspase-3 activated Raptinal drug stimulated B16 tumor cell pyroptosis cell line. Cell culture supernatant at different time points after drug stimulation was collected to detect the release of cellular lactate dehydrogenase (LDH) and quantitatively analyze cell activity.

[0029] The present invention discloses a method for constructing a tumor cell pyroptosis model based on dual-color fluorescent labeling, which comprises constructing a PB vector plasmid containing dual-color fluorescent proteins labeling GSDME and H2B; screening a B16 tumor cell pyroptosis cell line that stably expresses dual-color fluorescent protein-labeled GSDME and H2B; and then using a Caspase-3-activating drug to stimulate the B16 tumor cell pyroptosis cell line containing dual-color fluorescent proteins labeling GSDME and H2B, and visualizing the B16 tumor cell pyroptosis process and detecting cell activity by fluorescence microscopy. On the one hand, the present invention can intuitively visualize the changes in cell nucleus and cell morphology when tumor cell pyroptosis occurs; on the other hand, the B16 tumor cell pyroptosis cell line model established by the present invention can be used as a powerful tool for screening drugs that induce cell pyroptosis, providing a means for further exploring the immunological molecular mechanism stimulated by visualized cell pyroptosis.

[0030] It should be understood that the content described in this section is not intended to identify the key or important features of the embodiments of the present invention, nor is it intended to limit the scope of the present invention. Other features of the present invention will become readily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The above and other objects, features and advantages of the exemplary embodiments of the present invention will become readily apparent by reading the following detailed description with reference to the accompanying drawings, in which several embodiments of the present invention are shown by way of example and not limitation, in which:

[0032] In the drawings, the same or corresponding reference numerals denote the same or corresponding parts.

[0033] Figure 1 A schematic diagram showing a process of constructing a dual-color fluorescently labeled tumor cell pyroptosis model according to an embodiment of the present invention is shown;

[0034] Figure 2 Shown is a PB plasmid map of GSDME-mCerulean and H2B-mcherry dual-color fluorescent labeling in an embodiment of the present invention;

[0035] Figure 3 The invention shows a method for screening a B16 tumor cell pyroptosis monoclonal cell line stably expressing a dual-color fluorescent protein using a fixed-point aspiration method.

[0036] Figure 4 The luminescence rate of the B16 tumor cell pyroptosis cell line stably expressing dual-color fluorescent protein screened by confocal microscopy imaging in an embodiment of the present invention is shown, and a representative confocal imaging image is provided;

[0037] Figure 5 Figure 2 shows a quantitative statistical graph of the luminescence rate of a B16 tumor cell line stably expressing a dual-color fluorescent protein, screened by confocal microscopy imaging, according to an embodiment of the present invention. A statistical graph of fluorescent and non-fluorescent cells in 10 random imaging fields is shown. The data are from 10 images from three confocal dishes, performed in two independent experiments. The statistical method used was an unpaired two-tailed t-test. Values ​​are presented as mean ± standard deviation. P < 0.001 (***), P < 0.002 (**), P < 0.033 (*), ns: no significant difference.

[0038] Figure 6The figure shows that a Caspase-3-activating drug stimulates a dual-color fluorescently labeled B16 tumor cell pyroptosis cell line according to an embodiment of the present invention, and fluorescence microscopy imaging visualizes the entire process of B16 tumor cell pyroptosis. The Caspase-3-activating drug is a Raptinal inducer, and 15 μM of Raptinal is used to incubate and culture tumor cells expressing the dual-color fluorescent proteins GSDME-mCerulean and H2B-mcherry-B16. The figure shows images of morphological changes in cell pyroptosis observed by confocal imaging after 2 hours of Raptinal treatment. The cyan color represents the fluorescence signal of GSDME labeled with mCerulean, and the red color represents the nuclear fluorescence signal of H2B labeled with mcherry. The imaging time is 20 minutes, and the scale bar is 20 μm. The upper row shows the dual-color fluorescence merge fluorescence images, and the lower row shows the corresponding bright field images.

[0039] Figure 7 Quantitative statistics of the cell activity of dual-color fluorescence-labeled B16 tumor cells pyroptosis stimulated by Caspase-3-activating drugs in an embodiment of the present invention are shown; the cell lines in the experimental groups were the B16 cell line and the Ko-GSMDE-B16 cell line in which the screened dual-color fluorescence-expressing cell lines were GSDME-mCerulean and H2B-mcherry, and the Caspase-3-activating drug was 15 μM Raptinal. Three replicate wells were detected at each time point, and the experiment was repeated twice independently; the values ​​are shown as the mean ± sample standard error (n ≥ 3 per group), and statistical analysis was performed using a two-tailed Student's t-test, ns: no significant difference, *P < 0.0332, **P < 0.0021, ***P < 0.0002, ****P < 0.0001. DETAILED DESCRIPTION

[0040] In order to make the purposes, features, and advantages of the present invention more obvious and easy to understand, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative efforts shall fall within the scope of protection of the present invention.

[0041] Constructing a tumor cell pyroptosis model is beneficial for exploring the immunological molecular mechanisms that trigger tumor cell pyroptosis. Existing protocols have drawbacks such as cumbersome procedures, strict experimental environment requirements, and high costs. Furthermore, they lack molecular markers suitable for visual imaging, making it impossible to visualize the dynamic changes in the nucleus and cytoplasm during cell pyroptosis. To address this issue, the present invention proposes a method for constructing a dual-color fluorescently labeled tumor cell pyroptosis model based on a labeling strategy using fluorescent protein molecules.

[0042] like Figure 1 A schematic flow chart of a method for constructing a dual-color fluorescently labeled tumor cell pyroptosis model according to an embodiment of the present invention is shown. The method includes:

[0043] S1, constructing a PB vector plasmid for labeling the pyroptosis effector gene GSDME and the histone gene H2B with dual-color fluorescent proteins;

[0044] The dual-color fluorescent proteins are mCerulean and mcherry, and the vector plasmid is PB (PiggyBac) plasmid. A plasmid for co-expressing GSDME-mCerulean and H2B-mcherry is constructed. The mCerulean fluorescent protein labels the GSDME molecule, and the mcherry fluorescent protein labels the H2B molecule.

[0045] In one example, a PB vector plasmid for labeling the pyroptosis effector gene GSDME and the histone gene H2B with dual-color fluorescent proteins was constructed, including:

[0046] Use restriction enzymes to cut the PB vector and linearize it;

[0047] The GSDME fragment was labeled with mCerulean to obtain the GSDME-mCerulean fragment; the H2B fragment was labeled with mCherry to obtain the H2B-mCherry fragment;

[0048] The GSDME-mCerulean fragment and the H2B-mCherry fragment were constructed into the PB vector to obtain the PB vector plasmid with dual-color fluorescent protein labeled GSDME-mCerulean and H2B-mCherry.

[0049] Specifically, for example, the PB vector is cut and linearized using EcoRI-HF and AflII restriction enzymes; mCerulean and GSDME are ligated using a GGGSGGGS linker to obtain a GSDME-mCerulean fragment. Similarly, mCherry and H2B are ligated using a GGGSGGGS linker to obtain an H2B-mCherry fragment.

[0050] Then, IRES-linker was used to connect the GSDME-mCerulean fragment and the H2B-mcherry fragment to ensure that the two fluorescent protein-tagged molecules could be expressed independently, thus obtaining the following Figure 2 Plasmid map of GSDME-mCerulean-H2B-mcherry-PB shown;

[0051] The sequence of the IRES used:

[0052] CTCGAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATACTCCCTT

[0053] CCCGTAACTTAGACGCACAAAACCAAGTTCAATAGAAGGGGGTACAAAC

[0054] CAGTACCACCACGAACAAGCACTTCTGTTTCCCCGGGTGATGTCGTATAGA

[0055] CTGCTTGCGTGGTTGAAAGCGACGGATCCGTTATCCGCTTATGTACTTCGA

[0056] GAAGCCCAGTACCACCTCGGAATCTTCGATGCGTTGCGCTCAGCACTCAA

[0057] CCCCAGAGTGTAGCTTAGGCTGATGAGTCTGGACATCCCTCACCGGTGAC

[0058] GGTGGTCCAGGCTGCGTTGGCGGCCTACCTATGGCTAACGCCATGGGACG

[0059] CTAGTTGTGAACAAGGTGTGAAGAGCCTATTGAGCTACATAAGAATCCTC

[0060] CGGCCCCTGAATGCGGCTAATCCCAACCTCGGAGCAGGTGGTCACAAACC

[0061] AGTGATTGGCCTGTCGTAACGCGCAAGTCCGTGGCGGAACCGACTACTTT

[0062] GGGTGTCCGTGTTTCCTTTTATTTTATTGTGGCTGCTTATGGTGACAATCAC

[0063] AGATTGTTATCATAAAGCGAATTGGATAGGATCCGTACGATGGTGGTAGGGATCCG.

[0064] S2. Screening of B16 tumor cell pyroptosis cell lines stably expressing dual-color fluorescent protein-tagged GSDME and H2B;

[0065] In one example, a B16 tumor cell line stably expressing dual-color fluorescent protein-tagged GSDME and H2B was screened for pyroptosis, including:

[0066] The PB vector plasmid containing GSDME-mCerulean and H2B-mcherry and a helper plasmid expressing PBase transposase were co-transfected into B16 tumor cells in which the GSDME gene was knocked out;

[0067] The transfected tumor cells were cultured and a monoclonal cell line of B16 tumor cells stably expressing dual-color fluorescent protein and undergoing pyroptosis was screened by targeted digestion. The transfected tumor cells were placed in RPMI1640 medium containing 10% fetal bovine serum and cultured at 37°C with 5% CO2.

[0068] First, B16 tumor cells with GSDME protein knocked out were cultured, and the constructed GSDME-mCerulean-IRES-H2B-mcherry PB plasmid and transfection liposomes were mixed and incubated, and then transfected into tumor cells for expression, and B16 tumor cells stably expressing dual-color fluorescent protein were screened.

[0069] Preparation before transfection: Plate the cells one day in advance. Use a 96-well plate and seed 0.8 to 1 × 10 cells per well. 4 The transfection reagent used was 2000Reagent.

[0070] The specific steps for plasmid transfection are as follows:

[0071] (1) Lipo2000 dilution solution: Lipo2000 uses a 0.5 μl system: pre-add Medium 50μl, add 5μl 2000.

[0072] (2) Plasmid DNA dilution solution (plasmid + pBase): prepare a sterile 1.5 ml EP tube, take 1.25 μg PB-GSDME-mCerulean-IRES-H2B-mcherry plasmid and mix it with 1.25 μg pBase plasmid, and add 2.5 μg of the mixed plasmid to 125 μl Opti-MEMRMedium.

[0073] (3) Prepare a mixture of plasmid DNA dilution solution and Lipo 2000 dilution solution. Take a new 1.5EP tube, take 25μl of plasmid DNA dilution solution and 25μl of Lipo 2000 dilution solution, be careful not to let the droplets hang on the EP tube wall, and incubate at room temperature for 15 minutes.

[0074] (4) After incubation at room temperature, replace the complete medium in the wells to be transfected with fresh 10% FBS + 1640 medium, add 100 μl of fresh medium to each well, and then add the corresponding volume of DNA-lipid complex to each well plate, adding 10 μl to each well.

[0075] (5) After incubation for 6 to 8 hours, replace the complete culture medium.

[0076] Specific implementation steps for site-directed digestion screening of monoclonal cell clusters expressing dual fluorescence:

[0077] 48 hours after transfection, the fluorescence expression was observed under a fluorescence microscope. The fluorescence expression level was about 20-30%. The cells in the 96-well plate were digested, counted, and re-plated into a new 96-well plate, with about 100 cells per well.

[0078] After the cells have been cultured in the well plate for 4 to 6 days, observe the fluorescent cells in clusters under a fluorescence microscope, select the fluorescent cell clusters and make sure there are no non-luminescent cells around them. Then, use a black marker to draw circles at the bottom of the 96-well plate to determine the location of the fluorescent cells and circle the cells with the dual-color fluorescent group. Figure 3 As shown in the left picture, a cluster of cells is circled. Only the white light imaging image is shown here as an example. It has been confirmed that this cluster of cells has dual-color fluorescent labeling and there are no other obvious non-luminescent cell clusters around it.

[0079] Next, add a drop of trypsin to this well in the 96-well plate and wait until the cells slowly become round. Figure 3 Then use a 20μl pipette tip to aspirate the circled cell clusters, and aspirate about 2-3μl of the cell suspension into a 15ml centrifuge tube. Add an appropriate amount of culture medium to dilute the suspension, and plate the cells into a new 96-well plate, with about 1 cell per well.

[0080] Then, the newly laid 96-well plate was placed in a 37°C incubator for 5-7 days. Then, under a fluorescence microscope, the monoclonal cell clusters expressing only dual-color fluorescence were selected, and it was ensured that there were no other non-luminescent cell clusters in this well. The cells in this well were further digested and then transferred to a 24-well plate for expansion culture, and then transferred to a 25cm 3 The B16 tumor cell line labeled with GSDME-mCerulean and H2B-mcherry dual-color fluorescence was obtained by culture flask culture, and the cells were frozen for seed preservation.

[0081] The method of screening monoclonal cell lines by targeted digestion can solve the high cost of flow cytometry cell sorting, and compared with the method of obtaining monoclonal cells by infinite dilution screening, it can greatly reduce the time spent on cell screening.

[0082] The screened cells are monoclonal cell lines expressing dual-color fluorophores. Through fluorescence microscopy, the fluorescence luminescence rate is quantitatively determined to be above 95%.

[0083] Specific implementation steps: The screened cells were plated onto confocal plates one day in advance, and 1×10 5 When the cell density reached approximately 80%, imaging was performed using an LSM 710 laser confocal microscope. The cyan fluorescent protein mCerulean has an excitation peak wavelength of 433 nm and an emission peak wavelength of 475 nm. Excitation was performed using a 405 nm laser on the LSM 710 laser confocal microscope, with the detection channel set to a wavelength range of 410 to 525 nm. The red fluorescent protein mCherry has an excitation peak wavelength of 587 nm and an emission peak wavelength of 610 nm. Excitation was performed using a 561 nm laser on the LSM 710 laser confocal microscope, with the detection channel set to a wavelength range of 570 to 660 nm. Simultaneous imaging of both fluorescence and bright field was performed.

[0084] Representative confocal images are shown in Figure 4 As shown, image processing software such as ImageJ and Imaris 7.6 were used to separate the fluorescence image from the bright field, and the number of cells in the fluorescence image and bright field field of each image was counted. The fluorescence luminescence rate of the cell line was obtained by calculating the ratio of the number of fluorescent cells to the total number of cells.

[0085] In the 10 confocal images counted, the total number of fluorescent cells was 2004, the number of non-fluorescent cells was 21, and the total number of cells was 2025. The ratio of the number of fluorescent cells to the total number of cells was about 98.96%. Figure 5 The statistical results of confocal imaging showed that the fluorescent protein expression of GSDME-mCerulean-H2B-mcherry-B16 obtained by site-directed digestion screening was stable and had a high luminescence rate (more than 98%).

[0086] S3. Caspase-3 activating drugs were used to stimulate the pyroptosis of B16 tumor cells labeled with dual-color fluorescent proteins GSDME and H2B. Fluorescence microscopy was used to visualize the pyroptosis process of B16 tumor cells and detect cell activity.

[0087] In one example, a Caspase-3-activating drug was used to stimulate a dual-color fluorescently labeled B16 tumor cell pyroptosis cell line. Fluorescence microscopy was used to visualize B16 tumor cell pyroptosis and detect cell viability, including:

[0088] Caspase-3 activated Raptinal (activator) drug stimulation screened dual-color fluorescent labeled B16 tumor cell pyroptosis cell line, and long-term dynamic imaging was used to observe the entire process of B16 tumor cell pyroptosis;

[0089] Caspase-3 activated Raptinal drug stimulated B16 tumor cell pyroptosis cell line. Cell culture supernatant at different time points after drug stimulation was collected to detect the release of cellular lactate dehydrogenase (LDH) and quantitatively analyze cell activity.

[0090] The specific operation method for long-term dynamic imaging to observe the entire process of B16 tumor cell pyroptosis is as follows: cells are plated one day in advance, and the dual-color fluorescently labeled B16 tumor cell pyroptosis cell line is plated into the confocal dish. After the cells grow to an appropriate density, the cells are washed once with 1×PBS, and then 10% FBS+1640 prepared with a concentration of 15μM Raptinal is added for incubation, and then the confocal dish is taken for fluorescence imaging.

[0091] The two-color fluorescence and bright field images were simultaneously imaged using an LSM 710 laser confocal microscope at 60×. Figure 6 Shown are the morphological changes in cell apoptosis and fluorescence microscopy images of the cell nucleus of the screened dual-color fluorescently labeled tumor cells after incubation with 15μM Raptinal for 2 hours. The cyan color is the GSDME fluorescence signal labeled with mCerulean, and the red color is the H2B cell nuclear fluorescence signal labeled with mcherry. The imaging time is 20 minutes. The upper row is the fluorescence imaging of the dual-color fluorescently labeled cells (the image has been grayscale processed), and the lower row is the result of simultaneous bright field imaging.

[0092] H2B labeling can be used to monitor the division process and nuclear fragmentation of tumor cells in vivo. The imaging data shows that the nuclei of H2B cells labeled with mCherry in the upper row gradually expand and the fluorescence signal gradually decreases during the process of cell pyroptosis (e.g. Figure 6, as shown by the arrows in the upper row), until the cell membrane ruptures and the fluorescence signal disappears, indicating that the cell gradually dies. The change in the fluorescence signal of mCerulean-labeled GSDME in the cytoplasm shows that at the beginning, a large number of pyroptotic vesicles gather in the cytoplasm. A large number of pyroptotic vesicles can also be clearly seen in the cytoplasm under bright field. After that, the cell swells and ruptures violently, and the fluorescence signal of mCerulean disappears. In the late stage of pyroptosis, the typical morphology of cell pyroptosis, such as spitting out large vesicles, is shown (as shown in the figure). Figure 6 , as indicated by the arrows in the lower row of bright field images). Therefore, the dual-color fluorescently labeled tumor cell pyroptosis model developed and constructed by the present invention can characterize the entire process of cell pyroptosis.

[0093] Caspase-3 activated Raptinal drug stimulated B16 tumor cell pyroptosis cell line. Cell culture supernatant at different time points after drug stimulation was collected to detect the release of cellular lactate dehydrogenase (LDH) and quantitatively analyze cell activity.

[0094] The specific operation is to use 15μM Raptinal drug to induce the selection of dual-color fluorescence expression cells, detect the release of lactate dehydrogenase (LDH) of cell pyroptosis effect, and quantitatively analyze cell activity. Promega's CytoTox The kit can quantitatively detect the content of lactate dehydrogenase (LDH).

[0095] The specific implementation steps are as follows:

[0096] (1) First, the screened dual-color fluorescent-expressing tumor cells were plated, with 8,000 cells / well plated in a 96-well plate. The experimental control group used a B16 GSDME knockout cell line, the Ko-GSDME-B16 tumor cell line.

[0097] (2) Add the test compound and solvent control (DMSO) to the corresponding wells. The test compound concentration is 15 μM Raptinal and the final volume of each well is 100-150 μl.

[0098] (3) Incubate cells at 37°C with 15 μM Raptinal drug until the desired time point, which can be set at 30, 60, 90, 120, 150, 180, and 210 min. Note: When LDH is released into the cell culture medium, its half-life is approximately 9 h. If the experiment requires the use of lysis buffer to obtain a maximum LDH release control, add 10 μl of 10× Lysis Solution (100 μl initial volume) to the positive control well 45 min before adding the CytoTox96 reagent.

[0099] (4) Transfer 50 μl of supernatant from all test wells and control wells to a new 96-well clear flat-bottom plate.

[0100] (5) Add 50 μl of CytoTox96 reagent to each sample well, cover the multiwell plate with aluminum foil or an opaque box to protect it from light, and incubate at room temperature for 30 min.

[0101] (6) Add 50 μl of Stop Solution to each well of the 96-well plate.

[0102] (7) Use a syringe needle to puncture large bubbles and, after adding the reaction stop solution, measure the absorbance at 490 nm or 492 nm within 1 hour.

[0103] The quantitative results of cell activity showed that after treatment with 15 μM Raptinal, the experimental group cell lines showed a large release of LDH 1 to 1.5 hours after drug treatment, indicating that the cell membrane ruptured and the integrity of the cell membrane was damaged, which was consistent with the phenomenon of severe cell membrane rupture caused by cell pyroptosis (such as Figure 6 , shown in the upper row). The cell line, similar to the control group, showed low LDH release, which only increased in the later stages of drug stimulation, consistent with cell membrane rupture and increased cell membrane permeability in the late stages of apoptosis. Quantitative analysis of cell viability was consistent with the results observed using a cell fluorescence microscope. Therefore, the dual-color fluorescently labeled B16 tumor cell pyroptosis cell line screened by the present invention is capable of characterizing the process of tumor cell pyroptosis.

[0104] In summary, the present invention proposes a method for constructing a tumor cell pyroptosis model based on dual-color fluorescent labeling, which is achieved by constructing a PB vector plasmid that labels GSDME and H2B with dual-color fluorescent proteins; then screening for B16 tumor cell pyroptosis cell lines that stably express GSDME and H2B labeled with dual-color fluorescent proteins; then using Caspase-3-activating drugs to stimulate the B16 tumor cell pyroptosis cell lines labeled with GSDME and H2B with dual-color fluorescent proteins, and visualizing the B16 tumor cell pyroptosis process and cell activity detection by fluorescence microscopy. On the one hand, the present invention can intuitively visualize the changes in the cell nucleus and cell morphology when tumor cell pyroptosis occurs; on the other hand, the B16 tumor cell pyroptosis cell line model established by the present invention can be used as a powerful tool for screening drugs that induce cell pyroptosis, providing a means for further exploring the immunological molecular mechanism of visualized cell pyroptosis.

[0105] It should be understood that the various forms of the processes shown above can be used to reorder, add, or delete steps. For example, the steps described in this disclosure can be performed in parallel, sequentially, or in a different order, as long as the desired results of the technical solutions disclosed in this disclosure can be achieved. This is not a limitation herein.

[0106] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of the technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of such features. In the description of the present invention, "plurality" means two or more, unless otherwise specifically defined.

[0107] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in the present invention should be included in the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.

Claims

1. A method for constructing a tumor cell pyroptosis model based on dual-color fluorescent labeling, characterized in that: The method comprises: Constructing a PB vector plasmid for labeling the cell pyroptosis effector gene GSDME and the histone gene H2B with dual-color fluorescent proteins, wherein the dual-color fluorescent proteins are mCerulean and mCherry; comprising: using a restriction endonuclease to cut the PB vector and linearize the PB vector; labeling the GSDME fragment with mCerulean to obtain a GSDME-mCerulean fragment; labeling the H2B fragment with mCherry to obtain an H2B-mCherry fragment; constructing the GSDME-mCerulean fragment and the H2B-mCherry fragment into the PB vector to obtain a PB vector plasmid for labeling the dual-color fluorescent proteins GSDME-mCerulean and H2B-mCherry, wherein the GSDME-mCerulean fragment and the H2B-mCherry fragment are connected by an IRES-linker to enable independent expression of the two fluorescent protein-labeled molecules; the base sequence of the IRES is: Screening of B16 tumor cell pyroptosis cell lines stably expressing dual-color fluorescent protein-tagged GSDME and H2B; Caspase-3 activating drugs were used to stimulate the pyroptosis of B16 tumor cells labeled with dual-color fluorescent proteins GSDME and H2B. Fluorescence microscopy was used to visualize the pyroptosis process of B16 tumor cells and detect cell activity.

2. The method according to claim 1, characterized in that The method for screening a B16 tumor cell pyroptosis cell line stably expressing dual-color fluorescent protein-labeled GSDME and H2B comprises: The PB vector plasmid containing GSDME-mCerulean and H2B-mcherry and a helper plasmid expressing PBase transposase were co-transfected into B16 tumor cells in which the GSDME gene was knocked out; The transfected tumor cells were cultured, and monoclonal cell lines of B16 tumor cells with pyroptosis that stably expressed dual-color fluorescent protein were screened by targeted digestion.

3. The method according to claim 2, characterized in that The transfected tumor cells were placed in RPMI1640 culture medium containing 10% fetal bovine serum and cultured at 37° C. containing 5% CO 2 .

4. The method according to claim 3, characterized in that The site-directed digestion screened out a monoclonal cell line of B16 tumor cell pyroptosis that stably expressed dual-color fluorescent protein, including: The transfected B16 tumor cells were digested and plated into a 96-well plate. After culturing for several days, monoclonal cell clusters expressing dual-color fluorescent protein were screened under a fluorescence microscope and transferred to a new well plate for culture. After culturing for several days, monoclonal cell clusters with dual-color fluorescence were screened under a fluorescence microscope. Each well contained only one cell with dual-color fluorescence.

5. The method according to claim 4, characterized in that The luminescence rate of the screened B16 pyroptotic cell line stably expressing dual-color fluorescent protein markers GSDME-mCerulean and H2B-mcherry was above 95%.

6. The method according to claim 1, wherein The method uses a Caspase-3 activating drug to stimulate a dual-color fluorescently labeled B16 tumor cell pyroptosis cell line, and uses fluorescence microscopy to visualize B16 tumor cell pyroptosis and detect cell activity, including: The pyroptosis process of B16 tumor cells was observed by long-term dynamic imaging using dual-color fluorescent-labeled B16 tumor cell lines screened by Caspase-3 activated Raptinal drug stimulation. Caspase-3 activated Raptinal drug stimulated B16 tumor cell pyroptosis cell line. Cell culture supernatant at different time points after drug stimulation was collected to detect the release of cellular lactate dehydrogenase (LDH) and quantitatively analyze cell activity.

Images