Sensor for detecting cytochrome c and caspase in single cell as well as preparation method and application of sensor
The simultaneous detection of cytochrome c and caspase in single cells using a dual-channel theta-type nanotube sensor solves the problem of difficult simultaneous detection in existing technologies, achieving high sensitivity and low damage detection results, and is suitable for single-cell apoptosis research and drug action mechanism evaluation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-01
- Publication Date
- 2026-04-03
AI Technical Summary
Existing technologies cannot achieve simultaneous, low-damage detection of cytochrome c and caspase within single cells, and also suffer from problems such as photobleaching and heavy probe load.
A dual-channel θ-type nanotube sensor is used, with one channel immobilizing cytochrome c aptamers and the other channel immobilizing caspase recognition peptides. Cytoplasmic contents are extracted via electroosmosis and IV curves are recorded for detection, enabling simultaneous detection.
It enables simultaneous detection of cytochrome c and caspase, avoiding damage from multiple punctures, and features high sensitivity, selectivity, and reversibility. It can monitor the apoptosis process in real time and is suitable for research on different cell lines and evaluation of drug action mechanisms.
Smart Images

Figure CN121783816A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of single-cell analysis technology, and in particular to a sensor for detecting cytochrome c and caspase in single cells, its preparation method, and its application. Background Technology
[0002] Apoptosis is a highly heterogeneous and dynamic process, with cytochrome c (CYT c) and caspase-3 being key protein markers in the initiation and execution phases, respectively. Existing single-cell detection technologies, such as fluorescence imaging, suffer from problems like photobleaching and heavy probe load, and most can only detect a single target, failing to achieve simultaneous monitoring of CYT c and caspase-3, thus hindering a comprehensive reflection of the apoptosis process. Patent publication CN119178756A relates to the preparation of fluorescent probes for cytochrome c and MeHA gel microneedles, and their application in CYT c detection, but it also faces issues such as photobleaching and heavy probe load. Patent publication CN119000835A relates to the preparation of cell bio-MOF and Peptide#CoFeO-4@Au, and their application in caspase-3 detection, but it suffers from the limitation of single-target detection. Therefore, there is an urgent need to develop sensors and methods capable of real-time, synchronous, and highly selective detection of multiple apoptotic markers within single cells. Summary of the Invention
[0003] In view of the shortcomings of the prior art, the purpose of this invention is to provide a sensor for detecting cytochrome c and caspase-3 in single cells, as well as its preparation method and application, aiming to solve the problem that existing sensors and detection methods cannot achieve low-damage simultaneous detection of cytochrome c and caspase-3.
[0004] The technical solution of the present invention is as follows: In a first aspect, a sensor for detecting cytochrome c and caspase in a single cell is provided, comprising: a theta-type nanotube with dual channels, wherein a cytochrome c aptamer is immobilized in one channel and a caspase recognition peptide is immobilized in the other channel. One end of the θ-type nanotube is a pointed tip, and the pointed tip has θ-type nanopores; The θ-type nanopores have an outer diameter of 280-350 nm, an inner diameter of 100-130 nm, and a spacing of 10-30 nm.
[0005] In a preferred embodiment, the θ-type nanotube is made of quartz and / or glass.
[0006] In a preferred embodiment, the cytochrome c aptamer is a linker DNA-aptamer complex, which is composed of a linker DNA with a nucleotide sequence as shown in SEQ ID NO.1 and an aptamer with a nucleotide sequence as shown in SEQ ID NO.2.
[0007] In a preferred embodiment, the caspase recognition peptide is a bound DNA-DEVD complex, which is composed of bound DNA with a nucleotide sequence as shown in SEQ ID NO.3 and a short DEVD peptide with an amino acid sequence as shown in SEQ ID NO.4.
[0008] In a preferred embodiment, the inner wall of the θ-type nanotube channel is subjected to amylation treatment, and the cytochrome c aptamer and / or caspase recognition peptide are immobilized on the inner wall of the θ-type nanotube channel through an amidation reaction.
[0009] In a further preferred embodiment, the amination treatment is performed using 3-aminopropyltriethoxysilane.
[0010] Secondly, a method for fabricating a sensor as described in the first aspect is provided, comprising the steps of: One end of a θ-type capillary with dual channels is drawn to form a θ-type nanotube with a θ-type nanopore at the tip; The dual channels of the θ-type nanotube were specifically functionalized, with one channel immobilizing the cytochrome c aptamer and the other channel immobilizing the caspase recognition peptide, to obtain the sensor.
[0011] In a preferred embodiment, the step of drawing one end of the dual-channel θ-type capillary is performed using a needle drawing device, and the drawing parameters include: Line 1: Heat=700-900, Fil=2-4, Vel=20-40, Del=120-190, Pull=40-60; Line 2:Heat=700-900, Fil=2-4, Vel=20-40, Del=130-150, Pull=140-160.
[0012] Thirdly, the application of the sensor as described in the first aspect in detecting cytochrome c and cysteine in single cells is provided.
[0013] In a preferred embodiment, the detection of cytochrome c and caspase in single cells is used for one or more of the following purposes: real-time dynamic monitoring of single-cell apoptosis process, research on apoptosis heterogeneity among different cell lines, and evaluation of drug action mechanisms.
[0014] Fourthly, a method for detecting cytochrome c and cysteine in a single cell is provided, comprising the following steps: The tip of the sensor as described in the first aspect is inserted into a single cell to extract cytoplasmic contents through electroosmosis. After removing the sensor, the IV curve is recorded, and the concentrations of cytochrome c and caspase are quantified by the changes in the IV curve.
[0015] In a preferred embodiment, the step of extracting cytoplasmic contents via electroosmosis includes applying a voltage of -2.0V to -0.5V for a duration of 0.5-2 minutes.
[0016] In a preferred embodiment, the step of recording the IV curve after removing the sensor involves a scanning range of -1.0V to +1.0V and a scanning rate of 40-60mV / s for the IV curve.
[0017] Fifthly, a method for regenerating a sensor after detection, as described in the first aspect, is provided, comprising the steps of: Aptamer was backfilled into the channels containing fixed cytochrome c aptamers and then heat-treated. DEVD was backfilled into the channel immobilized with the caspase recognition peptide and then subjected to sonication.
[0018] Beneficial effects: This invention provides a sensor for detecting cytochrome c and caspase in single cells, along with its preparation method and applications. Compared with existing technologies, its advantages are: (1) Dual-channel synchronous detection: Utilizing the unique dual-channel structure of θ-type nanotubes, simultaneous detection of cyt c and caspase-3 is achieved, avoiding damage caused by multiple cell punctures and truly realizing multi-parameter analysis at the single-cell level.
[0019] (2) High sensitivity and selectivity: Detection is performed by the shift of IV curve induced by charge change, with detection ranges of 0.1-60.0 μM (cyt c) and 0.01-30.0 ng / mL (caspase-3), respectively, and it has excellent selectivity for common biomolecules such as HSA, BSA, Hb, ATP, GSH, and Glu.
[0020] (3) Good reversibility and stability: The sensor can be reused more than 7 times through a simple regeneration step, the signal attenuation is less than 5%, and the relative standard deviation of ten detections is less than 3%.
[0021] (4) Real-time dynamic monitoring capability: It can monitor the dynamic changes of Cyt c release and caspase-3 activation during single-cell apoptosis in real time, revealing the spatiotemporal heterogeneity of apoptosis mechanism.
[0022] (5) Broad application prospects: It can be applied to apoptosis research in different cell lines (such as MCF-10A, MCF-7, MDA-MB-231) and drug action mechanism evaluation, providing new ideas for disease diagnosis and treatment. Attached Figure Description
[0023] Figure 1 This is a schematic diagram of the sensor structure of the present invention and a schematic diagram of the detection principle of cyt c and caspase-3.
[0024] Figure 2 These are SEM characterization images and fluorescence channel verification images of the θ-type nanotubes of this invention.
[0025] Figure 3 These are the IV curves, concentration response curves, and selectivity study results of the sensor of this invention used for the detection of cyt c and caspase-3.
[0026] Figure 4 This is a statistical analysis chart showing the results of using the sensor of this invention to detect cyt c and caspase-3 in different cell lines.
[0027] Figure 5 This is a graph showing the real-time monitoring results of cyt c and caspase-3 detected by the sensor of this invention during drug-induced apoptosis. Detailed Implementation
[0028] This invention provides a sensor for detecting cytochrome c and caspase in single cells, its preparation method, and its application. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below.
[0029] This invention provides a sensor for detecting cytochrome c and caspase in a single cell, comprising: a theta-type nanotube with dual channels, wherein one channel is immobilized with a cytochrome c aptamer and the other channel is immobilized with a caspase recognition peptide; One end of the θ-type nanotube is a pointed tip, and the pointed tip has θ-type nanopores; The θ-type nanopores have an outer diameter of 280-350 nm, an inner diameter of 100-130 nm, and a spacing of 10-30 nm.
[0030] Specifically, the sensor used in this embodiment to detect cytochrome c and caspase in single cells employs a θ-shaped nanotube with a unique dual-channel structure. One channel immobilizes the cytochrome c aptamer, and the other channel immobilizes the caspase-3 specific recognition peptide. The tip of the θ-shaped nanotube has a θ-shaped nanopore for penetrating the single cell for sampling. When the target is present, the binding of cytochrome c to its aptamer causes a change in the negative charge density on the inner wall of the sensor channel; conversely, caspase-3 cleaves its recognition peptide, causing a change in the negative charge density on the inner wall of the sensor channel. Both changes cause specific alterations in the rectification characteristics of the current-voltage (IV) curve. By monitoring these changes, simultaneous quantitative detection of the two target proteins can be achieved.
[0031] In some embodiments, the θ-type nanotubes are made of quartz and / or glass.
[0032] In some embodiments, the cytochrome c aptamer is a linker DNA-aptamer complex, which consists of a linker DNA with a nucleotide sequence as shown in SEQ ID NO.1 and an aptamer with a nucleotide sequence as shown in SEQ ID NO.2. When the cytochrome c aptamer is a linker DNA-aptamer complex, the binding of the target cyt c to the aptamer leads to a reduction in the negative charge density on the inner wall of the sensor channel.
[0033] In some embodiments, the caspase recognition peptide is a bound DNA-DEVD complex, which consists of bound DNA with a nucleotide sequence as shown in SEQ ID NO.3 and a short DEVD peptide with an amino acid sequence as shown in SEQ ID NO.4. When the caspase recognition peptide is a bound DNA-DEVD complex, the target caspase-3 cleavage of the DEVD peptide leads to an increase in the negative charge density on the inner wall of the sensor channel.
[0034] In some embodiments, the inner wall of the channel of the θ-type nanotube is aminated, and the cytochrome c aptamer and / or caspase recognition peptide are immobilized on the inner wall of the channel of the θ-type nanotube by amidation.
[0035] In some more specific embodiments, the amination treatment is performed using 3-aminopropyltriethoxysilane (APTES).
[0036] This invention provides a method for fabricating the sensor as described above, comprising the following steps: One end of a θ-type capillary with dual channels is drawn to form a θ-type nanotube with a θ-type nanopore at the tip; The dual channels of the θ-type nanotube were specifically functionalized, with one channel immobilizing the cytochrome c aptamer and the other channel immobilizing the caspase recognition peptide, to obtain the sensor.
[0037] In some embodiments, the step of drawing one end of the dual-channel θ-type capillary is performed using a needle drawing device, and the drawing parameters include: Line 1: Heat=700-900, Fil=2-4, Vel=20-40, Del=120-190, Pull=40-60; Line 2:Heat=700-900, Fil=2-4, Vel=20-40, Del=130-150, Pull=140-160.
[0038] In one specific embodiment, the method for preparing the sensor includes the following steps: S1: Preparation and characterization of θ-type nanotubes (1) A P-2000 needle puller is used to control the quartz θ-type capillary. By precisely controlling the heating temperature and tension parameters, a θ-type nanotube with a uniform structure and a θ-type nanopore at the tip is formed. (2) The morphology of θ-type nanotubes was characterized by scanning electron microscopy to ensure pore size uniformity; (3) The independence and symmetry of the channels were verified by injecting fluorescent dyes (Rhodamine B and FITC) into the two channels respectively; S2: Functional modification of θ-type nanotube channels (1) Cyt c detection channel: First, the inner wall of the channel is aminated using 3-aminopropyltriethoxysilane (APTES), and then the linker DNA-aptamer complex is immobilized on the inner wall of the channel by amidation reaction through EDC / NHS activation; (2) caspase-3 detection channel: First, the inner wall of the channel is aminated with 3-aminopropyltriethoxysilane (APTES), and then the bound DNA-DEVD complex is fixed to the inner wall of the channel by EDC / NHS activation.
[0039] This invention provides an application of the sensor described above in detecting cytochrome c and caspase in a single cell.
[0040] In some embodiments, the detection of cytochrome c and caspase in single cells is used for one or more of the following purposes: real-time dynamic monitoring of single-cell apoptosis process, study of apoptosis heterogeneity among different cell lines, and evaluation of drug action mechanisms.
[0041] This invention provides a method for detecting cytochrome c and caspase in a single cell, comprising the following steps: The tip of the sensor described above is inserted into a single cell to extract cytoplasmic contents through electroosmosis. After removing the sensor, the IV curve is recorded, and the concentrations of cytochrome c and caspase are quantified by the changes in the IV curve.
[0042] In some embodiments, the step of extracting cytoplasmic contents by electroosmosis includes applying a voltage of -2.0V to -0.5V for a duration of 0.5-2 minutes.
[0043] In some embodiments, the step of recording the IV curve after removing the sensor has a scanning range of -1.0V to +1.0V and a scanning rate of 40-60mV / s.
[0044] In one specific implementation, the detection method includes the following steps: (1) The tip of the sensor described above is precisely inserted into the target single cell using a micromanipulation system; (2) Apply negative voltage to perform electroosmotic sampling and extract cytoplasmic contents; (3) After removing the sensor, record the IV curve in Tris-HCl / KCl buffer solution without the target; (4) Quantitative analysis of cyt c and caspase-3 concentrations by measuring the changes in rectification characteristics of the IV curve.
[0045] This invention provides a method for regenerating a sensor after detection as described above, comprising the following steps: Aptamer was backfilled into the channels containing fixed cytochrome c aptamers and then heat-treated. DEVD was backfilled into the channel immobilized with the caspase recognition peptide and then subjected to sonication.
[0046] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0047] This invention provides a sensor and detection method for detecting cytochrome c and caspase-3 at the single-cell level using θ-type nanotubes. Figure 1As shown in Figure a, one channel in the sensor is used to detect Cyt C, and the other channel is used to detect caspase-3. When the sensor tip is inserted into a cell, the cell contents are extracted, and Cyt C and caspase-3 are detected. For Cyt C detection (… Figure 1 (b) First, the inner wall of the θ-type nanotube channel is aminated, followed by amidation to immobilize the link DNA-aptamer to the inner wall. When cyt c is present, the aptamer detaches from the link DNA and preferentially binds to cyt c. This process leads to a change in the charge density (reduction of negative charge) of the inner wall of the θ-type nanotube channel, thus allowing for quantitative detection of cyt c concentration via IV curve analysis. For caspase-3 detection (… Figure 1 (c) Similarly, the inner wall of the θ-type nanotube channel is aminated to immobilize bound DNA-DEVD to the inner wall. When caspase-3 is present, DEVD acts as a target of caspase-3 and can be cleaved by it, leading to a change in the charge density (increased negative charge) of the inner wall of the θ-type nanotube channel. Therefore, the concentration of caspase-3 can be quantitatively detected by IV curve. This strategy provides an effective method for simultaneously detecting cyt c and caspase-3, avoiding multiple cell punctures and the additional burden on the cells.
[0048] Example 1 This embodiment provides a sensor for detecting cytochrome c and caspase in single cells, and evaluates its detection performance as follows: I. Preparation of θ-type nanotubes (1) A P-2000 needle drawing instrument was used to control the quartz θ-type capillary (QT 120-90-7.5). The parameters were set as follows: Line 1: Heat=870, Fil=4, Vel=30, Del=190, Pul=50; Line 2: Heat=900, Fil=3, Vel=20, Del=140, Pul=150. The variation in drawing time was controlled within 0.1 seconds to ensure the reproducibility of the aperture geometry.
[0049] (2) Characterization by SEM ( Figure 2 The θ-type nanotubes have dual channels and exhibit a symmetrical structure. The outer diameter of the θ-type nanopores at the tips of the obtained θ-type nanotubes is approximately 300 nm, the inner diameter is approximately 120 nm, and the spacing between the pores is 20 nm.
[0050] II. Channel Functional Modification (1) Synthesis of linker DNA-aptamer complex: First, centrifuge the tubes containing linker DNA (synthesized and purified by Shanghai Sangon Biotech Co., Ltd., specific sequence as shown in SEQ ID NO.1: TTTTTTTTGCAACAACGTAC) and aptamer (synthesized and purified by Shanghai Sangon Biotech Co., Ltd., specific sequence as shown in SEQ ID NO.2: CCGTGTCTGGGGCCGACCGGCGCATTGGGTACGTTGTTGC) frozen powder at 5000 rpm for 30 s. Dilute aptamer and linker DNA to 10 μM and 11 μM respectively using TE buffer. Mix them in a 1:1 volume ratio, heat in a 95℃ water bath for 5 min, and then cool to room temperature in a cold water bath to form the linker DNA-aptamer complex solution.
[0051] (2) Cyt C detection channel: 5% (v / v) APTES ethanol solution was injected for amination treatment for 30 min, and then the linker DNA-aptamer complex was fixed to the inner wall of the θ-type nanotube channel by amidation reaction using the EDC / NHS activation system.
[0052] (3) Synthesis of bound DNA-DEVD complex: First, centrifuge the tube containing frozen powder of bound DNA (synthesized and purified by Shanghai Sangon Biotech Co., Ltd., specific sequence as shown in SEQ ID NO.3: CCCAGCCTTCCAGCTCCTTGA) at 5000 rpm for 30 s. Dilute the bound DNA to 10 μM using TE buffer. Then, mix the 10 μM bound DNA solution with 4 μM DEVD (prepared by solid-phase peptide synthesis technology, specific sequence as shown in SEQ ID NO.4: Asp–Glu–Val–Asp) solution at a volume ratio of 1:1 at 23 °C for 15 min to form bound DNA-DEVD solution.
[0053] (2) Caspase-3 detection channel: 5% (v / v) APTES ethanol solution was injected for amination treatment for 30 min, and then the bound DNA-DEVD complex was fixed to the inner wall of the channel of the θ-type nanotube using the EDC / NHS activation system.
[0054] (3) Verify the independence and symmetry of the two channels using a fluorescence microscope.
[0055] III. Detection Performance Evaluation (1) Under the condition of incubation for 5 min, cyt c showed a good linear relationship with the current response in the concentration range of 0.1-60 μM. The linear equation was Y=0.1929X–22.9898, and the correlation coefficient R was 0.1929X–22.9898. 2 >0.99 ( Figure 3 (a and b) The sensor exhibits high selectivity for common interfering substances such as 0.15 mM HSA, 0.15 mM BSA, 0.2 mM Hb, 10 mM ATP, 1 mM GSH, and 5 mM Glu, maintaining specific recognition of the target even in mixed systems. Figure 3 (e).
[0056] (2) Under the condition of incubation for 5 min, caspase-3 showed linearity in the concentration range of 0.01-30 ng / mL, and the linear equation was Y=-0.4098X–17.6901, with a correlation coefficient R. 2 >0.99 ( Figure 3 (c and d). The sensor exhibits high selectivity for common interfering substances such as 0.15 mM HSA, 0.15 mM MBSA, 0.2 mM Hb, 10 mM ATP, 1 mM GSH, and 5 mM Glu, maintaining specific recognition of the target analytes even in mixed systems. Figure 3 (f)
[0057] IV. Sensor Regeneration Performance (1) The cyt c detection channel was regenerated by backfilling with 10 μM aptamer solution and annealing at 95 °C for 5 min; after seven complete detection-regeneration cycles, the signal attenuation was less than 5%, indicating that the sensor has good reversibility and stability.
[0058] (2) The caspase-3 detection channel was regenerated by backfilling with 4 μM DEVD solution and sonicating for 5 min. After seven complete detection-regeneration cycles, the signal attenuation was less than 5%, indicating that the sensor has good reversibility and stability.
[0059] V. Applications of Single-Cell Detection Functionalized θ-type nanotubes (i.e., the aforementioned sensor) were placed in an Axopatch 700B system, and their tips were inserted into MCF-10A, MCF-7, or MDA-MB-231 cells using a Sensapex micromanipulator. Cells were treated with STS (5.0 μM) for 4 hours to induce apoptosis. After sampling for 1 min with a -1.0 V voltage applied, linear sweep voltammetry (LSV) was used to measure the IV curve in a target-free Tris-HCl / KCl buffer (20 mmol / L Tris and 40 mmol / L KCl, pH=7.4). The detection results showed ( Figure 4The levels of cyt c and caspase-3 were lowest in MCF-10A cells, followed by MCF-7 cells, and highest in MDA-MB-231 cells. Statistical analysis showed that there was a significant difference between MDA-MB-231 cells and the other two cell types (P<0.05), indicating that MDA-MB-231 cells have higher apoptosis activity.
[0060] VI. Evaluation of the effects of different drugs By comparing the effects of STS alone, STS combined with Z-DEVD-FMK, and letrozole on apoptosis of MDA-MB-231 cells using the above sensors and detection methods, it was found that Z-DEVD-FMK significantly inhibited caspase-3 activation, and letrozole may activate caspase-3 through other pathways, demonstrating the application value of the sensors and detection methods of this invention in the study of drug action mechanisms. Figure 5 ).
[0061] VII. Real-time dynamic monitoring In an STS-induced apoptosis model of MDA-MB-231 cells, the levels of cyt c and caspase-3 were monitored every 30 minutes using the aforementioned sensor and detection method. The results showed that cyt c concentration increased sharply and then plateaued during the 0-1.5 hour period, while caspase-3 concentration increased rapidly and then plateaued during the 2.5-3.5 hour period. Caspase-3 activation lagged behind cyt c release by approximately 1 hour, which is consistent with known apoptosis pathway cascades, confirming that the sensor and detection method of this invention can be used for apoptosis kinetic studies. Figure 5 ).
[0062] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.
Claims
1. A sensor for detecting cytochrome c and caspase in a single cell, characterized in that, include: Theta-shaped nanotubes with dual channels, one channel immobilizing a cytochrome c aptamer and the other channel immobilizing a caspase recognition peptide. One end of the θ-type nanotube is a pointed tip, and the pointed tip has θ-type nanopores; The θ-type nanopores have an outer diameter of 280-350 nm, an inner diameter of 100-130 nm, and a spacing of 10-30 nm.
2. The sensor according to claim 1, characterized in that, The θ-type nanotubes are made of quartz and / or glass; The cytochrome c aptamer is a linker DNA-aptamer complex, which is composed of a linker DNA with a nucleotide sequence as shown in SEQ ID NO.1 and an aptamer with a nucleotide sequence as shown in SEQ ID NO.
2. The caspase recognition peptide is a bound DNA-DEVD complex, which is composed of bound DNA with a nucleotide sequence as shown in SEQ ID NO.3 and a short DEVD peptide with an amino acid sequence as shown in SEQ ID NO.
4. The inner wall of the channel of the θ-type nanotube is subjected to amylation treatment, and the cytochrome c aptamer and / or caspase recognition peptide are immobilized on the inner wall of the channel of the θ-type nanotube through amidation reaction.
3. The sensor according to claim 2, characterized in that, The amination treatment was performed using 3-aminopropyltriethoxysilane.
4. A method for manufacturing a sensor as described in any one of claims 1-3, characterized in that, Including the following steps: One end of a θ-type capillary with dual channels is drawn to form a θ-type nanotube with a θ-type nanopore at the tip; The dual channels of the θ-type nanotube were specifically functionalized, with one channel immobilizing the cytochrome c aptamer and the other channel immobilizing the caspase recognition peptide, to obtain the sensor.
5. The method for preparing the sensor according to claim 4, characterized in that, The step of drawing one end of the θ-type capillary with dual channels is performed using a needle drawing device, and the drawing parameters include: Line 1: Heat=700-900, Fil=2-4, Vel=20-40, Del=120-190, Pull=40-60; Line 2:Heat=700-900, Fil=2-4, Vel=20-40, Del=130-150, Pull=140-160.
6. The use of a sensor as described in any one of claims 1-3 in detecting cytochrome c and cysteine in a single cell.
7. The application according to claim 6, characterized in that, The detection of cytochrome c and caspase in single cells is used for one or more of the following purposes: real-time dynamic monitoring of single-cell apoptosis, study of apoptosis heterogeneity in different cell lines, and evaluation of drug action mechanisms.
8. A method for detecting cytochrome c and caspase in a single cell, characterized in that, Including the following steps: The tip of the sensor as described in any one of claims 1-3 is inserted into a single cell to extract cytoplasmic contents through electroosmosis. After removing the sensor, the IV curve is recorded, and the concentrations of cytochrome c and caspase are quantified by the changes in the IV curve.
9. The detection method according to claim 8, characterized in that, The step of extracting cytoplasmic contents by electroosmosis includes applying a voltage of -2.0V to -0.5V for 0.5-2 minutes. The step of recording the IV curve after removing the sensor involves a scanning range of -1.0V to +1.0V and a scanning rate of 40-60mV / s for the IV curve.
10. A method for regenerating a sensor after detection as described in any one of claims 1-3, characterized in that, Including the following steps: Aptamer was backfilled into the channels containing fixed cytochrome c aptamers and then heat-treated. DEVD was backfilled into the channel immobilized with the caspase recognition peptide and then subjected to sonication.
Citation Information
Patent Citations
Preparation method of cylindrical magnetic bio-MOF modified electrode and application of cylindrical magnetic bio-MOF modified electrode in Caspase-3 detection
CN119000835A
Fluorescence detection microneedle for cytochrome c in biological membrane as well as preparation method and application of fluorescence detection microneedle
CN119178756A