Functional molecular marker of gene AhARF2 for regulating and controlling oil content of peanut seed kernel and application of functional molecular marker

Abstract

The invention belongs to the field of molecular biology, provides a functional molecular marker of a major gene AhARF2 for regulating and controlling the oil content of peanut seed kernels and application of the functional molecular marker, discloses a major site qSOCA08-3 for regulating and controlling the oil content of the peanut seed kernels, and explains phenotypic variation of 14.91%-17.31%. The qSOCA08-3 is finely positioned to a physical interval of 349.6 kb between the Tif2. A08.49681404 and the Tif2. A08.50031016, and a candidate gene of the qSOCA08-3 is confirmed to be AhARF2. The qSOCA08-3 has the advantages that the qSOCA08-3 can be used for identifying the The AhARF2 coding sequence shows 275bp deletion between parents Jianhua No.1 and W191 and is accompanied by 7bp replacement, so that the code shift mutation of the coding sequence is caused, and the protein translation is terminated in advance. According to the invention, the KASP molecular marker is developed on the basis of a mutant sequence, the association between the KASP molecular marker and the oil content of the seed kernel is successfully verified in a Yuhua 15 * ST001 recombinant inbred line population, and the important value of the marker in the marker-assisted selection breeding of the high oil content of the seed kernel of the peanut is verified.

Description

Technical Field

[0001] This invention relates to the functional molecular markers and applications of AhARF2, the major gene regulating the oil content of peanut kernels, and belongs to the field of molecular biology. Background Technology

[0002] Oilseed crops are an important source of edible oils and play a vital role in national food security. Peanut kernels have an oil content (SOC) of around 52%, generally higher than other oilseed crops such as soybeans and rapeseed. Elucidating the genetic patterns and molecular mechanisms of peanut kernel oil synthesis is currently a research hotspot. Currently reported genes regulating peanut kernel oil content are all based on preliminary quantitative trait loci (QTL) mapping or homologous cloning from model plants. Fine mapping and target gene cloning studies are lacking, resulting in a deficiency of functional molecular markers for kernel oil content breeding and hindering the development of molecular design breeding.

[0003] Competitive allele-specific PCR (KASP) is a high-throughput genotyping technique based on SNPs that can accurately genotype SNPs and InDel variants at the genomic level. It is currently widely used in agricultural and medical research. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a functional molecular marker for AhARF2, a gene that regulates the oil content of peanut kernels, and its application.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] The functional molecular marker for AhARF2, a gene regulating peanut kernel oil content, is located at the InDel site on peanut chromosome 8 at positions 50005046-50005320 bp. The sequence of the molecular marker is as follows:

[0007] GTGCAACTCCTAGCTGAGCTGCTTAGTGGTTTGGCCTGACCATTCTTAAGATGCACCTGGGAAGTTTTTGACGGTTTGTCATGGTCATCAACAATAACTT[ GACCATCTGCCGATTTCAAGCCCTTTGATTGTTCTGTTTTCTG ATCATTTTCAGAAGTGTGTTGGTGGTGTGATTTGAGATGTGCTTGACCAGCTGGCTCAGTCGTCCCACTTCTATGT GATACAGAAGGCTCCGGTGCAGCAGTAGGGCTACTGATAAGTGAGATGCCAAATAGCTTACAGTCACCTTCTTTTG GTTTCGCTGTCTCATATGTTTTCGCTGACATTGGTTTGGACATAAGGTCTCTTGAACAAGGACTCTCGTATTGAGT TGGG / TCCATGT]GGTGGTGGCAGCATCAACTTTCCATGTGGATGCTCAACTTTGTGACCAGGAATGACCGGATATTCACTGAATGGGCCGTACCTCAAATTCCCTCGAGCTT.

[0008] The KASP primer combination includes:

[0009] AhARF2-A08-X: 5'-TTGTCATGGTCATCAACAATAACTTG-3'

[0010] AhARF2-A08-C1: 5'-CATCTCAAATCACAACCACCAACA-3'

[0011] AhARF2-A08-Y:5'-TTGTCATGGTCATCAACAATAACTTT-3'

[0012] AhARF2-A08-C2: 5'-GTGAATATCCGGTCATTCCTGG-3'.

[0013] The application of the molecular marker in the identification of oil content in peanut kernels includes the following steps:

[0014] (1) Extract DNA from the peanut germplasm to be identified and perform genotyping analysis on the InDel site at 50005046-50005320 bp on chromosome 8 of the material to be identified using the SNPLine genotyping platform;

[0015] (2) In the natural or genetic population of peanut germplasm, if the genotype of the InDel locus is the mutant DEL:DEL, the kernel oil content of the peanut germplasm to be identified is significantly higher than that of the germplasm with the wild type WT:WT.

[0016] The application of the molecular marker method in molecular breeding to improve the oil content of peanut kernels.

[0017] The beneficial effects of this invention are:

[0018] This invention utilizes a recombinant inbred line population created by crossing the peanut variety Jihua Tian 1 (JHT1) with the high-generation line W191 to perform genetic mapping for the trait of kernel oil content. One major locus regulating peanut kernel oil content, qSOCA08-3, was detected, explaining 14.91%–17.31% of the phenotypic variation. Based on the genotypes of six heterozygous recombinant plants produced by self-pollination of the remaining heterozygous plants in the recombinant inbred line population, and the phenotypes of six nearly isogenic lines derived from them, qSOCA08-3 was finely mapped to a 349.6 kb physical region between the KASP markers Tif2.A08.49681404 and Tif2.A08.50031016 on chromosome 8. This region contains 18 predicted genes. Based on the functional annotations, sequence differences, expression patterns, and functions of homologous genes in other plants, Ah08g349400, which encodes the ARF2 transcription factor, is predicted to be the target gene of qSOCA08-3 and is named AhARF2.

[0019] The AhARF2 coding sequence exhibits a 275 bp deletion accompanied by a 7 bp substitution between the parents Jihua Tian 1 and W191, resulting in a frameshift mutation and premature termination of protein translation. Based on the mutant sequence, a KASP molecular marker was developed, and its association with kernel oil content was successfully verified in the Yuhua 15×ST001 recombinant inbred line population, confirming the important value of this marker in marker-assisted selection breeding for high kernel oil content peanuts. Specifically, this is demonstrated in the following aspects:

[0020] (1) This invention is the first to achieve fine localization and functional marker development of the major gene for oil content in peanut kernels, breaking through the limitations of previous methods that only reached preliminary QTL localization or homologous cloning.

[0021] (2) The present invention successfully cloned and verified the key gene AhARF2. The coding sequence of this gene has a 275bp deletion and a 7bp substitution between the parents, which leads to frameshift mutation and premature termination of protein translation, thus clarifying its functional variation mechanism.

[0022] (3) The molecular marker of the present invention has been verified to be effective in multiple genetic background populations. In the Yuhua 15×ST001 recombinant inbred line population, the seed oil content of the mutant homozygous line is 2.68% higher than that of the wild type, indicating that the marker has good universality and breeding application value. Attached Figure Description

[0023] Figure 1 Fine mapping of the major site qSOCA08-3 for peanut kernel oil content;

[0024] Figure 2 A diagram illustrating the AhARF2 gene sequence and expression pattern.

[0025] Figure 3 A schematic diagram of the functional marker of AhARF2 in the genotypic analysis of the Yuhua 15×ST001 recombinant inbred line population and its association with the oil content of kernels. Detailed Implementation

[0026] The specific embodiments of the present invention will be further described in detail below with reference to examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the experimental methods involved are all conventional methods.

[0027] Example 1: Obtaining the major effective site qSOCA08-3 for oil content in peanut kernels

[0028] (1) Phenotypic identification of peanut kernel oil content in recombinant inbred line population

[0029] A recombinant inbred line population comprising 554 F8 generations of peanut varieties, specifically the peanut cultivar Jihua Tian 1 (JHT1) and the high-generation line W191, was used as experimental material. Planting and phenotypic surveys were conducted in Xinxiang City, Henan Province; Weifang City, Shandong Province; and Tangshan City, Hebei Province in 2024. After ripening, the peanuts were naturally sun-dried. Approximately 20 mature, plump kernels free from pests and diseases were selected from each line, and their oil content was determined.

[0030] (2) Preliminary localization of the major site qSOCA08-3 for oil content in peanut kernels

[0031] Based on the phenotypic data of kernel oil content in recombinant inbred lines under three environments, 40 lines with extremely high oil content and 40 lines with extremely low oil content were selected to construct extreme mixed pools for whole-genome sequencing. After comparison with the reference genome, a total of 249,826 homozygous and polymorphic SNPs and InDel loci were identified among the parents. Four algorithms—Δ (SNP-index), G-statistic, Euclidean distance, and Fisher's exact test—were used to perform association analysis on the detected high-quality SNPs and InDel loci. A 99% confidence level was used as the screening threshold to obtain confidence intervals associated with kernel oil content traits.

[0032] The Δ (SNP-index) algorithm yielded one confidence interval on chromosome 8, located between 37.63 Mb and 51.53 Mb; the G-statistic algorithm yielded two confidence intervals on chromosome 8, located between 37.51 and 46.73 Mb and between 47.18 and 51.53 Mb, respectively; the Euclidean distance algorithm yielded one confidence interval on chromosome 8, located between 37.56 and 51.53 Mb; and Fisher's exact test yielded two confidence intervals on chromosome 8, located between 38.42 and 45.93 Mb and between 46.72 and 50.35 Mb, respectively.

[0033] Combining the results from four algorithms, the 37.51-51.53 Mb (14.02 Mb) region on chromosome 8 was ultimately identified as a potential QTL region. Molecular markers were designed based on homozygous polymorphic SNPs among parents within this region. Genotypic analysis was performed on the recombinant inbred line population, and linkage maps were constructed. Phenotypic data from three environments were used to locate the QTL for kernel oil content. The major-effect locus qSOCA08-3 for kernel oil content was located between markers Tif2.A08.49524078 and Tif2.A08.50540079, explaining 14.91%-17.31% of the phenotypic variation.

[0034] Example 2: Fine mapping and candidate gene analysis of qSOCA08-3, the major locus for oil content in peanut kernels.

[0035] (1) Phenotypic analysis of near-isogenic lines

[0036] To evaluate the genetic effects of qSOCA08-3 on peanut kernel oil content and other important agronomic traits, residual heterozygous plants (RHL_179) from the JW-RIL population were screened and self-crossed to the F8 generation. Homozygous plants within the selected range were then selected to construct the near-isogenic line NIL_179. Peanut 40K SNP microarray analysis revealed that lines NIL_179A and NIL_179B shared 99.98% genetic background identity. Phenotypic investigation showed that qSOCA08-3, in addition to regulating kernel oil content, also regulates traits such as pod length, pod width, pod area, and kernel length. Alternatively, within the residual heterozygous range of RHL_179, in addition to genes regulating kernel oil content, genes regulating pod length, pod width, pod area, and kernel length also existed.

[0037] (2) Fine mapping and candidate gene analysis of qSOCA08-3, the major site of oil content in kernel seeds.

[0038] To precisely locate qSOCA08-3, RHL_179 plants were self-crossed to the F8 generation. Using 12 KASP markers, six heterozygous recombinant plants were screened within the remaining heterozygous region. Self-crossing was continued to the F9 generation, and homozygous non-recombinant plants within the region were screened to construct six near-isogenic lines. In the F9 near-isogenic lines of RHL_179_4 and RHL_179_13, the kernel oil content of plants with the same genotype as JHT1 and those with the same genotype as W191 differed significantly, indicating that the target gene of qSOCA08-3 is located between markers Tif2.A08.49213883 and Tif2.A08.50031016. In the F9 near-isogenic lines of RHL_179_5 and RHL_179_9, the kernel oil content of plants with the same genotype as JHT1 and those with the same genotype as W191 differed significantly. The difference in oil content was not significant, indicating that the target gene of qSOCA08-3 is located between markers Tif2.A08.49213883 and Tif2.A08.50031016. In the F9 near-isogenic lines of RHL_179_32 and RHL_179_35, the difference in kernel oil content between individual plants with the same genotype as JHT1 and individual plants with the same genotype as W191 in the remaining heterozygous interval was significant, indicating that the target gene of qSOCA08-3 is located between markers Tif2.A08.49681404 and Tif2.A08.51251235.

[0039] In summary, based on the genotypes of the six heterozygous recombinant single plants and the phenotypes of the six nearly isogenic lines derived from them, qSOCA08-3 was narrowed down to a 349.6 kb physical interval between markers Tif2.A08.49681404 and Tif2.A08.50031016. Figure 1 A). According to the annotations of the peanut tetraploid cultivar reference genome version Arahy.Tifrunner.gnm2.ann2.PVFB, 18 predicted genes are contained within a 349.6 kb physical region ( Figure 1 B).

[0040] To identify potential candidate genes, whole-genome sequencing data from parental JHT1 and W191 were used to compare the sequence differences in gene regions and promoters (2000 bp upstream of the transcription start site) of 18 candidate genes within the fine-mapping region. Among the 18 predicted genes, five genes (Ah08g347300, Ah08g348900, Ah08g349000, Ah08g349400, and Ah08g349500) showed insertion / deletion sequence differences in their promoter regions; two genes (Ah08g347700 and Ah08g348200) showed SNP sequence differences in their promoter regions; and Ah08g348700 showed differences in its encoding... The presence of SNPs in the coding region leads to missense mutations; the coding region of Ah08g349400 has insertion / deletion sequence differences leading to premature termination; the intron regions of two genes, Ah08g347200 and Ah08g348500, have SNP sequence differences; the intron regions of three genes, Ah08g347200, Ah08g347700, and Ah08g348100, have insertion / deletion sequence differences. Expression pattern analysis revealed that Ah08g347200 and Ah08g348700 were highly expressed in the seed coat and early embryo development; Ah08g347300, Ah08g347500, Ah08g347700, Ah08g347900, Ah08g348000, Ah08g348100, Ah08g348200, and Ah08g348 were also highly expressed. Twelve genes, including 400, Ah08g348500, Ah08g348600, Ah08g348900, Ah08g349400, and Ah08g349500, showed low expression levels in all tissues; Ah08g349100 showed high expression levels in all tissues; and Ah08g349200 showed high expression levels in leaves, inflorescences, early seed coat development, and early embryo development. Based on the functional annotations, sequence differences, expression patterns, and functions of homologous genes in other plants, the transcription factor Ah08g349400, encoding the Auxin response factor 2 (ARF2), was predicted to be the target gene of the major effect site qSOCA08-3 for kernel oil content and was named AhARF2 (Arachis hypogaea Auxin response factor 2).

[0041] Figure 1Fine mapping of qSOCA08-3, the major locus for peanut kernel oil content, was performed. A: Based on the genotypes of F8 heterozygous recombinant single plants of RHL_179 and the phenotypes of their derived F9 near-isogenic lines, qSOCA08-3 was mapped to a 349.6 kb physical interval between Tif2.A08.49681404 and Tif2.A08.50031016. B: The 349.6 kb physical interval contains 18 predicted genes.

[0042] (3) Analysis of AhARF2 gene sequence and expression pattern

[0043] The AhARF2 gene contains 14 exons and 13 introns. Sequence analysis showed that, compared with the parent JHT1, the W191 AhARF2 promoter region had a 1 bp insertion (Arahy.Tifrunner.gnm2.Arahy.08: 49999753); the W191 AhARF2 exon 12 region had a 275 bp deletion (Arahy.Tifrunner.gnm2.Arahy.08:50005046..50005320) accompanied by a 7 bp substitution, resulting in a frameshift mutation in the coding sequence and premature termination of protein translation. Figure 2 A).

[0044] PCR amplification and Sanger sequencing confirmed the insertion / deletion polymorphism of the AhARF2 coding sequence between the parents. Figure 2 B).

[0045] Peanut seeds were collected at 35, 45, 55, 65, and 75 days after flowering (DAF) and separated into seed coat and embryo. Total RNA was extracted and reverse transcribed to obtain cDNA. The transcription level of AhARF2 in the seed coat and embryo at the five developmental stages was analyzed by real-time quantitative reverse transcription PCR. Figure 2 C).

[0046] The reaction system consisted of 20 µl: 1 µl cDNA, 10 µl ChamQ Universal SYBR qPCR Master Mix, 0.5 µl each of forward and reverse primers (10 µmol / L), and 8 µl RNase-free ddH2O. The reaction was pre-denatured at 95 °C for 30 s; denatured at 95 °C for 10 s, annealed at 60 °C for 30 s, for 40 cycles; followed by denaturation at 95 °C for 15 s, annealing at 60 °C for 60 s, and denaturation at 95 °C for 15 s, and melting curves were collected.

[0047] Peanut AhADH3 was used as an internal reference gene. Primers for AhADH3-F were AhADH3-F: 5'-GACGCTTGGCGAGATCAACA-3' (SEQ ID NO.2) and AhADH3-R: 5'-AACCGGACAACCACCACATG-3' (SEQ ID NO.3). Real-time quantitative reverse transcription PCR primers for AhARF2 were AhARF2-F: 5'-GCATCATCCTTGGCCAGCA-3' (SEQ ID NO.4) and AhARF2-R: 5'-GTGGATGCTCAACTTTGTGACC-3' (SEQ ID NO.5). 2 ΔCT The method calculates the relative gene expression levels and performs a significance analysis of the differences.

[0048] During the seed kernel development stage, AhARF2 was highly expressed in both the seed coat and the embryo. The highest expression level of AhARF2 was reached in the seed coat 75 days after flowering and in the embryo 55 days after flowering. It is speculated that AhARF2 plays an important role in both the seed coat and embryo development process.

[0049] Figure 2 The analysis included AhARF2 gene sequence and expression pattern, where A: a 275bp deletion and 7bp substitution in the AhARF2 coding sequence between the parents; B: PCR amplification results of the AhARF2 coding sequences from both parents; and C: transcriptional levels of AhARF2 in seed coats and embryos collected at 35, 45, 55, 65, and 75 days after flowering, as determined by real-time quantitative reverse transcription PCR.

[0050] Example 3: Development and Validation of AhARF2 Functional Molecular Markers

[0051] (1) Development of functional molecular markers for AhARF2

[0052] The AhARF2 coding sequence exhibits a 275 bp deletion accompanied by a 7 bp substitution between parents. This InDel site is located at 50005046-50005320 bp on peanut chromosome 8. The sequence preceding and following this site, within 100 bp, is SEQ ID NO.1.

[0053] GTGCAACTCCTAGCTGAGCTGCTTAGTGGTTTGGCCTGACCATTCTTAAGATGCACCTGGGAAGTTTTTGACGGTTTGTCATGGTCATCAACAATAACTT[ GACCATCTGCCGATTTCAAGCCCTTTGATTGTTCTGTTTTCTG ATCATTTTCAGAAGTGTGTTGGTGGTGTGATTTGAGATGTGCTTGACCAGCTGGCTCAGTCGTCCCACTTCTATGT GATACAGAAGGCTCCGGTGCAGCAGTAGGGCTACTGATAAGTGAGATGCCAAATAGCTTACAGTCACCTTCTTTTG GTTTCGCTGTCTCATATGTTTTCGCTGACATTGGTTTGGACATAAGGTCTCTTGAACAAGGACTCTCGTATTGAGT TGGG / TCCATGT ]GGTGGTGGCAGCATCAACTTTCCATGTGGATGCTCAACTTTGTGACCAGGAATGACCGGATATTCACTGAATGGGCCGTACCTCAAATTCCCTCGAGCTT;

[0054] KASP markers were designed based on the InDel site between the parents, including four primer sequences:

[0055] AhARF2-A08-X: 5'-TTGTCATGGTCATCAACAATAACTTG-3' (SEQ ID NO. 6);

[0056] AhARF2-A08-C1: 5'-CATCTCAAATCACAACCACCAACA-3' (SEQ ID NO. 7);

[0057] AhARF2-A08-Y: 5'-TTGTCATGGTCATCAACAATAACTTT-3' (SEQ ID NO. 8);

[0058] AhARF2-A08-C2: 5'-GTGAATATCCGGTCATTCCTGG-3' (SEQ ID NO. 9).

[0059] KASP primer mixing solution: Prepare stock solutions of each of the four primers at a concentration of 100 μmol / L. The KASP primer mixing solution is prepared in the following ratio: X:C1:Y:C2:water = 60 μL:75 μL:60 μL:75 μL:230 μL.

[0060] The PCR reaction system consisted of 1 μL: 1 μL genomic DNA (~10 ng / μL). After drying, 1 μL of a mixture of 1×Master Mix and KASP primers was added. The primer volume was approximately 1.4% of the total reaction system.

[0061] PCR amplification program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ extension for 1 min, 26 cycles; store at 10℃.

[0062] (2) Verification of the functional molecular marker AhARF2 in the population of Yuhua 15×ST001 peanut recombinant inbred line

[0063] DNA was extracted from each line in the Yuhua 15×ST001 peanut recombinant inbred line population. Using AhARF2 functional markers, genotyping was performed on the InDel locus at 50005046-50005320 bp on chromosome 8 of each line via the SNPLine platform. Figure 3 A).

[0064] Of the 226 lines, 102 lines had the AhARF2 functional marker genotype WT:WT, with an average kernel oil content of 53.06%; 109 lines had the AhARF2 functional marker genotype DEL:DEL, with an average kernel oil content of 54.48%. Compared to the WT:WT genotype lines, the DEL:DEL genotype lines had a significantly higher kernel oil content of 2.68%. Figure 3 B).

[0065] Figure 3 A is a schematic diagram illustrating the genotypic analysis of the Yuhua 15×ST001 peanut recombinant inbred line population using the functional molecular marker AhARF2. Figure 3 B represents the functional molecular marker of AhARF2 and its association with the genotype and kernel oil content of the Yuhua 15×ST001 peanut recombinant inbred line population.

Claims

1. A functional molecular marker for AhARF2, a gene regulating the oil content of peanut kernels, characterized in that, The molecular marker is located at the InDel site at 50005046-50005320 bp on peanut chromosome 8, and the sequence of the molecular marker is as follows: GTGCAACTCCTAGCTGAGCTGCTTAGTGGTTTGGCCTGACCATCTTTAAGATGCACCTGGGAAGTTTTTGACGGTTTGTCATGGTCATCAACAATAACTT[ GACCATCTGCCGATTTCAAGCCCTTTGATTGTTCTGTTTTCTGATCA TTTTCAGAAGTGTGTGGTGGTGTGATTTGAGATGTGCTTGACCAGCTGGCTCAGTCGTCCCACTTCTATGTGATA CAGAAGGCTCCGGTGCAGCAGTAGGGCTACTGATAAGTGAGATGCCAAATAGCTTACAGTCACCTTCTTTTGGTTT CGCTGTCTCATATGTTTTCGCTGACATTGGTTTGGACATAAGGTCTCTTGAACAAGGACTCTCGTATTGAGTTGGG / TCCATGT ]GGTGGTGGCAGCATCAACTTTCCATGTGGATGCTCAACTTTGTGACCAGGAATGACCGGATATTCACTGAATGGGCCGTACCTCAAATTCCCTCGAGCTT。 2. A KASP primer combination for amplifying the said molecular marker site, characterized in that, The KASP primer combination includes: AhARF2-A08-X: 5'-TTGTCATGGTCATCAACAATAACTTG-3' AhARF2-A08-C1:5'-CATCTCAAATCACAACCACCAACA-3' AhARF2-A08-Y:5'-TTGTCATGGTCATCAACAATAACTTT-3' AhARF2-A08-C2: 5'-GTGAATATCCGGTCATTCCTGG-3'.

3. The application of the molecular marker as described in claim 1 in the identification of oil content in peanut kernels, characterized in that, Includes the following steps: (1) Extract DNA from the peanut germplasm to be identified and perform genotyping analysis on the InDel site at 50005046-50005320 bp on chromosome 8 of the material to be identified using the SNPLine genotyping platform; (2) In the natural or genetic population of peanut germplasm, if the genotype of the InDel locus is the mutant DEL:DEL, the kernel oil content of the peanut germplasm to be identified is significantly higher than that of the germplasm with the wild type WT:WT.

4. The application of the molecular marker method as described in claim 1 in molecular breeding for improving the oil content of peanut kernels.

Images