Molecular markers tightly linked to maize ear height and their application

Abstract

The present invention discloses a molecular marker tightly linked to corn ear height and its application. The molecular marker tightly linked to corn ear height disclosed in the present invention is a DNA fragment shown in SEQ ID No.3 or a DNA fragment shown in SEQ ID No.4, and can be detected using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No.1 and SEQ ID No.2 in the sequence table. Experiments have shown that the molecular marker tightly linked to corn ear height of the present invention is correlated with corn ear height. The molecular marker can be used to successfully identify the ear height of corn, and has the advantages of being simple, rapid, efficient, and accurate, and has good repeatability and high specificity. It can be used in corn molecular marker-assisted breeding to select new corn varieties with excellent comprehensive traits, greatly saving breeding costs and improving breeding efficiency.

Description

Technical Field

[0001] The present invention relates to a molecular marker tightly linked to corn ear height and an application thereof in the field of biotechnology. Background Art

[0002] Corn (Zea mays L.) is a food, feed and economic crop.

[0003] Ear height is one of the key agronomic traits that contributes to an ideal maize plant architecture. Studies have shown that excessive ear height significantly reduces planting density, lodging resistance, and harvest index. Excessively low ear height impedes field ventilation, increasing plant disease and insect pest infestation and reducing biomass yield. Therefore, further elucidating the genetic basis of ear height and developing molecular markers closely linked to the quantitative trait loci (QTL) for ear height are crucial for breeding new maize varieties with ideal plant architecture and high yields.

[0004] Molecular markers have the advantages of being large in number, unaffected by environmental conditions, developmental stages, and expression regulation, and providing comprehensive and rich genetic information. They have been widely used in germplasm identification, QTL mapping, and marker-assisted selection. Insertion-deletion (InDel) markers are a commonly used type of molecular marker based on DNA-level differences. Specifically, they refer to differences between two accessions, where one accession has a certain number of nucleotide insertions or deletions at certain sites in the genome of the other. PCR primers are designed to amplify these InDel sites based on the InDel sites. Using InDel markers tightly linked to the target gene can be used to assist backcross selection, pedigree selection, and even whole-genome selection, thereby reducing linkage drag, aggregating beneficial genes, and accelerating the breeding process, effectively improving selection efficiency and effectiveness.

[0005] At present, although QTLs controlling corn ear height have been reported on all chromosomes of maize, there are few reports on the development and patent application of molecular markers tightly linked to the target QTL, and there are no patent reports related to corn ear height in the qEH1-2 segment. Summary of the Invention

[0006] The technical problem to be solved by the present invention is how to detect the height trait of corn ear.

[0007] To solve the above technical problems, the present invention first provides the use of a substance for detecting a high-molecular-weight marker of corn cob position in detecting or assisting in detecting the corn cob height trait, wherein the high-molecular-weight marker of corn cob position is a DNA fragment shown in SEQ ID No. 3 and a DNA fragment shown in SEQ ID No. 4.

[0008] In the above application, the substance for detecting the high molecular weight marker of corn cob can be a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing.

[0009] The present invention also provides a method for detecting the ear height trait of corn, which comprises: using genomic DNA of corn to be tested as a template, and performing PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list, wherein the ear height of the homozygous corn whose PCR product sequence is SEQ ID No. 3 is lower than, or has a candidate value lower than, the ear height of the homozygous corn whose PCR product sequence is SEQ ID No. 4, the ear height of the homozygous corn whose PCR product sequence is SEQ ID No. 3 is lower than, or has a candidate value lower than, the ear height of the heterozygous corn whose PCR product sequences are SEQ ID No. 3 and SEQ ID No. 4, and the ear height of the heterozygous corn whose PCR product sequence is SEQ ID No. 3 and SEQ ID No. 4 is lower than, or has a candidate value lower than, the ear height of the homozygous corn whose PCR product sequence is SEQ ID No. 4.

[0010] The present invention also provides a method for detecting the ear height trait of corn, which comprises: using genomic DNA of corn to be tested as a template, and performing PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list, wherein the ear height of homozygous corn with a PCR product size of 329 bp is lower than or has a candidate value lower than the ear height of homozygous corn with a PCR product size of 277 bp, the ear height of homozygous corn with a PCR product size of 329 bp is lower than or has a candidate value lower than the ear height of heterozygous corn with PCR products of 329 bp and 277 bp, and the ear height of heterozygous corn with a PCR product size of 329 bp and 277 bp is lower than or has a candidate value lower than the ear height of homozygous corn with a PCR product size of 277 bp.

[0011] The present invention also provides a corn breeding method, which comprises: using the genomic DNA of the corn to be tested as a template, performing PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list, and selecting the corn to be tested whose PCR product is SEQ ID No. 3 as the parent to complete breeding.

[0012] In the above, the reaction system for PCR amplification using the primer pair consisting of two single-stranded DNAs shown in SEQ ID No.1 and SEQ ID No.2 in the sequence listing can be: 1 μL of the single-stranded DNA shown in SEQ ID No.1 with a concentration of 10 μmo1 / L; 1 μL of the single-stranded DNA shown in SEQ ID No.2 with a concentration of 10 μmo1 / L; 1 μL of genomic DNA with a concentration of 100 ng / μL; 5 μL of 2×Taq PCR StarMix with Loading Dye (Beijing Kangrun Chengye Biotechnology Co., Ltd., catalog number: A012-01); and 2 μL of ddH2O.

[0013] The reaction conditions for PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence table can be: pre-denaturation at 95° C. for 10 min; denaturation at 95° C. for 45 s, annealing at 58° C. for 45 s, and extension at 72° C. for 60 s, for 35 cycles; extension at 72° C. for 10 min; and storage at 4° C.

[0014] The use of the substance for detecting the high molecular weight marker of corn ear position in the preparation of a product for detecting the height trait of corn ear position also falls within the scope of protection of the present invention.

[0015] The application of the corn ear position high molecular marker in detecting or assisting in detecting the corn ear height trait also falls within the protection scope of the present invention.

[0016] The application of the corn ear position high molecular marker in corn breeding also falls within the protection scope of the present invention.

[0017] In the present invention, the ear height refers to the height from the ground to the female ear attachment node.

[0018] The corn ear position high-molecular marker of the present invention is correlated with the corn ear height. The corn ear height can be successfully identified using the molecular marker. It has the advantages of being simple, rapid, efficient, and accurate, and has good repeatability and high specificity. It can be used for corn molecular marker-assisted breeding to breed new corn varieties with excellent comprehensive traits, greatly saving breeding costs and improving breeding efficiency.

[0019] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the comparison result of the amplified sequences of the molecular marker qEH1-2 of the present invention in both parents.

[0021] Figure 2 This is the electrophoretic pattern of the PCR amplification products of the molecular marker qEH1-2 of the present invention in both parents. W represents the amplified band pattern of the maize inbred line W22, and C represents the amplified band pattern of the maize wild relative CIMMYT 8759. The marker band sizes from bottom to top are 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 1500 bp, and 2000 bp, respectively.

[0022] Figure 3 This is an electrophoretic pattern of the PCR amplification products of the molecular marker qEH1-2 of the present invention in an F2 population. W represents the amplified band pattern of the homozygous W22 genotype, C represents the amplified band pattern of the homozygous CIMMYT 8759 genotype, and H represents the amplified band pattern of the heterozygous genotype. The marker band sizes from bottom to top are 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 1500 bp, and 2000 bp, respectively.

[0023] Figure 4 This is the single marker analysis result of the molecular marker qEH1-2 of the present invention for the ear height trait in the F2 population. NIL_W22 represents the homozygous W22 genotype, Het represents the heterozygous genotype, NIL_CIMMYT 8759 represents the homozygous CIMMYT8759 genotype, and * represents a significant difference ( P <0.05, ** indicates extremely significant difference ( P <0.01). DETAILED DESCRIPTION

[0024] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0025] The maize inbred line W22 and the maize wild relative CIMMYT 8759 in the following examples are both recorded in the literature (Identification and fine mapping of quantitative trait loci for the number of vascular bundle in maize stem, J Integr Plant Biol. 2016 Jan;58(1):81-90.doi:10.1111 / jipb.12358.Epub 2015 Jul 16.). The maize wild relative CIMMYT 8759 is CIMMYT accession 8759 in the literature. The public can obtain the maize inbred line W22 and the maize wild relative CIMMYT 8759 from the applicant. The biological materials are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0026] The MR0919 germplasm material used in the following examples is a product of the Maize Genetics Cooperation Stock Center (Maize Cooperative Stock Center), available at www.maizecoop.cropsci.uiuc.edu. This material is also publicly available from the applicant and is intended solely for replication of the experiments described herein and is not intended for any other purpose. MR0919 is an introgression line derived from maize inbred line W22 and maize wild relative CIMMYT 8759 through hybridization, backcrossing, and selfing.

[0027] Example 1: Molecular markers tightly linked to maize ear height

[0028] The present invention provides a molecular marker qEH1-2 (denoted as a "maize ear height marker") for identifying or assisting in the identification of maize ear height. The molecular marker is a DNA fragment obtained by PCR amplification using maize genomic DNA as a template and primer pair A1. The sequence of the resulting DNA fragment is SEQ ID No. 3 or SEQ ID No. 4. The sequence of primer pair A1 is as follows:

[0029] Forward amplification primer EH1-F: 5′-ACAGTGCCAGCTTTGATGTT-3′, as shown in SEQ ID No. 1;

[0030] Reverse amplification primer EH1-R: 5′-ACAACTGTCCAAGAGAGCCA-3′, as shown in SEQ ID No. 2;

[0031] Genomic DNA from the maize inbred line W22 with lower ear height and the wild maize relative CIMMYT 8759 with higher ear height were used as templates. PCR amplification was performed using the forward amplification primer shown in SEQ ID No. 1 and the reverse amplification primer shown in SEQ ID No. 2, and the sequences of the resulting PCR products were detected.

[0032] The reaction system for 10 μL PCR amplification is as follows:

[0033] (1) 1 μL of the forward amplification primer shown in SEQ ID No. 1 at a concentration of 10 μmol / L;

[0034] (2) 1 μL of the reverse amplification primer shown in SEQ ID No. 2 at a concentration of 10 μmol / L;

[0035] (3) 1 μL of DNA template at a concentration of 100 ng / μL;

[0036] (4) 5 μL 2×Taq PCR StarMix with Loading Dye (Beijing Kangrun Chengye Biotechnology Co., Ltd., catalog number: A012-01);

[0037] (5) 2 μL ddH2O.

[0038] The PCR amplification procedure is as follows:

[0039] (1) Pre-denaturation at 95°C for 10 min;

[0040] (2) denaturation at 95°C for 45 s, annealing at 58°C for 45 s, and extension at 72°C for 60 s, for 35 cycles;

[0041] (3) Extension at 72°C for 10 min;

[0042] (4) Store at 4°C.

[0043] PCR instrument model: Eppendorf Mastercycler nexus.

[0044] The PCR amplification products were separated by electrophoresis on a 4.0% agarose gel (4.0 g of agarose per 100 mL of gel solution) and sequenced. The results showed that when PCR amplification was performed using genomic DNA of the maize inbred line W22 as a template, the molecular weight of the PCR amplification product was 329 bp, and its nucleotide sequence is shown in SEQ ID No. 3. When PCR amplification was performed using genomic DNA of the maize wild relative CIMMYT 8759 as a template, the molecular weight of the PCR amplification product was 277 bp, and its nucleotide sequence is shown in SEQ ID No. 4.

[0045] SEQ ID No.3:

[0046] ACAGTGCCAGCTTTGATGTTCTGTTAGAACTTTGAAGTTTCATTTGATACTTGTCCTTTGGATAAGTAGTCAAACATTGTAGTGAATATGGGTAGCAATAGCACAACTGGAGGTGGAAAGTATGTTGGTTAAGTAAGAATTAGGTAGCAATAGCACAACTGGAAG TGGGAAGTATGTTGGTTAAGTAAGAATTAGGTAGCAATAGCACAACTGGAAGTGGGAAGTATGTTGGTTAAGTAAGAATTAGGTAGCAATAGCAACAGGCAACAGCTACATTTCATGCCATGGTTACAGCTTTGCATGTTCAATTGGCTCTCTTGGACAGTTGT.

[0047] SEQ ID No.4:

[0048] ACAGTGCCAGCTTTGATGTTCTGTTAGAACTTTGAAGTTTCATTTGATACTTGTCCTTTGGATAAGTAGTCAAACATTGTAGTGAATATGGGTAGCAATAGCACAACTGGAGGTGGAAAGTATGTTGGTTAAGTAAGAA TTAGGTAGCAATAGCACAACTGGAAGTGGGAAGTATGTTGGTTAAGTAAGAATTAGGTAGCAATAGCAACAGGCAACAGCTACATTTCATGCCATGGTTACAGCTTTGCATGTTCAATTGGCTCTCTTGGACAGTTGT.

[0049] The amplified band pattern of the maize inbred line W22 is a superior allele that reduces ear height. Therefore, if the molecular weight of the PCR amplification product of the maize sample being tested is 329 bp, then the maize sample being tested contains an allele that reduces ear height; if the molecular weight of the PCR amplification product of the maize sample being tested is 277 bp, then the maize sample being tested contains an allele that increases ear height.

[0050] The sequence alignment results of SEQ ID No.3 and SEQ ID No.4 are as follows Figure 1 The electrophoresis results of PCR amplification products of maize inbred line W22 and maize wild relative CIMMYT 8759 are shown in Figure 2. Figure 2 shown.

[0051] Example 2: Method for obtaining molecular marker EH1

[0052] The method for obtaining the molecular marker EH1 specifically comprises the following steps:

[0053] Step 1: Construction of a BC2S3 introgression population containing 866 families

[0054] Using the maize inbred line W22 as the recipient parent and the maize wild relative CIMMYT 8759 as the donor parent, a BC2S3 introgression line population containing 866 families was obtained through one generation of hybridization, two generations of backcrossing, and three generations of selfing.

[0055] Step 2: Field planting and phenotyping of introgression lines

[0056] In the spring of 2019, a BC2S3 introgression population was planted at the National Crop Variety Regional Experimental Station in Liuyang City, Hunan Province (28.2°N, 113.6°E). The field experiment employed an expanded incompletely randomized block design. Each plot was planted in two rows, with 15 plants per row and a spacing of 25 cm between plants. Two families were planted per ridge. Ridge height was 15 cm, ridge width was 70 cm, and furrow width was 30 cm.

[0057] Ten days after pollination, the ear height phenotype was measured. Eight consecutive plants were surveyed, starting with the third plant in each family. Ear height was measured from the ground to the node where the female ear is attached.

[0058] Step 3: Conduct QTL mapping analysis

[0059] QTL mapping analysis was performed using the R / qtl multi-QTL model. First, simple interval QTL mapping was performed using Haley-Knott regression, and the LOD threshold (α = 0.05) for the ear height QTL was determined using 10,000 permutation tests. The QTL model derived from simple interval mapping was then fitted to a multi-QTL model, and the position of each QTL was optimized using the refineqtl command in R / qtl. The addqtl command was then used to test for additional QTLs that significantly improved the model. If new QTLs were detected, the multi-QTL model was refitted and the QTL position was optimized. This process was repeated until no new QTLs were detected. Finally, the fitqtl command was used to calculate the total phenotypic variance explained by all QTLs, as well as the additive effects and phenotypic contributions of individual QTLs.

[0060] QTL mapping analysis revealed that 10 QTLs controlling ear height were detected, including one QTL with a significant phenotypic effect, qEH1-2, on chromosome 1. qEH1-2 had a LOD value of 12.84, an additive effect size of 6.25 cm, a dominant effect size of 2.93 cm, and a phenotypic contribution rate of 4.71%. It was located within the 232529138 to 237965521 bp interval on chromosome 1.

[0061] Step 4: Development and synthesis of molecular marker EH1

[0062] The online primer design software Primer3 (https: / / primer3.ut.ee / ) was used to search for the physical interval of qEH1-2 on chromosome 1 from 232529138 bp to 237965521 bp. Forward amplification primer EH1-F and reverse amplification primer EH1-R were designed. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The nucleotide sequences are as follows:

[0063] Forward amplification primer EH1-F: 5′-ACAGTGCCAGCTTTGATGTT-3′, as shown in SEQ ID No. 1;

[0064] Reverse amplification primer EH1-R: 5'-ACAACTGTCCAAGAGAGCCA-3', as shown in SEQ ID No.2.

[0065] Example 3: Application of molecular marker EH1

[0066] Using the introgression line MR0919, which is heterozygous only in the qEH1-2 segment and homozygous at other genomic sites, as the starting material, self-pollination was performed to generate an F2 population that segregated only in the qEH1-2 segment. This F2 population, comprising 324 individual plants, was used to validate the molecular marker EH1 obtained in this invention to determine its accuracy for use in marker-assisted selection breeding. Specifically, the following steps were involved:

[0067] Step 1: Determination of ear height in F2 population

[0068] The ear height of the F2 population plants was measured according to the method of Example 2.

[0069] Step 2: Extract DNA from corn leaves using the CTAB method.

[0070] Step 3: PCR amplification

[0071] The PCR amplification reaction system is 10 μL, including:

[0072] (1) 1 μL of the forward amplification primer shown in SEQ ID No. 1 at a concentration of 10 μmol / L;

[0073] (2) 1 μL of the reverse amplification primer shown in SEQ ID No. 2 at a concentration of 10 μmol / L;

[0074] (3) 1 μL of DNA template at a concentration of 100 ng / μL;

[0075] (4) 5 μL 2×Taq PCR StarMix with Loading Dye (Beijing Kangrun Chengye Biotechnology Co., Ltd., catalog number: A012-01);

[0076] (5) 2 μL ddH2O.

[0077] The PCR amplification procedure is as follows:

[0078] (1) Pre-denaturation at 95°C for 10 min;

[0079] (2) denaturation at 95°C for 45 s, annealing at 58°C for 45 s, and extension at 72°C for 60 s, for 35 cycles;

[0080] (3) Extension at 72°C for 10 min;

[0081] (4) Store at 4°C.

[0082] PCR instrument model: Eppendorf Mastercycler nexus.

[0083] Step 4: Electrophoresis

[0084] The electrophoretic patterns of the PCR amplified products of the molecular marker EH1 in some F2 plants are as follows: Figure 3 shown.

[0085] Step 5: Result Analysis

[0086] The genotype of the corn sample to be tested is determined based on the molecular weight of the PCR amplification product: if the PCR amplification product of the corn sample to be tested has only one 329 bp band, the corn to be tested has a homozygous W22 genotype (i.e., the same genotype as the corn inbred line W22); if the PCR amplification product of the corn sample to be tested has only one 277 bp band, the corn to be tested has a homozygous CIMMYT 8759 genotype (i.e., the same genotype as the wild relative of corn CIMMYT 8759); if the PCR amplification product of the corn sample to be tested has not only one 329 bp band but also a 277 bp band, the corn to be tested has a heterozygous genotype.

[0087] Among the F2 plants, a total of 73 were homozygous W22 genotypes, and sequencing of PCR products showed that their sequences were all SEQ ID No. 3. The ear height of the 73 homozygous W22 genotype F2 plants was 50.1±9.5 cm; a total of 79 were homozygous CIMMYT8759 genotypes, and sequencing of PCR products showed that their sequences were all SEQ ID No. 4. The ear height of the 79 homozygous CIMMYT 8759 genotype F2 plants was 62.8±12.9 cm; a total of 172 were heterozygous genotypes, and sequencing of PCR products showed that their sequences were all SEQ ID No. 3 and SEQ ID No. 4. The ear height of the 172 heterozygous genotype F2 plants was 53.3±8.7 cm.

[0088] The phenotypic values ​​of ear height in each group were further analyzed by variance analysis ( Figure 4 The results showed that the ear height of the homozygous W22 genotype F2 plant was significantly lower than that of the homozygous CIMMYT 8759 genotype F2 plant, the ear height of the homozygous W22 genotype F2 plant was significantly lower than that of the heterozygous genotype F2 plant, and the ear height of the heterozygous genotype F2 plant was significantly lower than that of the homozygous CIMMYT8759 genotype F2 plant. This indicates that the molecular marker EH1 is related to the ear height of maize and has important breeding application value.

[0089] In summary, the molecular marker EH1 provided by the present invention is tightly linked to qEH1-2, enabling rapid and accurate identification of maize ear height. This facilitates the application of this locus in the breeding of new maize varieties and facilitates molecular aggregation breeding of this locus with other loci for superior traits. The method provided by the present invention allows for the identification and screening of maize germplasm for ear height at any stage of development, demonstrating its simplicity, speed, efficiency, and accuracy, making it suitable for large-scale application.

[0090] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Use of a reagent for detecting a high-molecular-weight marker of corn ear position in detecting or assisting in detecting the corn ear height trait, wherein the high-molecular-weight marker of corn ear position is a DNA fragment shown in SEQ ID No. 3 and a DNA fragment shown in SEQ ID No.

4.

2. The use according to claim 1, characterized in that: The reagent for detecting the high molecular marker of corn cob is a primer pair composed of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence table.

3. A method for detecting the height trait of corn ears, comprising: The genomic DNA of the corn to be tested is used as a template, and PCR amplification is performed using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list. The ear height of the homozygous corn with the PCR product sequence of SEQ ID No. 3 obtained is lower than, or a candidate is lower than, the ear height of the homozygous corn with the PCR product sequence of SEQ ID No. 4 obtained. The ear height of the homozygous corn with the PCR product sequence of SEQ ID No. 3 obtained is lower than, or a candidate is lower than, the ear height of the heterozygous corn with the PCR product sequences of SEQ ID No. 3 and SEQ ID No. 4 obtained. The ear height of the heterozygous corn with the PCR product sequence of SEQ ID No. 3 and SEQ ID No. 4 obtained is lower than, or a candidate is lower than, the ear height of the homozygous corn with the PCR product sequence of SEQ ID No. 4 obtained.

4. A method for detecting the height trait of corn ears, comprising: Using the genomic DNA of the corn to be tested as a template, PCR amplification is performed using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing. The ear height of the homozygous corn with a PCR product size of 329 bp obtained is lower than or has a candidate value lower than the ear height of the homozygous corn with a PCR product size of 277 bp obtained. The ear height of the homozygous corn with a PCR product size of 329 bp obtained is lower than or has a candidate value lower than the ear height of the heterozygous corn with PCR products of 329 bp and 277 bp obtained. The ear height of the heterozygous corn with PCR products of 329 bp and 277 bp obtained is lower than or has a candidate value lower than the ear height of the homozygous corn with a PCR product size of 277 bp obtained.

5. Corn breeding methods, including: The genomic DNA of the test corn was used as a template, and a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list was used for PCR amplification. The test corn with the PCR product of SEQ ID No. 3 was selected as the parent to complete the breeding.

6. Use of the reagent for detecting high-molecular-weight markers of corn ear position according to claim 1 or 2 in the preparation of a product for detecting the trait of corn ear height.

7. Use of the high-molecular-weight marker for corn ear position according to claim 1 or 2 in detecting or assisting in detecting the corn ear height trait.

8. Use of the corn ear position high molecular weight marker according to claim 1 or 2 in corn breeding.

Images