A SNP mutation site of PRLR gene and its application

Abstract

The present invention relates to the field of genetic engineering technology, and in particular to a SNP mutation site of a PRLR gene and its application. The present invention provides a SNP mutation site of a PRLR gene, and the mutation site includes: site 1 to site 7. The present invention takes border chickens as the research object, uses time-of-flight mass spectrometry to detect the genetic diversity distribution of the PRLR gene in this variety, and conducts association analysis with the age at first laying, weight at first laying, egg weight at first laying and number of eggs at 300 days of age, to screen key sites that affect the egg-laying traits of border chickens, and provide a theoretical basis for carrying out marker-assisted selection, improving the egg-laying performance of border chickens and increasing economic benefits.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a SNP mutation site of a PRLR gene and an application thereof. Background Art

[0002] Bian chicken is the only excellent local poultry breed in Shanxi Province. It has the advantages of large eggs and high egg yolk ratio. However, local breeds generally have the problem of low egg production, which seriously restricts the large-scale production of Bian chicken. Egg production traits are one of the main economic traits of poultry. How to improve the egg production performance of Bian chicken is an important task in Bian chicken breeding. Studies have shown that brooding ability may be one of the important factors for the low egg production of local poultry. Brooding ability is regulated by the hypothalamic-pituitary-ovarian axis endocrine system and regulated by the expression of multiple genes. The PRLR gene is closely related to brooding ability and plays an important role in the growth, development and reproduction of poultry. Studies have found that the polymorphism of the PRLR gene is significantly correlated with the egg production traits of chickens. There are no reports on the correlation between the polymorphism of the PRLR gene and the egg production traits of Bian chickens. Summary of the Invention

[0003] The purpose of the present invention is to provide a SNP mutation site of the PRLR gene and its application. The present invention screened and obtained a total of 7 polymorphic sites of the PRLR gene. This study took border chickens as the research object, used time-of-flight mass spectrometry to detect the genetic diversity distribution of the PRLR gene in this variety, and performed association analysis with the age at first laying, weight at first laying, egg weight at first laying and number of eggs at 300 days of age, screened the key sites that affect the egg-laying traits of border chickens, and provided a theoretical basis for carrying out marker-assisted selection, improving the egg-laying performance of border chickens and increasing economic benefits.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides a SNP mutation site of the PRLR gene, characterized in that the mutation site includes:

[0006] Site 1: located at base 10641897, the type is T / A transversion; as shown in SEQ NO: 1;

[0007] Site 2: located at base 10632956, type is A / G transition; as shown in SEQ NO: 2;

[0008] Site 3: located at base 10618162, type is A / G transition; as shown in SEQ NO: 3;

[0009] Site 4: located at base 10611270, type is G / A transition;

[0010] Site 5: located at base 10611168, type A / C transversion;

[0011] Site 6: located at base 10611109, type is C / T transition;

[0012] Site 7: located at base 10610562, the type is G / A transition; the nucleotide sequence of sites 4 to 7 is shown in SEQ NO: 4;

[0013] 2. The SNP mutation site of the PRLR gene according to claim 1 is characterized in that the genotype corresponding to site 1 is TT or TA; the genotype corresponding to site 2 is GA or AA; the genotype corresponding to site 3 is AG or GG; the genotype corresponding to site 4 is GG; the genotype corresponding to site 5 is AA; the genotype corresponding to site 6 is CC; and the genotype corresponding to site 7 is GG or AA.

[0014] Preferably, the primers for detecting the SNP mutation site are shown in SEQ NOs: 5 to 25.

[0015] The present invention also provides the application of the SNP mutation site of the PRLR gene in improving the egg-laying performance of chickens.

[0016] Preferably, the chicken is a side chicken.

[0017] Preferably, the egg production performance is the age at first laying, the first egg weight or the egg production.

[0018] 7. The use according to claim 6, characterized in that the sites 4, 5 and 6 are related to the age of first laying; and site 7 is related to the first egg weight and egg production.

[0019] The present invention further provides the use of the SNP mutation site of the PRLR gene in preparing a kit.

[0020] The present invention further provides the application of the SNP mutation site of the PRLR gene in chicken breeding.

[0021] The present invention further provides the application of the SNP mutation site of the PRLR gene in the genetic marker for marker-assisted selection of egg production in border chickens.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention aims to investigate the correlation between single nucleotide polymorphisms (SNPs) in the prolactin receptor (PRLR) gene of Bian chicken and egg production traits, thereby providing new molecular markers for the breeding of high-yield Bian chickens. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) was used to genotype seven SNPs in 158 Bian chickens. Hardy-Weinberg population genetic equilibrium tests were performed using Excel, and association analysis was performed using SPSS 26.0. The results showed that all seven SNPs in the Bian chicken PRLR gene were moderately polymorphic (0.25 < PIC < 0.50), with S1, S2, and S3 being in Hardy-Weinberg equilibrium (P > 0.05).

[0024] The results of correlation analysis showed that the age at first laying of individuals with heterozygous genotype at S4~S6 loci of PRLR gene was significantly or extremely significantly higher than that of individuals with homozygous genotype; the weight of first egg laid of individuals with GA genotype at S7 locus was significantly higher than that of individuals with GG and AA genotype (P<0.05), and the number of eggs at 300 days of age of individuals with GG and AA genotype was extremely significantly higher than that of individuals with GA genotype (P<0.01); thus, it can be seen that the S4~S7 loci of PRLR gene can be used as genetic markers for marker-assisted selection of age at first laying and egg number of border chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0026] Figure 1 A represents the typing results of the S1SNPs sites of the PRLR gene;

[0027] Figure 2 B represents the typing results of S2SNPs sites of PRLR gene;

[0028] Figure 3 C represents the typing results of S3SNPs sites of PRLR gene;

[0029] Figure 4 D represents the typing results of S6SNPs sites of PRLR gene. DETAILED DESCRIPTION

[0030] The SNP site sequence involved in the present invention is as follows:

[0031] PRLR(ensgalg00000003446): Transcript ID: ensgalt00000097029.1

[0032] Chromosome: z

[0033] Sequenced transcript sequence:

[0034] acctaatattctctgctaatccatgcttgtgaagccatgtgctcgcctttgctgcacaatgagcatctctgtctttgcaaaatggatttcttcaattccttccctgacacatttcgtttgcccctgagggatgcacgtattacctgttagaagtacattcatcagtaagtgacacgatactgtcctcgcagtctgtaaggagaacaagtgagttaatgaatgaatgggttaatgaatgaatacattaataaatgtacctttaacctctggagattacagtgtaagttttaattcagtaaacaagtgcataaaagcctcacagtctacaacctcagggtcacttccttatacttacaaaacaaaagaaaaatccaaaacacagttcaccatgactgagaatctgctaggagttac(t / a)gcctgggatgaagatagggggtagatcaggtcagtgctatacttcgctcagtttatacattcattgcggagaaattagaaaataagagaaattcatgctgctaattaaagagggaatgcagttccttcagaaatgtgttttgaagctgttatgagattagtctgttttcctcatgaagctgtaattaaagatatttttgctacaagatgtggcattctgaagggctgtgatacagcagcgttaat (Exon 1)

[0035] After mutation: 10,641,976 - 10,641,868

[0036] ggtcacttccttatacttacaaaacaaaagaaaaatccaaaacacagttcaccatgactgagaatctgctaggagttactgcctgggatgaagatagggggtagatcag

[0037] SNP1 (bold part)

[0038] tatttaagagactgatttctcaggtaaattaagctaatgcactggaagcctaatcccagcactgctatctgctcaaaggcttgcagaaagatctgtttactactctccaactcaagttttcttcctctgaagtgaaaacacgccacacctgtttgagtaataacaagaatcaatgagctgcaattcaaaggggactttgatcaaaatggatatatattacatgttaacacttttatttactttcacattatcgcatgtttttcagtgagcccttgatgtgatacttctttccaag(a / g)ggaagtggaaatcatgaaacaggatttgatatcgtctgttcaaatcatattgttccttcctctgaccacagtgggtctggcaggtaagtacagtatttcccagaacacttgttttccttgaaacacttctttcagaaaagtctgaggctttacttgatctatcctgaccatcactggaacctgcgcatatttgatctgctttctttcaaagttttgtatggaggtcttgaaagtggcttgagtccccttttctctaatgtagtatgaatttaatgataatgcggtggtgataatgaaaggtattcagtctctcaccacgcttactccatccttgtcacctttttgggaatcagcatcgtatggg (Exon 3)

[0039] After mutation 10,632,986 - 10,632,873

[0040] tgagcccttgatgtgatacttctttccaagaggaagtggaaatcatgaaacaggatttgatatcgtctgttcaaatcatattgttccttcctctgaccacagtgggtctggcag

[0041] SNP2 (bold part)

[0042] tcagtgtcttgaaatttataaatccttgttttctttgtcaggaaattcttgctccctgtattctagcagttccaagttactagacacgatgaaggtggcaatttgccccaaatatcacttcaaattccaaaggtgcaaagaaaaatcattgatacttttactatcagttctcttattttaacagtacagccagatcctcctgtgaatgtaactctagaattaaaaaagccaataaatagaaaaccatatctggtattgacatggtctcc(a / g)cccccactggctgatgtcagatctggatggcttaccctcgagtatgaattgcgactgaagcctgaagaaggagaggaatgggaggtaaggatcttgcaattttttacctacagtttttcttgatcagttagagtttgttagttatgtcccatgcctgactataatgaagcaggaacatggaataattcgtcctttttcaaaagcagtgcttgtgtgttccacatgttcctattgagaagactagtatctcaaatgctactgtgtgatagcaggtgatgaggtacttatttttaattgtggccattatatattaatcacagtggcatggta (Exon 10)

[0043] After mutation 10,618,247 - 10,618,078

[0044] tacagccagatcctcctgtgaatgtaactctagaattaaaaaagccaataaatagaaaaccatatctggtattgacatggtctccacccccactggctgatgtcagatctggatggctttaccctcgagtatgaattgcgactgaagcctgaagaaggagaggaatgggga

[0045] SNP3 (the bold part is the mutation point)

[0046]

[0047] 10,612,371-10,610,212

[0048]

[0049] SNP4-7 (bold part)

[0050] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1

[0052] 1 Materials and Methods

[0053] 1.1 Experimental animals and sample collection

[0054] A total of 158 hens (from a national-level Bianji breeding farm) raised under identical feeding and management conditions were randomly selected. Age at first laying, egg weight at first laying, body weight at first laying, and egg production at 300 days of age were recorded. Blood was collected from the wing vein using 2 mL EDTA anticoagulant tubes and stored at -20°C until use.

[0055] 1.2 Main reagents and instruments

[0056] Blood genomic DNA extraction kit was purchased from TIANGEN, HotStarTaq DNA Polymerase was purchased from Qiagen, and Complete Gold Genotyping Reagent Set was purchased from SEQUENOM, and dNTP (10 mM) was purchased from Sangon Biotechnology; MALDI-TOF System mass spectrometer was purchased from SEQUENOM, PCR instrument was purchased from ABI, USA, and UV-visible spectrophotometer was purchased from Merinton.

[0057] 1.3 Genomic DNA extraction

[0058] Genomic DNA was extracted from chickens using a blood genomic DNA extraction kit. The specific extraction steps were described in the kit instructions. DNA concentration and purity were determined using a spectrophotometer and stored at -20°C.

[0059] 1.4 Genotyping

[0060] Based on the PRLR gene mutation site information and sequence obtained from transcriptome sequencing, the SNP loci (exons) were determined using Ensemble software for alignment analysis. Using chicken DNA as a template, PCR amplification primers and single-base extension primers were designed for the target loci using Sequenom's Genotyping Tools and Massarray Assay Design software. Genotyping data were obtained using time-of-flight mass spectrometry. Primer information is shown in Table 1.

[0061] Table 1 Primer information

[0062]

[0063]

[0064] The primer sequences are shown in SEQ NOs: 5 to 25.

[0065] 1.5 Data Statistical Analysis

[0066] Genotype frequencies, allele frequencies, P values, and chi-square fitness tests were calculated using Excel spreadsheets to analyze Hardy-Weinberg population genetic equilibrium. One-way ANOVA was performed using SPSS 26.0 software to analyze the associations of genotype with age at first laying, weight at first laying, egg weight at first laying, and egg number at 300 days of age. Results are presented as mean ± standard deviation.

[0067] 2. Results and Analysis

[0068] 2.1 Screening of SNP sites in the PRLR gene of Bian chicken

[0069] As shown in Table 2, seven SNPs were initially identified in the four exons of the Bian chicken PRLR gene. S1 and S2 are located in the 5'UTR, S3 is located in the translation sequence, and S4 to S7 are located in the 3'UTR. Five of the seven SNPs are transition-type, and two are transversion-type.

[0070] Table 2 Preliminary screening results of SNP sites in PRLR gene of Bian chicken

[0071]

[0072] 2.2 MALDI-TOF-MS test results

[0073] In order to verify the accuracy of the PRLR gene SNPs sites screened in the early stage, this experiment carried out SNP genotyping detection on 158 Bian chicken individuals for a total of 13 SNPs sites of two genes. Some genotyping detection maps are shown in Figure 1 .by Figure 1 For example, there were 40 TT individuals, 80 heterozygous TA individuals, and 38 AA individuals in the S1 locus of the PRLR gene, indicating that the MALDI-TOF-MS technology can accurately detect the three common genotypes with a high accuracy rate and can be used for subsequent analysis. Figures 1 to 4 : A to D represent the typing results of PRLR gene S1, S2, S3 and S64 SNPs sites respectively; Note: ① Orange represents homozygotes; green represents heterozygotes; blue represents homozygotes.

[0074] 2.3 Analysis of PRLR gene genetic diversity

[0075] The genotype frequency and allele frequency of the 7 SNPs loci of the PRLR gene of 158 Bian chickens were statistically analyzed, and the data were subjected to P value and chi-square test. The results are shown in Table 3. As shown in Table 3, the polymorphic information content of the PRLR gene in the Bian chicken population showed that all loci were moderately polymorphic (0.25<PIC<0.50), and the chi-square test was 0. 2 The test showed that S1, S2 and S3 were all in Hardy-Weinberg equilibrium (P>0.05).

[0076] Table 3 Genotypes, gene frequencies and genetic diversity of PRLR genes in Bian chicken

[0077]

[0078] 2.4 Effects of different PRLR gene genotypes on egg production traits

[0079] As shown in Table 4, the age at first laying of individuals with heterozygous genotypes at the S4, S5 and S6 loci of the PRLR gene was significantly or extremely significantly higher than that of individuals with homozygous genotypes; the weight of first egg laying of individuals with the GA genotype at the S7 locus was significantly higher than that of individuals with the GG and AA genotypes (P < 0.05), and the number of eggs at 300 days of age of individuals with the GG and AA genotypes was extremely significantly higher than that of individuals with the GA genotype (P < 0.01).

[0080] Table 4 Effects of PRLR genotype frequency on egg-laying traits in chickens

[0081]

[0082]

[0083] Note: Data in the same column with different capital letters in the shoulders indicate extremely significant differences (P<0.01), different lowercase letters in the shoulders indicate significant differences (P<0.05), and the same letters or no letters in the shoulders indicate no significant differences (P>0.05). The same below.

[0084] Egg-laying traits have low heritability and are controlled by micro-effect polygenes. Traditional breeding methods using phenotypic data have long data recording cycles and poor accuracy. MALDI-TOF-MS is currently the only technology that uses time-of-flight mass spectrometry to directly perform SNP genotyping. In livestock and poultry breeding, numerous reports have confirmed the feasibility of MALDI-TOF-MS technology for SNP genotyping. In this study, seven SNPs sites of the PRLR gene in border chickens were detected using MALDI-TOF-MS technology. The highest detection rate of the PRLR gene was 100%, the lowest detection rate was 99.37%, and the average detection rate was 99.69%.

[0085] Hardy-Weinberg equilibrium analysis of mutation sites revealed that SNP1, SNP2, and SNP3 in the PRLR gene are all in Hardy-Weinberg equilibrium, indicating that the border chicken population has adapted to the local living environment and that these loci have been subjected to long-term selection within the border chicken population, leading to stable genetic frequencies. SNP4 to SNP7 in the PRLR gene deviate from Hardy-Weinberg equilibrium, potentially influenced by factors such as selection, drift, and migration, and could serve as molecular markers in breeding. Population genetics results indicate that most SNPs in both genes are moderately polymorphic in the border chicken population, suggesting a high potential for artificial selection.

[0086] The present invention found that the two SNPs in exon 1 and exon 3 of the PRLR gene of border chickens were not significantly correlated with the age of first laying, weight of first laying, weight of first egg laying and number of eggs at 300 days of age, and had little effect on egg-laying traits. Both SNPs occurred in the 5'UTR of the exon and had no effect on the translation of mRNA, which may be the reason for the little effect on egg-laying traits. The SNP site in exon 10 of the PRLR gene is a synonymous mutation and has no significant correlation with egg-laying traits. There are 4 SNPs in exon 14 of the PRLR gene, namely S4 to S7, among which the S4 to S6 sites are significantly or extremely significantly correlated with the age of first laying of border chickens, and the S7 site is significantly or extremely significantly correlated with the weight of first egg laying and egg production of border chickens.

[0087] Egg production at 300 days of age is a key reproductive trait in laying hens and a crucial selection indicator for their breeding value. Due to its low heritability, marker-assisted selection (MAS) can be used to improve its genetic potential. The PRLR gene S7 locus may serve as a marker for marker-assisted selection of egg production in hens. Further validation will be conducted with a larger sample size.

[0088] This study found seven mutation sites in the PRLR gene of Bian chickens. The S4-S6 sites of the PRLR gene were significantly or extremely significantly associated with the age of first laying in Bian chickens, and the S7 site had a significant effect on the first egg weight and egg production in Bian chickens. The first egg weight of the GA genotype was significantly better than that of the GG and AA genotypes (P < 0.05), and the number of eggs produced at 300 days of age in the GG and AA genotypes was extremely significantly higher than that in the GA genotype (P < 0.01).

[0089] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Application of the SNP mutation site of the PRLR gene in improving the egg-laying performance of chickens, characterized in that: The SNP mutation sites include: Site 1: T / A transversion; located at the 80th base of the nucleotide sequence shown in SEQ NO: 1; Site 2: A / G transition; located at the 31st base of the nucleotide sequence shown in SEQ NO: 2; Site 3: A / G transition; located at the 86th base of the nucleotide sequence shown in SEQ NO: 3; Site 4: Type is G / A transition; located at base 1102 of the nucleotide sequence shown in SEQ NO: 4; Site 5: A / C transversion; located at base 1204 of the nucleotide sequence shown in SEQ NO: 4; Site 6: Type is C / T transition; located at the 1263rd base of the nucleotide sequence shown in SEQ NO: 4; Site 7: Type is G / A transition; located at the 1810th base of the nucleotide sequence shown in SEQ NO: 4; Sites 4, 5, and 6 are associated with the age at first egg laying; site 7 is associated with the first egg weight and the number of eggs produced at 300 days of age; The age at first laying of individuals with heterozygous genotypes at sites 4, 5 and 6 was significantly or extremely significantly higher than that of individuals with homozygous genotypes; the weight of first laying eggs of individuals with GA genotype at site 7 was significantly higher than that of individuals with GG and AA genotypes, and the number of eggs laid at 300 days of age of individuals with GG and AA genotypes was extremely significantly higher than that of individuals with GA genotype.

2. The use according to claim 1, characterized in that The primers for detecting the SNP mutation sites are shown in SEQ NOs: 5 to 25.

3. Application of the SNP mutation site of the PRLR gene according to claim 1 in the breeding of border chickens; Sites 4, 5, and 6 are associated with the age at first egg laying; site 7 is associated with the first egg weight and the number of eggs produced at 300 days of age; The age at first laying of individuals with heterozygous genotypes at sites 4, 5 and 6 was significantly or extremely significantly higher than that of individuals with homozygous genotypes; the weight of first laying eggs of individuals with GA genotype at site 7 was significantly higher than that of individuals with GG and AA genotypes, and the number of eggs laid at 300 days of age of individuals with GG and AA genotypes was extremely significantly higher than that of individuals with GA genotype.

4. The use of the SNP mutation site of the PRLR gene described in claim 1 in a genetic marker for assisting selection of egg production in 300-day-old chickens, characterized in that: The site 7 is associated with the number of eggs produced at 300 days of age; the number of eggs produced at 300 days of age by individuals with the GG and AA genotypes at the site 7 is significantly higher than that by individuals with the GA genotype.

Images