The application discloses an sgRNA group targeting a DYA gene, a primer pair amplifying a target sequence, a plasmid group and application thereof.

Abstract

The present application relates to the field of genetic engineering, in particular to a sgRNA group targeting DYA gene, a primer pair for amplifying target sequence, a plasmid group and application thereof. The sgRNA group designed by the present application edits the sheep DYA gene, and after gene editing, large fragment deletion occurs and causes frame shift mutation, which causes great damage to the protein structure and function encoded by the DYA gene. The experimental results show that different fragment lengths of gene editing can be caused in the target region, the overall editing efficiency of the first exon reaches 76.4%, and the overall editing efficiency of the second exon reaches 84.09%. Editing occurs on both sets of chromosomes in the genome (i.e. homozygote): the homozygote editing efficiency of the first exon is 30.9%, and the homozygote editing efficiency of the second exon is 9.1%. The sgRNA group provided by the present application has important significance in the study of ruminant evolution and related immune mechanisms.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to an sgRNA group targeting the DYA gene, primer pairs for amplifying the target sequence, plasmid group, and their applications. Background Technology

[0002] CRISPR / Cas9 technology is currently the most commonly used gene editing technology. Previous technologies such as homologous recombination, ZFN (zinc finger nucleases), and TANLEN (transcriptional activator-like effector nucleases) could also achieve precise knockout of large segments of the target gene, but the efficiency of spontaneous homologous recombination within cells was extremely low. ZFN and TALEN technologies are cumbersome to design, more expensive, and less efficient, while CRISPR / Cas9 technology has higher gene editing efficiency and can mediate homologous recombination. Compared to ZFN and TALEN, the Cas9 system has significant advantages. When using the CRISPR / Cas9 system for gene editing, it is necessary to first design a single-guide (Sg) sequence based on the genome sequence. Multiple sg sequences can generally be designed for the target gene, but the position and base order of the sequence affect its efficiency in editing the target gene. Using a high-efficiency sg sequence makes it easier to obtain cells or fertilized eggs for target gene editing, reducing experimental time and costs in obtaining gene-edited cells or animal individuals.

[0003] The DYA (MHC class II antigen DYalpha) gene is an MHC class II antigen, DYα. The DYA gene is expressed only in the lymphatic tissue, skin, and spleen of ruminants. The proteins expressed by DYA are mainly located on the surface of dendritic cells and play an important role in the immune response. The specificity of DYA expression in ruminants and its function are of great significance in the study of ruminant evolution and related immune mechanisms. Currently, there are no reports of editing the sheep DYA gene, nor are there any examples of editing the DYA gene using the CRISPR / Cas9 system. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides an sgRNA genome targeting the DYA gene, primer pairs for amplifying the target sequence, a plasmid genome, and their applications. The sgRNA genome provided by this invention can be used to edit the sheep DYA gene using CRISPR / Cas9 technology, which is of great significance in the study of ruminant evolution and related immune mechanisms.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The application provides an sgRNA group targeting a DYA gene, the sgRNA group comprising Exon1-sgRNA and / or Exon2-sgRNA;

[0007] The Exon1-sgRNA comprises Exon1-sgRNA1 and Exon1-sgRNA2;

[0008] The Exon1-sgRNA1 comprises Exon1-sgRNA1-F and Exon1-sgRNA1-R; and the Exon1-sgRNA2 comprises Exon1-sgRNA2-F and Exon1-sgRNA2-R;

[0009] The nucleotide sequence of the Exon1-sgRNA1-F is shown as SEQ ID No. 1, and the nucleotide sequence of the Exon1-sgRNA1-R is shown as SEQ ID No. 2;

[0010] The nucleotide sequence of the Exon1-sgRNA2-F is shown as SEQ ID No. 3, and the nucleotide sequence of the Exon1-sgRNA2-R is shown as SEQ ID No. 4;

[0011] The Exon2-sgRNA comprises Exon2-sgRNA1 and Exon2-sgRNA2, the Exon2-sgRNA1 comprises Exon2-sgRNA1-F and Exon2-sgRNA1-R; and the Exon2-sgRNA2 comprises Exon2-sgRNA2-F and Exon2-sgRNA2-R;

[0012] The nucleotide sequence of the Exon2-sgRNA1-F is shown as SEQ ID No. 5, and the nucleotide sequence of the Exon2-sgRNA1-R is shown as SEQ ID No. 6;

[0013] The nucleotide sequence of the Exon2-sgRNA2-F is shown as SEQ ID No. 7, and the nucleotide sequence of the Exon2-sgRNA2-R is shown as SEQ ID No. 8.

[0014] The application further provides a primer pair for amplifying the target sequence of the sgRNA group described in the above scheme, the primer pair comprising primer pair 1 and / or primer pair 2;

[0015] The nucleotide sequence of the upstream primer of the primer pair 1 is shown as SEQ ID No. 9, and the nucleotide sequence of the downstream primer of the primer pair 1 is shown as SEQ ID No. 10;

[0016] The nucleotide sequence of the upstream primer of the primer pair 2 is shown as SEQ ID No. 11, and the nucleotide sequence of the downstream primer of the primer pair 2 is shown as SEQ ID No. 12.

[0017] The application further provides a plasmid group for knocking out a DYA gene, wherein the plasmid group comprises an Exon1-sgRNA plasmid group and / or an Exon2-sgRNA plasmid group.

[0018] The Exon1-sgRNA plasmid group comprises an Exon1-sgRNA1 plasmid and an Exon1-sgRNA2 plasmid; the Exon1-sgRNA1 plasmid comprises the Exon1-sgRNA1 in the sgRNA group of claim 1 and a px330 plasmid; and the Exon1-sgRNA2 plasmid comprises the Exon1-sgRNA2 in the sgRNA group of claim 1 and a px330 plasmid.

[0019] The Exon2-sgRNA plasmid group comprises an Exon2-sgRNA1 plasmid and an Exon2-sgRNA2 plasmid; the Exon2-sgRNA1 plasmid comprises the Exon2-sgRNA1 in the sgRNA group of claim 1 and a px330 plasmid; and the Exon2-sgRNA2 plasmid comprises the Exon2-sgRNA2 in the sgRNA group of claim 1 and a px330 plasmid.

[0020] Preferably, the px330 plasmid comprises a px330 large fragment plasmid after BbsI enzyme.

[0021] The application further provides an application of the sgRNA group in the above scheme or the primer pair in the above scheme or the plasmid group in the above scheme in editing a DYA gene.

[0022] Preferably, the DYA gene comprises a DYA gene of a sheep.

[0023] Preferably, the sheep comprises a Hu sheep.

[0024] The application further provides an application of the sgRNA group in the above scheme or the primer pair in the above scheme or the plasmid group in the above scheme in identifying a function of a DYA gene.

[0025] The application further provides a method for editing a DYA gene in a sheep cell, comprising: introducing the plasmid group in the above scheme into the sheep cell to obtain a gene-edited sheep cell.

[0026] Preferably, the sheep cell comprises a sheep fibroblast cell.

[0027] Beneficial effects:

[0028] The application provides an sgRNA group targeting a DYA gene, the sgRNA group comprising Exon1-sgRNA and / or Exon2-sgRNA; the Exon1-sgRNA comprising Exon1-sgRNA1 and Exon1-sgRNA2; the Exon1-sgRNA1 comprising Exon1-sgRNA1-F and Exon1-sgRNA1-R; the Exon1-sgRNA2 comprising Exon1-sgRNA2-F and Exon1-sgRNA2-R; the nucleotide sequence of the Exon1-sgRNA1-F is shown in SEQ ID No. 1, the nucleotide sequence of the Exon1-sgRNA1-R is shown in SEQ ID No. 2; the nucleotide sequence of the Exon1-sgRNA2-F is shown in SEQ ID No. 3, and the nucleotide sequence of the Exon1-sgRNA2-R is shown in SEQ ID No. 4; the Exon2-sgRNA comprising Exon2-sgRNA1 and Exon2-sgRNA2, the Exon2-sgRNA1 comprising Exon2-sgRNA1-F and Exon2-sgRNA1-R; the Exon2-sgRNA2 comprising Exon2-sgRNA2-F and Exon2-sgRNA2-R; the nucleotide sequence of the Exon2-sgRNA1-F is shown in SEQ ID No. 5, and the nucleotide sequence of the Exon2-sgRNA1-R is shown in SEQ ID No. 6; the nucleotide sequence of the Exon2-sgRNA2-F is shown in SEQ ID No. 7, and the nucleotide sequence of the Exon2-sgRNA2-R is shown in SEQ ID No. 8. The application designs two sg sequences (namely the sgRNA group in the application) for the No. 1 and No. 2 exons of the DYA gene, respectively, and edits the sheep DYA gene by using the sgRNA group designed in the application, so that a large fragment deletion and a frame shift mutation can occur after gene editing, and the protein structure and function coded by the DYA gene are greatly damaged. Through transfection and sequencing verification in fetal fibroblasts, it is proved that different fragment lengths of gene editing can occur in the target region, the overall editing efficiency of the No. 1 exon reaches 76.4%, and the overall editing efficiency of the No. 2 exon reaches 84.09%. Editing occurs on both sets of chromosomes in the genome (namely homozygote): the editing efficiency of the No. 1 exon homozygote is 30.9%, and the editing efficiency of the No. 2 exon homozygote is 9.1%. The sgRNA group provided by the application has important significance in the study of ruminant evolution and related immune mechanisms. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced as follows.

[0030] Figure 1 For sequence design and experimental implementation process;

[0031] Figure 2 For primer amplification and sequencing results; wherein A is the electrophoresis result of the amplification product, 960bp is obtained by amplifying exon 1; 648bp is obtained by amplifying exon 2; B is part of the sequence of DYA exon 1 obtained by sequencing; C is part of the sequence of DYA exon 2 obtained by sequencing; D is the sg sequence and position diagram designed for DYA exon 1 and exon 2;

[0032] Figure 3 For part of the sequencing results of the obtained monoclonal cell DYA gene; wherein A is the monoclonal genotype obtained by editing DYA exon 1; B is the monoclonal genotype obtained by editing DYA exon 2;

[0033] Figure 4 For the electrophoresis detection results of the restriction enzyme digestion products after the transfection of different recombinant vectors in Comparative Example 1; wherein A is the detection result of exon 1, sg1+2 is the combined transfection result of pX330DYA-Exon1-sg1 and pX330DYA-Exon1-sg2; B is the detection result of exon 2, sg1+2 is the combined transfection result of pX330DYA-Exon2-sg1 and pX330DYA-Exon2-sg2, sg1+3 is the combined transfection result of pX330DYA-Exon2-sg1 and pX330DYA-Exon2-sg3, sg2+3 is the combined transfection result of pX330DYA-Exon2-sg2 and pX330DYA-Exon2-sg3; NC is the sheep fibroblast cell without any sgRNA transfection. DETAILED DESCRIPTION

[0034] The application provides an sgRNA group targeting a DYA gene, the sgRNA group comprising Exon1-sgRNA and / or Exon2-sgRNA; the Exon1-sgRNA comprising Exon1-sgRNA1 and Exon1-sgRNA2; the Exon1-sgRNA1 comprising Exon1-sgRNA1-F and Exon1-sgRNA1-R; the Exon1-sgRNA2 comprising Exon2-sgRNA1 and Exon2-sgRNA2, the Exon2-sgRNA1 comprising Exon1-sgRNA2-F and Exon1-sgRNA2-R; the Exon2-sgRNA comprising Exon2-sgRNA1-F and Exon2-sgRNA1-R; the Exon2-sgRNA2 comprising Exon2-sgRNA2-F and Exon2-sgRNA2-R.

[0035] The nucleotide sequence of the Exon1-sgRNA1-F is shown in SEQ ID No. 1, in particular: CACCG GAAGAAAGCTCTGATTCTGA

[0036] The nucleotide sequence of the Exon1-sgRNA1-R is shown in SEQ ID No. 2, in particular: AAAC TCAGAATCAGAGCTTTCTTC C ;

[0037] The nucleotide sequence of the Exon1-sgRNA2-F is shown in SEQ ID No. 3, in particular: CACCG TGTGGAGGTGAAGACATCGT

[0038] The nucleotide sequence of the Exon1-sgRNA2-R is shown in SEQ ID No. 4, in particular: AAAC ACGATGTCTTCACCTCCACA C ;

[0039] The nucleotide sequence of the Exon2-sgRNA1-F is shown in SEQ ID No. 5, in particular: CACCG TTGTGCCGTAAGTGCCCACG

[0040] The nucleotide sequence of the Exon2-sgRNA1-R is shown in SEQ ID No. 6, in particular: AAAC CGTGGGCACTTACGGCACAA C ;

[0041] The nucleotide sequence of the Exon2-sgRNA2-F is shown as SEQ ID No. 7, in particular: CACCG TGGAGACGAGCTCTTCTACG;

[0042] The nucleotide sequence of the Exon2-sgRNA2-R is shown as SEQ ID No. 8, in particular: AAAC CGTAGAAGAGCTCGTCTCCA C The nucleotide sequence of the underlined part in SEQ ID No. 1-8 is the nucleotide sequence of the enzyme cutting site of BbsI enzyme.

[0043] The present application designs efficient gene editing targeting sg sequences for the 1st and 2nd exon sequences of the DYA gene, thereby facilitating subsequent gene editing in somatic cells or individuals, wherein Exon1-sgRNA1 and Exon1-sgRNA2 can specifically edit the 1st exon of the DYA gene, and Exon1-sgRNA2-F and Exon1-sgRNA2-R can specifically edit the 2nd exon of the DYA gene.

[0044] The present application also provides a primer pair for amplifying the target sequence of the sgRNA group described in the above scheme, and the primer pair comprises primer pair 1 and / or primer pair 2.

[0045] The nucleotide sequence of the upstream primer of the primer pair 1 is shown as SEQ ID No. 9, in particular: AGCTTTACTCTTTGATGATTCCTC.

[0046] The nucleotide sequence of the downstream primer of the primer pair 1 is shown as SEQ ID No. 10, in particular: CATGCTATACTTGGGCATTACG.

[0047] The nucleotide sequence of the upstream primer of the primer pair 2 is shown as SEQ ID No. 11, in particular: AGGAAGTGGTGTAGGACCAG.

[0048] The nucleotide sequence of the downstream primer of the primer pair 2 is shown as SEQ ID No. 12, in particular: GGCTGAGGTACTACTTGGCTAC.

[0049] The primer pair 1 can specifically amplify the first exon of the DYA gene, and the sequence obtained by amplification is preferably as shown in SEQ ID No.13, as follows: agctttactctttgatgattcctcctatgtatgatatccttctgctcccgtttgaatctatgtatgcc cttagataattcaaaacaagggagttttccaggcttcttacaggtctcttcctaaaaatgcttcagctggcaactgagatgtcagctcagggaatttctctgatgggctgaaacacgatagagcagggtgaggcgtgggctgctccaacatgacttctccagcagttctctttagaccaccttcctggtgaggcaccacttggaacagccactcctgaggaaacccttggaggaggaggaggatgaagaaagctctgattctgagggctctcgctctggccgccatgatgagcctgtgtggaggtgaagacatcgtgggtgagtgtacagttgaggggtgggggtttacaattgtgaagaatttcttaatttttattttatattggagtatggtggctcaggtggtaaagaatctgcctgcaatgcaggagacccagatttgatccctggattgggaagatcccctggagaagggaatggctacccacttcagtattcttgcctgaagaattccatgggcagaggagcctggcaggctgcagtccatgaggtcacaaaaagtctgacatgacttagcaactaaacaactatatatatacatcttctttatccattcatttgtcagtagacatttaggttgtttccatgtcttggctcttataagtagcactgctgtgaaataaaggtgcatttatctttttgcattatagttctttccggatatatacccaggagtgggattgctggaccatatggcaactctattttcagatgtgcattctaaataacaaagagttgtgtgtatgtgtatgtgtgtgaaagtcactcagttctgtccaactctttgagaccccatggactaaaaagcaacgtaatgcccaagtatagcatg.

[0050] The primer pair 2 can specifically amplify the 2nd exon of the DYA gene, and the sequence obtained by amplification is preferably as shown in SEQ ID No. 14, and specifically as follows: aggaagtggtgtaggaccaggccaaatatgaacccacactcctagacagaccacttctcat ctgtttttatttaatccaattctttcccctcccctgtatcccgcttccctgttcttaccttcctgctttggcatggccacgcaccagcggaccacgtgggcacttacggcacaaatgtctaccagacgtacggcgcctctggccagttcacgtttgaatttgatggagacgagctcttctacgtggacctgaggaaaaaagagactgtctggaggctgcccgagtttaacaatatcacaatgtttgaaattcagagtgccctgagaaacattgttatgtcaaaaagaaatttggacatcttgatgaaaaattccaactttacacctgccaccaacggtaagtgtggtctctcttcacggtatctatctcctgttcctggtctctttttcctccccaaggtagctagtcttccccccaacactctaaattgttccccctttctattccatttcctggcaaatacccagtcctcagctacagatttaatcttgaaatatccctccccaagttccaagaaccactccttgaagttctaaaagaggatattcccaagctcttggcctaagtagccaagtagtacctcagcc.

[0051] The application further provides a plasmid group for knocking out the DYA gene, wherein the plasmid group comprises an Exon1-sgRNA plasmid group and / or an Exon2-sgRNA plasmid group.

[0052] The Exon1-sgRNA plasmid group comprises an Exon1-sgRNA1 plasmid and an Exon1-sgRNA2 plasmid; the Exon1-sgRNA1 plasmid comprises the Exon1-sgRNA1 and the px330 plasmid described in the above scheme; the Exon1-sgRNA2 plasmid comprises the Exon1-sgRNA2 and the px330 plasmid described in the above scheme;

[0053] The Exon2-sgRNA plasmid group includes an Exon2-sgRNA1 plasmid and an Exon2-sgRNA2 plasmid; the Exon2-sgRNA1 plasmid includes the Exon2-sgRNA1 and the px330 plasmid described in the above scheme; and the Exon2-sgRNA2 plasmid includes the Exon2-sgRNA2 and the px330 plasmid described in the above scheme.

[0054] In the present application, the px330 plasmid preferably includes a px330 large fragment plasmid after Bbs I enzyme.

[0055] The Exon1-sgRNA plasmid group provided by the present application can specifically edit the first exon of the DYA gene, and the Exon2-sgRNA plasmid group can specifically edit the second exon of the DYA gene.

[0056] The present application also provides the sgRNA described in the above scheme, the primer pair described in the above scheme or the plasmid group described in the above scheme for use in editing the DYA gene. In the present application, the editing preferably includes knocking out the DYA gene; the DYA gene preferably includes the DYA gene of sheep; and the sheep preferably includes Hu sheep.

[0057] The present application also provides the sgRNA described in the above scheme, the primer pair described in the above scheme or the plasmid group described in the above scheme for use in identifying the function of the DYA gene.

[0058] The present application also provides a method for efficiently editing the DYA gene in sheep cells, which includes: introducing the plasmid group described in the above scheme into the sheep cells to obtain gene-edited sheep cells.

[0059] In the present application, the sheep cells preferably include sheep fibroblasts, further preferably Hu sheep fibroblasts, and more preferably Hu sheep fetal fibroblasts.

[0060] In order to further illustrate the present application, the sgRNA group targeting the DYA gene, the primer pair amplifying the target sequence, the plasmid group and the application thereof provided by the present application are described in detail below in conjunction with the embodiments and the drawings, but they should not be understood as limiting the protection scope of the present application.

[0061] Example 1

[0062] According to the reference sequence provided by the DYA gene (sequence number: NC_019477.2) of sheep (version number Oar_v4.0(GCF_000298735.2)) published by NCBI, PCR primers targeting the first and second exons are designed, and the designed primers are used for PCR amplification with the Hu sheep genome as a template. After sequencing the amplification product (the amplification product electrophoresis result is shown in FIG. 1), the sequence of the first exon is shown in SEQ ID NO: 1, and the sequence of the second exon is shown in SEQ ID NO: 2.Figure 2 A in SEQ ID No. 1, and the sequencing results are shown in Figure 2 B and C in SEQ ID No. 1, and the sequencing results are shown in

[0063] The amplification primer for the No. 1 exon (the fragment length is 960 bp, as shown in SEQ ID No. 13) is as follows:

[0064] The nucleotide sequence of the upstream primer DYA-Exon1-F is shown in SEQ ID No. 9;

[0065] The nucleotide sequence of the downstream primer DYA-Exon1-R is shown in SEQ ID No. 10;

[0066] The amplification primer for the No. 2 exon (the fragment length is 648 bp, as shown in SEQ ID No. 14) is as follows:

[0067] The nucleotide sequence of the upstream primer DYA-Exon2-F is shown in SEQ ID No. 11;

[0068] The nucleotide sequence of the downstream primer DYA-Exon2-R is shown in SEQ ID No. 12.

[0069] The PCR amplification procedure for the No. 1 exon and the No. 2 exon is as follows: 95 °C pre-denaturation for 5 min, 34 x [95 °C denaturation for 30 s, 53 °C annealing for 30 s, 72 °C extension for 45 s], 72 °C extension for 5 min, and 4 °C preservation.

[0070] The amplification system for the No. 1 exon and the No. 2 exon is as follows (PhantaMaxmix of Nanjing Novogene Bio-tech Co., Ltd. is used, and the product number is P525-03): 1 μL of the upstream primer and the downstream primer, 1 μL of the DNA template, 12.5 μL of the 2 x mix of the DNA polymerase, and ddH2O is added to 25 μL.

[0071] Example 2

[0072] 1. The sequence of the DYA exon of the Hu sheep according to the sequencing results of Example 1 is designed as sg (see Figure 2 D in SEQ ID No. 1), and a single-stranded oligonucleotide sequence is synthesized. The sequence is as follows (5'-3'):

[0073] The upstream sequence Exon1-sgRNA1-F: CACCGGAAGAAAGCTCTGATTCTGA, SEQ ID No. 1;

[0074] The downstream sequence Exon1-sgRNA1-R: AAACTCAGAATCAGAGCTTTCTTCC, SEQ ID No. 2;

[0075] Upstream sequence Exonl-sgRNA2-F: CACCGTGTGGAGGTGAAGACATCGT, SEQ ID No. 3;

[0076] Downstream sequence Exonl-sgRNA2-R: AAACACGATGTCTTCACCTCCACAC, SEQ ID No. 4;

[0077] Upstream sequence Exon2-sgRNA1-F: CACCGTTGTGCCGTAAGTGCCCACG, SEQ ID No. 5;

[0078] Downstream sequence Exon2-sgRNA1-R: AAACCGTGGGCACTTACGGCACAAC, SEQ ID No. 6;

[0079] Upstream sequence Exon2-sgRNA2-F: CACCGTGGAGACGAGCTCTTCTACG, SEQ ID No. 7;

[0080] Downstream sequence Exon2-sgRNA2-R: AAACCGTAGAAGAGCTCGTCTCCAC, SEQ ID No. 8;

[0081] The underlined nucleotide sequences in SEQ ID Nos. 1-8 are the enzyme cutting sites of Bbs I enzyme.

[0082] 2. The synthesized oligonucleotide sequences of sg were annealed to obtain double-stranded sg sequences, wherein the double-stranded sg sequences are as follows: Exonl-sgRNA1 is obtained by annealing the upstream sequence Exonl-sgRNA1-F and the downstream sequence Exonl-sgRNA1-R, Exonl-sgRNA2 is obtained by annealing the upstream sequence Exonl-sgRNA2-F and the downstream sequence Exonl-sgRNA2-R, Exon2-sgRNA1 is obtained by annealing the upstream sequence Exon2-sgRNA1-F and the downstream sequence Exon2-sgRNA1-R, and Exon2-sgRNA2 is obtained by annealing the upstream sequence Exon2-sgRNA2-F and the downstream sequence Exon2-sgRNA2-R; the annealing program is 95°C for 5 min, 37°C for 10 min, and 4°C for preservation; and the annealing system is as follows: 2.5 μL of the upstream sequence and the downstream sequence, 1.0 μL of 10x PCR buffer, and ddH2O to make up to 10 μL.

[0083] At the same time of annealing, Cas9 expression vector pX330 (starting vector) was subjected to enzyme digestion with Bbs I (NEB, item number: R3539S), and the enzyme digestion product was purified and recovered by an agarose gel recovery kit (Hunan Aikuo Rui Biological Engineering Co., Ltd., item number: AG21004).

[0084] The reaction procedure for enzyme digestion was as follows: 10 μg of pX330 vector, 10 μL of NEBCutsmart, 3.0 μL of Bbs I, and ddH2O to make up to 100 μL; the reaction system for enzyme digestion was as follows: enzyme digestion at 37°C for 4 h.

[0085] 3. The enzyme-digested pX330 vector and the annealed double-stranded sg sequence were subjected to ligation by T4 DNA ligase (NEB, item number: M0202S). The ligation product was transformed into E. coli competent cells (transformation and culture were performed according to the method provided by Beijing Tiangeng Biochemical Technology Co., Ltd., reagent item number: CB101), and the obtained bacterial clones were subjected to sequencing. If the sequencing result contained the designed sg sequence, it indicated that the ligation was correct.

[0086] The colonies containing the correct vector were cultured in large quantities, and plasmids were extracted (culture and plasmid extraction were performed according to the method provided in the reagent kit of Tiangeng Biochemical Technology Co., Ltd., item number: DP118-02), to obtain recombinant vectors pX330DYA-Exon1-sg1 (Exon1-sgRNA1 plasmid), pX330DYA-Exon1-sg2 (Exon1-sgRNA2 plasmid), pX330DYA-Exon2-sg1 (Exon2-sgRNA1 plasmid), and pX330DYA-Exon2-sg2 (Exon2-sgRNA2 plasmid).

[0087] The ligation system was as follows: 100 ng of pX330 vector recovery product, 6.5 μL of annealing product (sg), 0.5 μL of T4 DNA ligase, and ddH2O to make up to 10 μL; the ligation procedure was as follows: ligation at 16°C for 3 h.

[0088] 4、Cell transfection: for exon 1, use pX330DYA-Exonl-sgl, pX330DYA-Exonl-sg2, g418 (geneticin) resistance vector pl452 (Wuhan Mlin Biological Technology Co., Ltd: L3065); for exon 2, use pX330DYA-Exon2-sgl, pX330DYA-Exon2-sg2, g418 (geneticin) resistance vector pl452, the above two combinations were co-transfected into Hu sheep fetal fibroblasts by lipofection method (Invitrogen: LIPOFECTAMINE3000 L3000015), and the total amount of plasmid transfected into each six-well plate hole was 9 μg. The transfection system consisted of system 1 and system 2.

[0089] System 1 for exon 1 was liposome 7.5 μL and DMEM / F12 125 μL, and system 2 was pl452 vector 3 μg, pX330DYA-Exonl-sgl 3 μg, pX330DYA-Exonl-sg2 3 μg, P3000 reagent 10 μL and DMEM / F12 125 μL.

[0090] System 1 for exon 2 was liposome 7.5 μL and DMEM / F12 125 μL, and system 2 was pl452 vector 3 μg, pX330DYA-Exon2-sgl 3 μg, pX330DYA-Exon2-sg2 3 μg, P3000 reagent 10 μL and DMEM / F12 125 μL.

[0091] 5、After mixing system 1 and system 2, incubate at room temperature for 20 min, then add to the six-well plate hole containing Hu sheep fetal fibroblasts (cell inoculation amount is 2 x 10 6 6mL. 48 h after transfection, digest the cells and distribute them into 20 10 cm culture dishes, and add 350 μg / ml g418 for screening culture.

[0092] 6、On the 10th day of cell culture, cell clones were formed in the culture dishes, and single clone cells were picked and cultured in a 48-well plate. After the cells grew, the cells were collected and the genome was extracted (genomic extraction kit: (Tiangen Biochemical Technology (Beijing) Co., Ltd.), DP304-03).

[0093] 7、The single clone genome edited for two exons of DYA2 was respectively subjected to PCR amplification with 2 pairs of amplification primers in Example 1, and the amplification products were sequenced (the sequencing results are shown inFigure 3 ), and the sequencing results were compared with the No. 1 or No. 2 exon of DYA to detect whether the sequence was edited. The PCR amplification procedure and system were the same as in Example 1.

[0094] After the above steps, 55 monoclonal cell strains were screened for No. 1 exon editing after vector transfection, and 42 positive clones with gene editing occurred after sequencing, with a positive rate of 76.4%, and the number of clones with editing on both sets of chromosomes (alleles) was 17, and the probability of double alleles with editing was 30.9%.

[0095] For No. 2 exon editing, 44 monoclonal cell strains were screened, and 37 positive clones with gene editing occurred after sequencing, with a positive rate of 84.1%, and the number of clones with editing on both sets of chromosomes (alleles) was 4, and the probability of double alleles with editing was 9.1%.

[0096] Comparative Example 1

[0097] According to the sequence of DYA exon 2 of Hu sheep in the sequencing results of Example 1, sg was designed, and the single-stranded oligonucleotide sequence was synthesized. The sequence is as follows (5'-3'):

[0098] The upstream sequence Exon2-sgRNA3-F is CACCGGGCCAGAGGCGCCGTACGTC, SEQ ID No. 15; and the downstream sequence Exon2-sgRNA3-R is AAACGACGTACGGCGCCTCTGGCCC, SEQ ID No. 16.

[0099] The underlined nucleotide sequence is the enzyme cutting site of Bbs I enzyme.

[0100] The underlined nucleotide sequence is the enzyme cutting site of Bbs I enzyme.

[0101] The synthesized sg oligonucleotide sequence was annealed to obtain the double-stranded sg sequence Exon2-sgRNA3, and the annealing procedure was 95°C, 5 min, 37°C, 10 min, and 4°C storage; the annealing system was: 2.5 μL of upstream sequence and 2.5 μL of downstream sequence, 1.0 μL of 10×PCR buffer, and ddH2O to 10 μL.

[0102] According to the method of Example 2, the double-stranded sg sequence Exon2-sgRNA3 was inserted into the px330-cas9 vector to obtain the recombinant vector pX330DYA-Exon2-sg3.

[0103] The recombinant vectors pX330DYA-Exon1-sg1 and pX330DYA-Exon1-sg2, pX330DYA-Exon2-sg1 and pX330DYA-Exon2-sg2 constructed in Example 2 were combined with pX330DYA-Exon2-sg3, and then the sheep fibroblasts were transfected according to the method described in step 4 of Example 2, and sheep fibroblasts without transfection of the recombinant vector were set as a control group, denoted as NC, and the cell genome was extracted after 48 h; wherein the combination for exon 1 is as follows: the combination of pX330DYA-Exon1-sg1 and pX330DYA-Exon1-sg2 is denoted as sg1+2; the combination for exon 2 is as follows: the combination of pX330DYA-Exon2-sg1 and pX330DYA-Exon2-sg2 is denoted as sg1+2, the combination of pX330DYA-Exon2-sg1 and pX330DYA-Exon2-sg3 is denoted as sg1+3, and the combination of pX330DYA-Exon2-sg2 and pX330DYA-Exon2-sg3 is denoted as sg2+3.

[0104] The cell genomes extracted after transfection of different combinations and the cell genome of the control group were subjected to PCR amplification with 2 pairs of amplification primers in Example 1, and the PCR amplification procedure and system were the same as in Example 1.

[0105] Subsequently, the PCR amplification products were recovered, and the specific recovery steps refer to the agarose gel recovery kit (Hunan Aikuo Biological Engineering Co., Ltd., product number: AG21004) for purification and recovery.

[0106] 1 μg of the recovered product was subjected to annealing, and the annealing procedure was annealing from 95℃ to 85℃ with a decrease of 2℃ per second, and annealing from 85℃ to 25℃ with a decrease of 0.3℃ per second. Subsequently, T7 exonuclease was added to 1 μg of the annealed product, and after incubation at 37℃ for 1 h, part of the enzyme digestion product was subjected to electrophoresis detection, and the results are shown in Figure 4 , wherein NC is sheep fibroblasts without transfection of any sgRNA.

[0107] It can be known from Figure 4 that the sgRNA designed in Example 2 has a good editing effect compared with the sgRNA of Comparative Example 1, which is verified by in vitro T7 exonuclease enzyme digestion.

[0108] In summary, the sgRNA group provided by the present application can edit the sheep DYA gene by using the CRISPR / Cas9 system, which has important significance in the study of ruminant evolution and related immune mechanisms.

[0109] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained based on the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. An sgRNA set targeting DYA a gene, characterized in that, the sgRNA group comprises Exon1-sgRNA or Exon2-sgRNA; the Exon1-sgRNA comprises Exon1-sgRNA1 and Exon1-sgRNA2; the Exon1-sgRNA1 comprises Exon1-sgRNA1-F and Exon1-sgRNA1-R; and the Exon1-sgRNA2 comprises Exon1-sgRNA2-F and Exon1-sgRNA2-R; the nucleotide sequence of the Exon1-sgRNA1-F is shown as SEQ ID No. 1, and the nucleotide sequence of the Exon1-sgRNA1-R is shown as SEQ ID No. 2; the nucleotide sequence of the Exon1-sgRNA2-F is shown as SEQ ID No. 3, and the nucleotide sequence of the Exon1-sgRNA2-R is shown as SEQ ID No. 4; the Exon2-sgRNA comprises Exon2-sgRNA1 and Exon2-sgRNA2, the Exon2-sgRNA1 comprises Exon2-sgRNA1-F and Exon2-sgRNA1-R; and the Exon2-sgRNA2 comprises Exon2-sgRNA2-F and Exon2-sgRNA2-R; the nucleotide sequence of the Exon2-sgRNA1-F is shown as SEQ ID No. 5, and the nucleotide sequence of the Exon2-sgRNA1-R is shown as SEQ ID No. 6; the nucleotide sequence of the Exon2-sgRNA2-F is shown as SEQ ID No. 7, and the nucleotide sequence of the Exon2-sgRNA2-R is shown as SEQ ID No.

8.

2. A plasmid set for knocking out DYA a gene, characterized in that, the plasmid group comprises Exon1-sgRNA plasmid group or Exon2-sgRNA plasmid group; the Exon1-sgRNA plasmid group comprises Exon1-sgRNA1 plasmid and Exon1-sgRNA2 plasmid; the Exon1-sgRNA1 plasmid comprises Exon1-sgRNA1 in the sgRNA group of claim 1 and px330 plasmid; and the Exon1-sgRNA2 plasmid comprises Exon1-sgRNA2 in the sgRNA group of claim 1 and px330 plasmid; the Exon2-sgRNA plasmid group comprises Exon2-sgRNA1 plasmid and Exon2-sgRNA2 plasmid; the Exon2-sgRNA1 plasmid comprises Exon2-sgRNA1 in the sgRNA group of claim 1 and px330 plasmid; and the Exon2-sgRNA2 plasmid comprises Exon2-sgRNA2 in the sgRNA group of claim 1 and px330 plasmid.

3. The set of plasmids according to claim 2, characterized in that, The px330 plasmid includes a px330 large fragment plasmid after Bbs Ⅰ enzyme.

4. Use of the set of sgRNAs of claim 1 or the set of plasmids of claim 2 or 3 for the preparation of a kit for editing a gene. DYA gene.

5. Use according to claim 4, characterized in that, The DYA gene includes the ovine DYA gene.

6. Use according to claim 5, characterized in that, the sheep comprises Hu sheep.

7. Use of the set of sgRNAs of claim 1 or the set of plasmids of claim 2 or 3 for the preparation of a kit for the identification of the function of a gene. DYA gene.

Images