A gene editing tool for eliminating bifidobacterium resistance plasmids and its application method
By designing a gene editing plasmid containing two sgRNAs in bacteria and using sgRNA2 to induce elimination plasmids, the problem of low plasmid elimination efficiency in the prior art is solved, and a fast and efficient gene editing process is achieved.
Patent Information
- Application Number
- CN202211013044.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-23
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-08-23
AI Technical Summary
The prior art plasmid elimination efficiency and time-consuming and laborious during the removal of bacterial gene editing process, requiring repeated passages and monoclonal verification to increase the risk of genomic mutations.
Gene editing plasmids containing two sgRNAs were designed, sgRNA1 was used to edit the gene of interest, and sgRNA2 was used to induce the expression of resistance genes in the targeted plasmid, eliminating the plasmid through lactose induction, and reducing homologous recombination.
A method of rapid elimination of plasmids has been implemented, shortening the gene editing cycle, reducing the risk of genomic mutations, and simplifying the operation process.
Smart Images

Figure CN116004689B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene editing technology, and in particular to a gene editing tool for eliminating bifidobacterium resistance plasmids and an application method thereof. Background Art
[0002] Gene editing methods can effectively genetically modify and transform genomes and have been widely applied in basic and applied research across a wide range of species. Through gene editing, a large number of strains meeting diverse needs have been successfully constructed. Classic bacterial genome editing methods rely on homologous recombination using phage recombinases. However, this method requires two recombination cycles, resulting in low recombination efficiency and the introduction of selection markers. When editing multiple genes, this approach is often limited by a shortage of selection markers. After gene editing, selection markers must be removed. Although various removal methods exist, achieving 100% removal efficiency is difficult, necessitating isolation and verification of single clones during repeated passages. This makes existing methods time-consuming and labor-intensive. While gene editing methods, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), transposon mutagenesis, RNA interference (RNAi), and antisense RNA, have also been developed, they still suffer from the drawbacks of being time-consuming and labor-intensive. In recent years, the CRISPR-Cas9 system, which leverages bacteria's native immune system, has gained widespread application, promoting the advancement of bacterial genome genetic modification and expression regulation. Cas nuclease proteins with efficient cleavage activity can cause double-strand breaks in the genome. Only cells with homologous templates and successful recombination can survive and successfully edit. However, when targeting different target genes, different guide RNAs (sgRNAs) need to be introduced. Therefore, after completing the previous round of gene editing, the old sgRNA expression plasmid needs to be removed and a new sgRNA expression plasmid needs to be introduced.
[0003] Plasmid removal through physical or chemical methods suffers from low efficiency and inconsistent results, and the toxicity of chemical reagents can cause unpredictable mutations in the genome. While currently widely used, plasmid elimination through repeated passage in antibiotic-free culture medium is time-consuming and cannot guarantee 100% efficiency. Finally, single clones must be isolated, purified, and individually verified. Therefore, molecular biological methods offer greater advantages in plasmid elimination.
[0004] In summary, existing technical solutions all require the steps of removing the screening marker or eliminating the plasmid. Since the elimination efficiency cannot be guaranteed to be 100%, additional single clone picking and verification steps are required. This process is time-consuming and labor-intensive, and repeated cultivation will also increase the risk of spontaneous genome mutations. Summary of the Invention
[0005] The purpose of the present invention is to overcome the defects of the above-mentioned prior art and provide a gene editing tool and its application method for eliminating Bifidobacterium resistance plasmids. Based on the CRISPR-Cas9 system, a gene editing plasmid (pLJ series) containing two guide RNAs (guide RNA, gRNA, also known as small guide RNAsmall guide RNA, sgRNA, this patent is unified as guide RNA, sgRNA) is designed. In addition to expressing sgRNA1 for gene editing, this series of plasmids also induces the expression of sgRNA2 targeting the resistance gene in the plasmid, thereby having the characteristic of eliminating the plasmid.
[0006] The purpose of the present invention can be achieved by the following technical solutions:
[0007] The present invention provides a gene editing tool for eliminating bifidobacterium resistance plasmids, wherein the gene editing tool is a gene editing plasmid containing two sgRNAs, wherein each plasmid includes sgRNA1 and sgRNA2.
[0008] The promoter of the sgRNA1 is a synthetic strong promoter P23, the nucleotide sequence of which is shown in SEQ ID NO.1, and is used to edit the target gene;
[0009] The promoter of the sgRNA2 is PlacZ, and the nucleotide sequence is shown in SEQ ID NO. 2, which is used to induce the expression of the resistance gene in the targeting plasmid and eliminate the plasmid.
[0010] During the gene editing process, gene knockout is achieved by editing the target gene with sgRNA1. After editing is completed, an inducer (such as lactose) is added to initiate the expression of sgRNA2 targeting the resistance gene in the plasmid, thereby eliminating the gene editing plasmid.
[0011] In one embodiment of the present invention, the sgRNA2 fragment and the sgRNA1 fragment are separated by target gene homologous fragments in the plasmid, and the purpose of separation is to reduce homologous recombination.
[0012] The present invention also provides a method for preparing the gene editing tool for eliminating Bifidobacterium resistance plasmids, comprising the following steps:
[0013] S1. Amplify the promoter PlacZ fragment of sgRNA2: Using Bifidobacterium as a template, DNA polymerase amplifies the promoter PlacZ fragment of sgRNA2; using pLJ2 as a template, amplify sgRNA2;
[0014] S2. Construction of the sgRNA2 expression cassette-specific fragment: Using the PCR product PlacZ fragment and sgRNA2 in equal molar ratios as templates, amplify the sgRNA2 expression cassette-specific fragment by overlapping PCR;
[0015] S3. Obtain linearized vector: Use pLJ2 as template and digest it with restriction endonuclease XhoⅠ at 37℃ to obtain the purified product as linearized vector;
[0016] S4. Plasmid construction: Use a seamless cloning kit to splice the amplified sgRNA2 expression cassette-specific fragment with the linearized vector, and transform it into the competent Escherichia coli Top10 by the heat shock method. Use ampicillin and corresponding primers to perform colony PCR to screen positive transformants to obtain a gene-editing plasmid containing two sgRNAs, which is a gene-editing tool for eliminating Bifidobacterium resistance plasmids.
[0017] In one embodiment of the present invention, in step S1, when DNA polymerase amplifies the promoter PlacZ fragment of sgRNA2 using Bifidobacterium as a template, the upstream primer is 5'-TATGCAAAACTACAGGCCGTCTCCTTTGCCTCC-3', and the downstream primer is 5'-AATCCACGGCGGTCCTCGAGGCGGCCGCATAACTTCACTAGTATAGCGTGCGG-3'.
[0018] In one embodiment of the present invention, in step S1, when sgRNA2 is amplified using pLJ2 as a template, the upstream primer is 5'-CGTCAGACATGGGCACTAGTCTCGAGAAAAAAAGCACCGACTCGGTGC-3', and the downstream primer is 5'-GGCAAAGGAGACGGCCTGTAGTTTTGCATAATTTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'.
[0019] In one embodiment of the present invention, in step S2, the PCR product PlacZ fragment and sgRNA2 in equal molar ratios are used as templates, and when overlapping PCR amplification is performed, the upstream primer is 5'-CGTCAGACATGGGCACTAGTCTCGAGAAAAAAAGCACCGACTCGGTGC-3', and the downstream primer is 5'-AATCCACGGCGGTCCTCGAGGCGGCCGCATAACTTCACTAGTATAGCGTGCGGG-3'.
[0020] In one embodiment of the present invention, the sgRNA2 expression cassette specific fragment in step S2 is regulated by the endogenous inducible promoter PlacZ of Bifidobacterium.
[0021] In one embodiment of the present invention, in step S3, the original pLJ2 vector is pAM1, which is formed into a new plasmid named pLJ2 by adding the Cas9 expression cassette, the sgRNA expression cassette and the target gene homology arms.
[0022] In one embodiment of the present invention, the gene editing plasmid containing two sgRNAs in step S4 carries an erythromycin resistance gene expression module and an sgRNA2 expression cassette for plasmid elimination, wherein the erythromycin resistance gene coding region sequence is TAAATTATGCAAAACTACAG.
[0023] In one embodiment of the present invention, in step S4, when the amplified sgRNA2 expression cassette-specific fragment is spliced together with the linearized vector using a seamless cloning kit, the corresponding primers are the upstream primer 5'-CCACGATCGTGTTCACCAGC-3' and the downstream primer 5'-GACGCATGAGAGAGGAGAAGAGGAA-3'; in step S4, the ampicillin concentration is 100 mg / L.
[0024] In addition, the present invention also provides an application method of a gene editing tool for removing bifidobacterium resistance plasmids, comprising the following steps:
[0025] Step A: Purify the gene-editing plasmid containing two sgRNAs and then electroporate into Bifidobacterium. The electroporate-transformed Bifidobacterium is incubated in a recovery medium and then plated on an erythromycin-resistant plate for screening of recombinants.
[0026] Step B, plasmid induction elimination: select a single colony of Bifidobacterium grown on an erythromycin-resistant plate, transfer it twice, add 1% lactose to induce it, and spread the bacterial solution on a non-resistant BS plate and a BS plate containing erythromycin respectively;
[0027] Step C, screening of strains without plasmids: colonies that can grow on plates without antibiotics but not on plates with antibiotics are selected as the target strains after plasmid elimination.
[0028] In one embodiment of the present invention, the electroporation conditions in step A are 2.5 kV, 0.2 cm.
[0029] In one embodiment of the present invention, the static incubation time in step A is 4 hours.
[0030] In one embodiment of the present invention, the specific operation of transferring twice in step B is to inoculate the picked single colony into BS liquid medium under anaerobic conditions at 37°C overnight, transfer the turbid bacterial solution to fresh BS liquid medium, and culture until OD 600 is 0.3.
[0031] In one embodiment of the present invention, the lactose induction time in step B is 3 hours.
[0032] In one embodiment of the present invention, the BS plate culture condition in step B is anaerobic culture at 37° C. for 48 hours.
[0033] Compared with the prior art, the present invention realizes a method for quickly eliminating the plasmid after gene editing of Bifidobacterium. It does not need to construct other plasmids on the basis of the gene editing plasmid. Instead, an additional sgRNA expression cassette is added to the original plasmid. After each round of gene editing, the plasmid of the previous round of gene editing can be eliminated. The gene-edited positive clones picked have also eliminated the sgRNA expression plasmid of the previous round. The present invention reduces the number of cultures required for each round of gene editing to two. Compared with the existing gene editing technology (at least four cultures per round of gene editing), the editing cycle is shortened and the speed of multiple rounds of gene editing is accelerated (e.g., Figure 1 while reducing the likelihood of spontaneous genome mutations. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 This is a flow chart for constructing the pLJ series plasmids of the present invention;
[0035] Figure 2 Construct validation maps for plasmids;
[0036] Figure 3 Result diagram for optimization of induction conditions;
[0037] Figure 4 The figure shows the growth of the strain on the resistance plate before and after plasmid elimination;
[0038] In the figure, Amp: ampicillin, Em: erythromycin, Up: upstream homology arm of target gene, Down: downstream homology arm of target gene, sgRNA2: guide RNA for eliminating plasmid, sgRNA1: guide RNA for editing target gene. DETAILED DESCRIPTION
[0039] Unless otherwise defined, the technical terms used in the following examples have the same meanings as commonly understood by those skilled in the art to which this invention belongs. The experimental reagents used in the following examples, unless otherwise specified, are conventional biochemical reagents; the experimental methods described, unless otherwise specified, are conventional methods.
[0040] In the present invention, Escherichia coli Top10 is a strain preserved in this laboratory; Bifidobacterium AR668 is a strain isolated from infant feces in this laboratory.
[0041] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0042] Example 1
[0043] The present embodiment provides a gene editing tool for removing bifidobacterium resistance plasmids, and the gene editing tool is a gene editing plasmid (pLJ series) containing two sgRNAs, wherein each plasmid includes sgRNA1 and sgRNA2, and the promoter of the sgRNA1 is an artificially synthesized strong promoter P23, and the nucleotide sequence is shown in SEQ ID NO.1, for editing the target gene; the promoter of the sgRNA2 is PlacZ, and the nucleotide sequence is shown in SEQ ID NO.2, for inducing expression of resistance genes in the targeting plasmid and eliminating the plasmid. The sgRNA2 fragment and the sgRNA1 fragment are separated by target gene homologous fragments in the plasmid. The purpose of separation is to reduce homologous recombination.
[0044] Among them, SEQ ID NO.1:
[0045] AACATCATTGTCATTCATATTTTTCATTATATTTGGCCTCCCTTTTTAATTTAATTCTAAGACTATTTTATCAAAATTTTCTCTTTTTGTCATCAGTCTTAGGTCTGATTTTTTATTTCTATTATTTACTGACCGAACGCTTATTCCTTTTTAGGAACAAGGGTTGTCAGGGCTTTTCG;
[0046] SEQ ID NO.2:
[0047] GCCGTCTCCTTTGCCTCCACCGCTGTTATGAGAACATGGTATGGGGAGCACGGTATTTCCGCGGGTTACGCCCATGTGCAGATTATCTACCCCCGCACGCTATACTAGTGAAGTTAT.
[0048] During the gene editing process, gene knockout is achieved by editing the target gene with sgRNA1. After editing is completed, an inducer (such as lactose) is added to initiate the expression of sgRNA2 targeting the resistance gene in the plasmid, thereby eliminating the gene editing plasmid.
[0049] This embodiment also provides a method for preparing the gene editing tool for removing the bifidobacterium resistance plasmid, comprising the following steps:
[0050] S1. Amplify the promoter PlacZ fragment of sgRNA2: Using Bifidobacterium AR668 as a template, DNA polymerase amplifies the promoter PlacZ fragment of sgRNA2; using pLJ2 as a template, amplify sgRNA2;
[0051] S2. Construction of the sgRNA2 expression cassette-specific fragment: Using the PCR product PlacZ fragment and sgRNA2 in equal molar ratios as templates, amplify the sgRNA2 expression cassette-specific fragment by overlapping PCR;
[0052] S3. Obtaining the linearized vector: Using the pLJ2 plasmid as a template, the purified product after single digestion with restriction endonuclease XhoⅠ at 37°C is the linearized vector;
[0053] S4. Plasmid construction: Use a seamless cloning kit to splice the amplified sgRNA2 expression cassette-specific fragment with the linearized vector, and transform it into the competent Escherichia coli Top10 by the heat shock method. Use ampicillin and corresponding primers to perform colony PCR to screen positive transformants to obtain a gene-editing plasmid containing two sgRNAs, which is a gene-editing tool for eliminating Bifidobacterium resistance plasmids.
[0054] In step S1, when the promoter PlacZ fragment of sgRNA2 is amplified by DNA polymerase using Bifidobacterium as a template, the upstream primer (primer 1, the sequence is shown in SEQ ID NO. 3) is 5'-TATGCAAAACTACAGGCCGTCTCCTTTGCCTCC-3', and the downstream primer (primer 2, the sequence is shown in SEQ ID NO. 4) is 5'-AATCCACGGCGGTCCTCGAGGCGGCCGCATAACTTCACTAGTATAGCGTGCGG-3'.
[0055] In step S1, when sgRNA2 was amplified using pLJ2 as a template, the upstream primer (primer 3, the sequence of which is shown in SEQ ID NO. 5) was 5'-CGTCAGACATGGGCACTAGTCTCGAGAAAAAAAGCACCGACTCGGTGC-3', and the downstream primer (primer 4, the sequence of which is shown in SEQ ID NO. 6) was 5'-GGCAAAGGAGACGGCCTGTAGTTTTGCATAATTTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'.
[0056] In step S2, the PCR product PlacZ fragment and sgRNA2 in equal molar ratios were used as templates for overlapping PCR amplification. The upstream primer (primer 5, sequence shown in SEQ ID NO. 7) was 5'-CGTCAGACATGGGCACTAGTCTCGAGAAAAAAAGCACC GACTCGGTGC-3', and the downstream primer (primer 6, sequence shown in SEQ ID NO. 8) was 5'-AATCCACGGCGGTCCTCGAGGCGGCCGCATAACTTCACTAGTATAGCGTGCGGG-3'.
[0057] The sgRNA2 expression cassette specific fragment in step S2 is regulated by the endogenous inducible promoter PlacZ of Bifidobacterium.
[0058] In step S3, the original pLJ2 vector is pAM1, which is composed of a new plasmid named pLJ2 after adding the Cas9 expression cassette, sgRNA expression cassette, and target gene homology arms.
[0059] The gene editing plasmid containing two sgRNAs in step S4 carries the erythromycin resistance gene expression module and the sgRNA2 expression cassette for plasmid elimination, wherein the erythromycin resistance gene coding region sequence is TAAATTATGCAAAACTACAG.
[0060] In step S4, when the amplified sgRNA2 expression cassette-specific fragment and the linearized vector are spliced together using a seamless cloning kit, the corresponding primers are the upstream primer (primer 7, the sequence is shown in SEQ ID NO. 9) 5'-CCACGATCGTGTTCACCAGC-3', and the downstream primer (primer 8, the sequence is shown in SEQ ID NO. 10) 5'-GACGCATGAGAGAGGAGAAGAGGAA-3'; in step S4, the ampicillin concentration is 100 mg / L.
[0061] This embodiment also provides a method for using a gene editing tool to eliminate Bifidobacterium resistance plasmids, comprising the following steps:
[0062] (1) Transformation of Bifidobacterium: The plasmid was purified from the E. coli transformant and then electroporated into Bifidobacterium at 2.5 kV and 0.2 cm. The electroporated Bifidobacterium was incubated in a recovery medium for 4 hours and then plated on an erythromycin-resistant plate for screening of recombinants.
[0063] (2) Plasmid induction elimination: Select a single colony of Bifidobacterium growing on an erythromycin-resistant plate, inoculate it into BS liquid medium and culture it overnight under anaerobic conditions at 37°C. Transfer the bacterial liquid to fresh BS liquid medium and culture it until OD600 The concentration of the culture medium was 0.3, 1% lactose was added for induction for 3 h, the bacterial suspension was spread on BS plates without resistance and BS plates containing erythromycin resistance, and cultured anaerobically at 37°C for 48 h;
[0064] (3) Screening of strains without plasmids: Select the colonies that can grow on plates without resistance but not on plates with resistance. These are the target strains after plasmid elimination.
[0065] Example 2
[0066] like Figure 1 As shown, this example constructs a gene editing tool pLJ11 plasmid, which displays a pMB1-specific fragment and an ampicillin resistance gene Amp, a Bifidobacterium replication protein rep, a Cas9 expression cassette, an sgRNA1 expression cassette targeting gene 0348, a target gene homology arm, and an sgRNA2 inducible expression cassette targeting a plasmid resistance gene.
[0067] The pLJ11 plasmid was prepared as follows: After digesting the pLJ2 vector with Xho I, the PlacZ promoter was amplified by PCR. Overlapping PCR with the amplified sgRNA2 fragment yielded the sgRNA2 expression cassette. The vector and fragment were then ligated using a seamless cloning kit. The recombinant product was heat-shock transformed into competent Escherichia coli Top10 cells. Positive transformants were screened on ampicillin-resistant plates, verified by PCR, and sequenced to obtain the plasmid pLJ11.
[0068] Figure 2 This is a PCR verification image of the plasmid construction. The colony PCR verification result showed a band close to 1500 bp, indicating that the plasmid was successfully constructed.
[0069] Figure 3 This is the result diagram of induction condition optimization; the optimal induction condition is to culture the bacterial solution to OD 600 The induction effect is optimal when the induction temperature is 0.3 and 1% lactose is added for 3 hours.
[0070] Figure 4 This is a diagram showing the growth of the strain on the resistance plate before and after plasmid elimination; after lactose induction was added under optimal conditions, Cas9 cut the plasmid under the guidance of the sgRNA targeting the resistance gene to complete the plasmid elimination.
[0071] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.
Claims
1. A gene editing tool for removing bifidobacterium resistance plasmids, characterized in that The gene editing tool is a gene editing plasmid containing two sgRNAs, sgRNA1 and sgRNA2. The promoter of the sgRNA1 is a synthetic strong promoter P23, the nucleotide sequence of which is shown in SEQ ID NO.1, and is used to edit the target gene; The promoter of the sgRNA2 is PlacZ, and the nucleotide sequence of PlacZ is shown in SEQ ID NO. 2, which is used to induce the expression of sgRNA2 targeting the resistance gene in the plasmid and eliminate the plasmid.
2. A gene editing tool for eliminating Bifidobacterium resistance plasmids according to claim 1, characterized in that The sgRNA2 fragment and the sgRNA1 fragment are separated by target gene homologous fragments in the plasmid.
3. A method for preparing a gene editing tool for eliminating bifidobacterium resistance plasmids according to any one of claims 1-2, characterized in that: The following steps are included: S1. Amplify the promoter PlacZ fragment of sgRNA2: Using Bifidobacterium as a template, DNA polymerase amplifies the promoter PlacZ fragment of sgRNA2; using pLJ2 as a template, amplify sgRNA2; S2. Construction of sgRNA2 expression cassette-specific fragment: Using the PCR product PlacZ fragment and sgRNA2 in equal molar ratios as templates, the sgRNA2 expression cassette-specific fragment was obtained by overlapping PCR amplification; S3. Obtain linearized vector: Use pLJ2 as template and digest with restriction endonuclease Xho Ⅰ at 37°C to obtain the purified product; S4. Plasmid construction: Use a seamless cloning kit to splice the amplified sgRNA2 expression cassette-specific fragment into the linearized vector. Heat-shock transform the fragment into E. coli Top10 competent cells. Use ampicillin and corresponding primers to perform colony PCR to screen positive transformants. This yields a gene-editing plasmid containing two sgRNAs, a gene-editing tool for eliminating Bifidobacterium resistance plasmids. In steps S1 and S3, the original vector of pLJ2 is pAM1, which is composed of a new plasmid named pLJ2 after adding the Cas9 expression cassette, sgRNA expression cassette, and target gene homology arms.
4. The method for preparing a gene editing tool for eliminating bifidobacterium resistance plasmids according to claim 3, characterized in that: In step S1, when the promoter PlacZ fragment of sgRNA2 is amplified by DNA polymerase using Bifidobacterium as a template, the upstream primer is 5'-TATGCAAAACTACAGGCCGTCTCCTTTGCCTCC-3', and the downstream primer is 5'-AATCCACGGCGGTCCTCGAGGCGGCCGCATAACTTCACTAGTATAGCGTGCGG-3'; In step S1, when sgRNA2 was amplified using pLJ2 as a template, the upstream primer was 5′-CGTCAGACATGGGCACTAGTCTCGAGAAAAAAAGCACCGACTCGGTGC-3′, and the downstream primer was 5′-GGCAAAGGAGACGGCCTGTAGTTTTGCATAATTTAGTTTTAG AGCTAGAAATAGCAAGTTAAAATAAGG-3′; In step S2, the PCR product PlacZ fragment and sgRNA2 in equal molar ratios were used as templates for overlap PCR amplification. The upstream primer was 5′-CGTCAGACATGGGCACTAGTCTCGAGAAAAAAAGCACCGACTCGGTGC-3′, and the downstream primer was 5′-AATCCACGGCGGTCCTCGAGGCGGCCGCATAACTTCACTAGTATAGCGTGCGGG-3′.
5. The method for preparing a gene editing tool for eliminating bifidobacterium resistance plasmids according to claim 3, characterized in that: In step S4, when the amplified sgRNA2 expression cassette-specific fragment is spliced together with the linearized vector using a seamless cloning kit, the corresponding primers are the upstream primer 5'-CCACGATCGTGTTCACCAGC-3' and the downstream primer 5'-GACGCATGAGAGAGGAGAAGAGGAA-3'; in step S4, the ampicillin concentration is 100 mg / L.
6. A method for using the gene editing tool for removing bifidobacterium resistance plasmids as claimed in any one of claims 1 to 2, characterized in that: The following steps are included: Step A: Purify the gene-editing plasmid containing two sgRNAs and then electroporate into Bifidobacterium. The electroporate-transformed Bifidobacterium is incubated in a recovery medium and then plated on an erythromycin-resistant plate for screening of recombinants. Step B, plasmid induction elimination: select a single colony of Bifidobacterium grown on an erythromycin-resistant plate, transfer it twice, add 1% lactose to induce it, and spread the bacterial solution on a non-resistant BS plate and a BS plate containing erythromycin respectively; Step C, screening of strains without plasmids: colonies that can grow on plates without antibiotics but not on plates with antibiotics are selected as the target strains after plasmid elimination.
7. The method for using a gene editing tool for removing bifidobacterium resistance plasmids according to claim 6, characterized in that: The electroporation conditions in step A are 2.5 kV, 0.2 cm, and / or, The static incubation time in step A is 4 h, and / or, The specific operation of the two transfers in step B is to inoculate the picked single colony into BS liquid medium under anaerobic conditions at 37°C overnight, transfer the turbid bacterial solution to fresh BS liquid medium, and culture until OD 600 is 0.3, and / or, The lactose induction time in step B is 3 h, and / or, The BS plate culture conditions described in step B are anaerobic culture at 37°C for 48 hours.
Citation Information
Patent Citations
CRISPR-Cas9 plasmid as well as construction method and application thereof
CN116064632A