A recombinant Escherichia coli for efficiently expressing gmd and wcaG and a construction method thereof

Abstract

The present invention relates to a method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG. The method uses Escherichia coli as a starting strain, knocks out its metabolic genes wcaA, wcaB, wcaC, wcaD, wcaE and wcaF for biosynthesis of colanic acid, and knocks in an expression control component of a gmd-wcaG gene before a gmd gene to obtain a recombinant Escherichia coli that efficiently expresses gmd and wcaG; the regulatory component of the gmd-wcaG gene includes a promoter and a ribosome binding site. The starting strain is an Escherichia coli carrying a gmd-wcaG gene. The present invention is applicable to all Escherichia coli having a gmd-wcaG gene, and there are many options for background strains. Compared with unmodified Escherichia coli, the strain gmd-wcaG gene expression of the present invention is stronger, and because it is a genome modification, it is more stable than the existing plasmid optimization expression.

Description

Technical Field

[0001] The invention relates to a recombinant Escherichia coli capable of efficiently expressing gmd and wcaG and a construction method thereof, belonging to the technical field of genetic engineering. Background Art

[0002] Escherichia coli is the most important and most numerous bacterium in the intestines of humans and many animals, and is also one of the most studied and applied strains. Escherichia coli has flagella all over its body, can move, and can ferment a variety of carbon sources to produce acid and gas. It is a normal resident bacterium in the intestines of humans and animals. Its metabolic activities can inhibit the growth of harmful microorganisms in the intestines, and can also synthesize vitamin B, vitamin K and colicin, which has bactericidal effects. Escherichia coli has a clear genetic background, relatively clear gene functions, and mature editing technology to modify its genome; in addition, Escherichia coli is easy to culture, and has relatively low environmental requirements during experimental and industrial fermentation processes, which can save a lot of production costs. Therefore, Escherichia coli has great advantages in gene expression and biosynthesis.

[0003] The E. coli genome contains the gmd gene encoding GDP-glucose-6-dehydrogenase and the wcaG gene (fcl gene) encoding GDP-fucose synthase, both of which play an important role in E. coli biosynthesis. Among them, gmd encodes GDP-glucose-6-dehydrogenase, which can convert GDP-mannose into GDP-4-dehydrogenated-6-deoxy-mannose; wcaG is located next to gmd in the genome, and the GDP-L-fucose synthase it encodes can convert GDP-4-dehydrogenated-6-deoxy-mannose into GDP-L-fucose, which is an intermediate product for the synthesis of many important substances of HMOs. The gmd and wcaG genes are located in the E. coli colanic acid synthesis gene cluster, which are used to synthesize bacterial cell wall components and can also be used to synthesize fucose. At the same time, studies have also shown that the gmd and wcaG genes can be used for the synthesis of HMO series. Therefore, it is of great significance to strengthen the expression of gmd and wcaG genes.

[0004] In the prior art, most of the methods for enhancing the expression of gmd-wcaG require the use of plasmids, that is, first integrating the gmd-wcaG gene into the expression plasmid of Escherichia coli, and then inducing the target gene to participate in anabolism. However, there are the following shortcomings:

[0005] 1. Integrating the gmd-wcaG gene into the expression plasmid will increase the strain construction cost and waste E. coli genome resources;

[0006] 2. In some synthetic pathways using the gmd-wcaG gene, it is necessary to block the synthesis of colanic acid by E. coli and knock out the undecenyl glucose phosphate phosphotransferase gene wcaj. However, the continuous expression of wcaA, wcaB, wcaC, wcaD, wcaE and wcaF upstream of wcaJ will cause a waste of E. coli resources in biosynthesis. At the same time, the continuous accumulation of metabolites of these genes in E. coli cells will burden the bacteria and be detrimental to the growth of E. coli.

[0007] 3. At present, it is often difficult to control the expression efficiency of the target gene when using the E. coli genome to express gmd and wcaG genes. Too high expression efficiency will lead to overexpression of gmd-wcaG, resulting in waste of cell resources and growth pressure; too low expression efficiency will lead to low product synthesis efficiency and insufficient substrate utilization; therefore, for different strains and metabolic pathways, it is necessary to artificially control the gene expression intensity to optimize biosynthesis;

[0008] 4. Plasmid expression often relies on antibiotics to maintain the stability of the plasmid in E. coli cells. The use of antibiotics will increase the culture cost on the one hand, and on the other hand, it will bring additional steps to the purification and quality control of the synthetic product. Summary of the invention

[0009] The purpose of the present invention is to solve the deficiencies of the above-mentioned background technology and provide a recombinant Escherichia coli that efficiently expresses gmd and wcaG and a construction method thereof. The gmd-wcaG gene in the Escherichia coli genome can be fully utilized to stably express it according to the intensity requirements of different metabolic pathways, and it is suitable for different Escherichia coli transformations, which increases the options for background strains and reduces the cost of constructing strains.

[0010] Technical Solution

[0011] In the E. coli genome, wcaA, wcaB, wcaC, wcaD, wcaE and wcaF are metabolic genes for the biosynthesis of colanic acid, which are unfavorable metabolisms in some biological metabolisms such as the 2-FL synthesis pathway. Therefore, the inventors chose to delete them from the genome to reduce unnecessary expression; in addition, since wcaA, wcaB, wcaC, wcaD, wcaE and wcaF are adjacent to the upstream of the gmd-wcaG gene (5'-3'), the inventors knocked in the expression regulatory components of the gmd-wcaG gene while knocking out wcaA, wcaB, wcaC, wcaD, wcaE and wcaF to optimize the E. coli genome; one of the regulatory components of the gmd-wcaG gene is the promoter. In addition, after genetic modification, the expression of gmd-wcaG should not be too strong or too weak, otherwise it will affect cell growth or substrate utilization. Therefore, the inventors use RBS of different strengths to regulate it. The specific scheme is as follows:

[0012] A method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG: using Escherichia coli as a starting strain, knocking out its metabolic genes wcaA, wcaB, wcaC, wcaD, wcaE and wcaF for biosynthesis of colanic acid, and knocking in the expression regulatory component of the gmd-wcaG gene before the gmd gene to obtain a recombinant Escherichia coli that efficiently expresses gmd and wcaG;

[0013] The expression regulatory components of the gmd-wcaG gene include a promoter and a ribosome binding site.

[0014] The starting strain is Escherichia coli carrying gmd-wcaG, for example, Escherichia coli BL21 series, JM109 series, K12 or MG1655, more preferably Escherichia coli JM109 (DE3) and BL21 (DE3).

[0015] Furthermore, the promoter is selected from T7, tac, J23119 or lacI promoter.

[0016] Furthermore, the ribosome binding site is selected from BBa_B0034, BBa_B0030, BBa_B0032 or BBa_BJ61101, and the coding sequences are shown in SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, and SEQ ID No: 4, respectively.

[0017] The recombinant Escherichia coli was obtained by the above construction method.

[0018] The recombinant Escherichia coli obtained by the above construction method is used for fermentation production of GDP-L-fucose.

[0019] Beneficial effects of the present invention:

[0020] (1) Compared with unmodified Escherichia coli, the strain constructed in the present invention has stronger expression of the gmd-wcaG gene, and due to the genome modification, the expression is more stable than the existing plasmid optimization.

[0021] (2) The components for optimizing the expression of gmd-wcaG of the present invention can use inducible or non-inducible promoters, which can be selected according to different metabolic pathways. The use of non-inducible promoters can eliminate the need for inducers during the expression of gmd-wcaG, thereby reducing the cost of product fermentation and purification; the use of inducible promoters can make the expression of gmd-wcaG more controllable.

[0022] (3) The gmd-wcaG regulatory component can use RBS sequences of different strengths. The corresponding RBS sequence is selected according to the expression intensity required by the position of gmd-wcaG in the metabolic pathway to prevent excessive or weak expression of gmd-wcaG from affecting the pathway efficiency.

[0023] (4) The present invention can be applied to any Escherichia coli having the gmd-wcaG gene, such as Escherichia coli BL21 series, JM109 series, K12 or MG1655, etc., and there are many options for background strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The plasmid map of the pTargetTB plasmid containing the target gene fragment constructed in Example 1;

[0025] Figure 2 Schematic diagram of the gene structure of the strain BLD-1 constructed in Example 1 and the BL21 (DE3) strain before optimization;

[0026] Figure 3 The plasmid map of the pTargetTJ plasmid containing the target gene fragment constructed in Example 2;

[0027] Figure 4 Schematic diagram of the gene structure of strain JMD-1 constructed in Example 2 and strain JM109 (DE3) before optimization. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0029] In the following examples, the experimental materials used: BL21 (DE3) strain and JM109 (DE3) strain were purchased from Shanghai Weidi Biotechnology Co., Ltd.; kanamycin sulfate and spectinomycin hydrochloride pentahydrate were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; arabinose and isopropyl-β-D-thiogalactoside (IPTG) were purchased from Shanghai MacLean Biochemical Technology Co., Ltd.; LB medium, agar, and agarose were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; pTargetF and pCas plasmids were purchased from Biofeng (www.biofeng.com); 2×Phanta MaxMasterMix and 2×RapidTaqMasterMix were purchased from Nanjing Novozymes Biotech Co., Ltd. However, they are not limited thereto.

[0030] The experimental methods without specific conditions in the examples are usually carried out according to conventional conditions in the art or according to the conditions recommended by the equipment and reagent manufacturers.

[0031] Example 1: Transformation of the inducible promoter gmd-wcaG in the BL21 (DE3) genome

[0032] A method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG comprises the following steps:

[0033] (1) Construction of gRNA plasmid:

[0034] According to the E. coli BL21 genome sequence information, the replaced N20 sequence (tctcaatctatatgccgacc, taaaacgcttccggcaaatg) was determined and primers were designed. The pTargetF plasmid was used as a template, and the linear plasmid was obtained by PCR amplification. After connection with Gibson Assembly Master Mix, DH5a competent cells were transformed, and LB solid plates containing 50 μg / ml spectinomycin were coated and cultured in a 37°C incubator overnight. The next day, single clones were selected for sequencing verification. The plasmid that successfully replaced the N20 sequence was the positive clone. The positive clone was selected for shake culture and plasmid extraction to obtain pTargetF1 and pTargetF2 plasmids;

[0035] The relevant primers and sequences designed for constructing the pTargetF plasmid are shown in Table 1:

[0036] Table 1 Relevant primers designed for constructing pTargetF plasmid

[0037]

[0038] (2) Construction of pTargetT plasmid containing target gene fragment:

[0039] ① Amplify the constructed pTargetF1 and pTargetF2 plasmids respectively to obtain linear plasmids and N20-2-gRNA fragments; the primers required for amplifying plasmid fragments are shown in Table 2:

[0040] Table 2 Primers required for amplification of plasmid fragments

[0041]

[0042]

[0043] ② Referring to the genome sequence of E. coli BL21, 1000 bp of homologous templates HL (sequence as shown in SEQ ID No: 5) and HR (sequence as shown in SEQ ID No: 6) were designed, and primers for amplifying the homologous templates were designed, and PCR amplification was performed to obtain homologous sequence fragments. The primers required for amplifying the homologous templates are shown in Table 3:

[0044] Table 3 Primers required for amplifying homologous templates

[0045]

[0046] ③ Using pET28a(+) plasmid as template, perform PCR amplification to obtain T7 promoter and its components; the primers required for PCR amplification are shown in Table 4:

[0047] Table 4 Primers required for amplifying gene expression regulatory components

[0048]

[0049] ④ After obtaining the above fragments, transform DH5a competent cells after ligation with Gibson Assembly Master Mix, and then spread on LB solid plates containing 50μg / ml spectinomycin and culture in a 37℃ incubator overnight, and then identify by colony PCR. The primers required for PCR identification are shown in Table 5:

[0050] Table 5 Primers required for PCR identification

[0051]

[0052] ⑤ After selecting the positive single clone, verify it through sequencing to obtain the pTargetTB plasmid containing the target gene fragment. See the plasmid map for details. Figure 1 .

[0053] (3) Editing the E. coli genome:

[0054] The pCas plasmid was transferred into BL21 (DE3) competent cells, and the cells were coated with LB solid plates containing 50 μg / ml kanamycin and cultured overnight at 30°C. Single clones were selected the next day, cultured at 30°C in LB medium containing 50 μg / ml kanamycin, and then transferred at a ratio of 1:100. Arabinose (10 mM) was used for induction culture for 4 hours, and then electroporated competent cells were prepared and pTargetTB plasmid was introduced. The electroporated strains were coated with LB solid plates containing 50 μg / ml kanamycin and 50 μg / ml spectinomycin, cultured overnight at 30°C, and single clones were selected for PCR identification the next day. The primers required for PCR identification are shown in Table 6:

[0055] Table 6 Primers required for PCR identification

[0056]

[0057] (4) Obtaining the target strain:

[0058] After successful identification in step (3), a single clone was selected and inoculated onto a LB solid plate containing 50 μg / ml kanamycin, and IPTG (0.2 mM) was used for induction and overnight culture, followed by streaking. The elimination of the pTargetTB plasmid was identified by PCR. The primers for PCR identification are shown in Table 7:

[0059] Table 7 Primers required for PCR identification

[0060]

[0061] The single clones that have eliminated the pTargetTB plasmid were selected and inoculated in an antibiotic-free medium at 42°C overnight, then streaked onto antibiotic-free plates, and the elimination of the pCas plasmid was identified by PCR. After successful identification, the BL21 (DE3) genome-modified strain BLD-1 was obtained. The schematic diagram of the gene structure of strain BLD-1 and the BL21 (DE3) strain before optimization is shown in Figure 2 The primers required for PCR identification of pCas plasmid elimination are shown in Table 8:

[0062] Table 8 Primers required for PCR identification

[0063]

[0064] Example 2: Transformation of the self-promoting gmd-wcaG in the genome of the JM109 (DE3) strain

[0065] A method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG comprises the following steps:

[0066] (1) Construction of gRNA plasmid:

[0067] According to the E. coli K12 genome sequence information, the replaced N20 sequence (tctcaatctatatgccgacc, taaatcgcttccggcaaatg) was determined and primers were designed. The pTargetF plasmid was used as a template, and the linear plasmid was obtained by PCR amplification. After connection with Gibson Assembly Master Mix, DH5a competent cells were transformed and coated with LB solid plates containing 50 μg / ml spectinomycin. The plates were cultured in a 37°C incubator overnight. The next day, single clones were selected for sequencing verification. The plasmid that successfully replaced the N20 sequence was the positive clone. The positive clone was selected for shaking culture and plasmid extraction to obtain pTargetF1 and pTargetF3 plasmids. The relevant primers and sequences designed for constructing the pTargetF plasmid are shown in Table 9:

[0068] Table 9 Primers related to constructing pTargetF plasmid

[0069]

[0070] (2) Construction of pTargetT plasmid containing target gene fragment:

[0071] ① Amplify the constructed pTargetF1 and pTargetF3 plasmids respectively to obtain linear plasmids and N20-3-gRNA fragments; the primers required for amplifying plasmid fragments are shown in Table 10:

[0072] Table 10 Primers required for amplifying plasmid fragments

[0073]

[0074] ② Based on the E. coli K12 genome sequence, 1000 bp homologous templates HL2 (sequence as shown in SEQ ID No: 7) and HR2 (sequence as shown in SEQ ID No: 8) were designed, and primers required for amplifying the homologous templates were designed, and PCR amplification was performed to obtain homologous sequence fragments. The primers required for amplifying the homologous templates are shown in Table 11:

[0075] Table 11 Primers required for amplifying homologous templates

[0076]

[0077]

[0078] ③ After obtaining the above fragments, transform DH5a competent cells after ligation with Gibson Assembly Master Mix, and culture in a 37°C incubator overnight on a LB solid plate containing 50 μg / ml spectinomycin, and then identify by colony PCR. The primers required for PCR identification are shown in Table 12:

[0079] Table 12 Primers required for PCR identification

[0080]

[0081] ④ After selecting the positive single clone, verify it through sequencing to obtain the pTargetTJ plasmid containing the target gene fragment. See the plasmid map for details. Figure 3 .

[0082] (3) Editing the E. coli genome:

[0083] The pCas plasmid was transferred into JM109 (DE3) competent cells, and the cells were coated with LB solid plates containing 50 μg / ml kanamycin and cultured overnight at 30°C. The next day, single clones were selected and cultured at 30°C in LB containing 50 μg / ml kanamycin, and then transferred at a ratio of 1:100. Arabinose (10 mM) was used for induction culture for 4 hours, and then electroporated competent cells were prepared and pTargetTJ plasmid was introduced. The electroporated strains were coated with LB solid plates containing 50 μg / ml kanamycin and 50 μg / ml spectinomycin, and cultured overnight at 30°C. The next day, single clones were selected for PCR identification. The primers required for PCR identification are shown in Table 13:

[0084] Table 13 Primers required for PCR identification

[0085]

[0086] (4) Obtaining the target strain:

[0087] After successful identification in step (3), a single clone was selected and inoculated into LB medium containing 50 μg / ml kanamycin, and IPTG (0.2 mM) was used for induction and overnight culture, followed by streaking. The elimination of the pTargetTJ plasmid was identified by PCR. The primers for PCR identification are shown in Table 14:

[0088] Table 14 Primers required for PCR identification

[0089]

[0090] Single clones with the pTargetTJ plasmid eliminated were selected, inoculated into antibiotic-free medium and cultured overnight at 42°C, then streaked onto antibiotic-free plates, and the elimination of the pCas plasmid was identified by PCR. After successful identification, the JM109 (DE3) genome-modified strain JMD-1 was obtained. Figure 4 Schematic diagram of the genetic structure of strain JMD-1 and strain JM109 (DE3) before optimization.

[0091] Table 15 Primers required for PCR identification of pCas plasmid elimination

[0092]

[0093] Application testing:

[0094] As a metabolite of gmd-wcaG, GDP-L-fucose is an intermediate product for the synthesis of many important substances of HMOs. In order to verify whether the genetically modified strains JMD-1 and BLD-1 of the embodiments of the present invention can increase the GDP-L-fucose production, JMD-1 and BLD-1 were used as background strains, respectively, and the pET28a(+) plasmid containing manA, manB, and manC gene clusters was additionally constructed to construct a GDP-L-fucose production strain (Modulation of guanosine 50-diphosphate-D-mannose metabolism in recombinant Escherichia coli for production of guanosine 50-diphosphate-L-fucose), JM109 (DE3) and BL21 (DE3) were used as background strains for the transfer of the same plasmid as a reference, and the GDP-L-fucose production strain was constructed and used for fermentation to produce GDP-L-fucose. The fermentation conditions were the same, and a 5L small fermenter was used for testing. pH-related feeding was used, the concentration of the inducer IPTG was 0.2mM, and the fermentation time was 65 hours. After the fermentation, the fermentation broth was taken, centrifuged at 3000×g until the bacteria were completely precipitated, and the supernatant was discarded. 10g of cell precipitate was weighed, and the bacteria were broken using a cell disruptor to obtain a cell lysate. The supernatant was centrifuged at 12000×g for 10min, and the supernatant was filtered through a 0.22μm filter membrane for sterilization. The supernatant was analyzed using a 1260Infinity II (Agilent Technologies) and an Inertsil ODS-SP column with an ultraviolet wavelength of 254nm and a flow rate of 0.6mL / min. The gradient elution process is: first elution with 100% (v / v) mobile phase A for 10 minutes; then elution with mobile phase B at a gradient change of 0%-50% (v / v) for 10 minutes; mobile phase B is then eluted with a gradient change of 50%-0% (v / v) for 5 minutes; finally, elution with 100% (v / v) mobile phase A for 25 minutes. The intracellular GDP-L-fucose concentration was calculated by high performance liquid chromatography. The test results are shown in Table 16:

[0095] Table 16

[0096]

[0097]

[0098] It can be seen from the test results in Table 16 that the genome optimization method of this scheme can effectively improve the expression efficiency of gmd and wcaG genes and increase the GDP-L-fucose production.

[0099] Sequence Listing:

[0100] SEQ ID No: 1

[0101] BBa_B0034

[0102] tctagagaaagaggagaaatactag

[0103] SEQ ID No: 2

[0104] BBa_B0030

[0105] tctagagattaaagaggagaaatactag

[0106] SEQ ID No: 3

[0107] BBa_B0032

[0108] tctagagtcacacaggaaagtactag

[0109] SEQ ID No: 4

[0110] BBa_BJ61101

[0111] tctagagaaagacaggacccactag

[0112] SEQ ID No: 5

[0113] Homologous template HL

[0114] tgctaaaaccgaagaaagggctgattatccttggggcgattattcttggcctgatgctctctatcgtgggtgtgctgctgcgctcgttgtttaatcgcggcatcgaaagcccgcaggtgctggaagaacacggtatcagcgtctatgccagcatcccgttgtcggaatggcagaaagcgcgcgatagcgtcaaaaccatcaaagggattaaacgctataaacagagccagctactggcggtggggaatccaaccgatctggcgattgaagccatccgcagtctgcgtaccagcctgcacttcgcgatgatgcaggcgcagaacaatgtgttgatgatgaccggggttagcccgtcaatcggtaaaacctttgtctgcgccaacctggcggcggtgatcagccagaccaataaacgcgtgttgttgatcgactgcgatatgcgcaaaggctacacccacgagctgttgggcaccaataacgtcaatggcctgtcggaaattctgattggtcagggcgatattactaccgcagctaaatcgacctctattgccaaatttgacctgatcccgcgcggtcaggtgccgccaaatccttctgaactgttgatgagcgaacgctttgccgaactggtgaactgggcgagtaaaaactatgacctggtgttgattgatacgccgccgattctggcagtgaccgatgcggcaattgttggtcgtcatgtcggaaccacgttaatggtggcgcgttatgcggtcaacacattgaaagaagtggaaaccagtctgagccgctttgagcaaaacggtattccggtgaaaggggtgattctgaactccatcttccgccgcgccagcgcgtatcaggattatggctattacgaatacgaatataagtcggatgcgaaataacgacgcctgcattcgcaccgccccgtaggccggataaggcgttcacgccgcatccggcaagcaaaccagctcataagccgggagaacaacct。

[0115] SEQ ID No: 6

[0116] Homologous template HR

[0117] atgtcaaaagtcgctctcatcaccggtgtaaccggacaagacggttcttacctggcagagtttctgctggaaaaaggttacgaggtgcatggtattaagcgtcgtgcatcgtcattcaacaccgagcgcgtggatcacatttatcaggatccgcacacctgcaacccgaaattccatctgcattatggcgacctgagtgatacctccaacctgacacgcattttgcgtgaagtgcagccggatgaagtgtataacctgggcgcaatgagccacgttgcggtctcttttgagtcaccggaatataccgcagacgttgatgcgatgggtacgctgcgcctgctcgaggcgatccgcttcctcggtctggaaaagaaaacccgtttttatcaggcttccacctctgaactgtacggtctggtgcaggaaattccgcagaaagaaactacgccgttctacccgcgatctccgtatgcggtcgccaaactgtacgcctactggatcaccgttaactaccgcgaatcctacggcatgtacgcctgtaacggtattctcttcaaccatgaatccccgcgccgcggtgaaaccttcgttacccgcaaaatcacccgcgcaatcgccaatatcgcccaggggctggagtcgtgcctgtacctcggcaatatggattccctgcgtgactggggccatgccaaagactacgtaaaaatgcagtggatgatgctgcaacaggaacagccggaagatttcgttattgctaccggcgttcagtactccgtacgtcagttcgtggaaatggcggcagcacagttgggcatcaaactgcgctttgaaggcacgggtgttgaagagaagggcattgtggtttccgtcaccgggcatgacgcgccgggcgttaaaccgggtgatgtgattatcgccgttgacccgcgttacttccgtccggcagaagttgaaacgctgctcggcgacccgaccaaagcgcacgaaaaactgggctgga。

[0118] SEQ ID No: 7

[0119] Homologous template HL2

[0120] tgctgaaaccgaagaaagggctgattatcctcggcgcgattatccttggcctgatgctttctatcgtgggtgtgctgctgcgctcgttgtttaatcgcggcattgaaagcccgcaagtactggaagaacacggtattagcgtctatgccagcatcccgctgtcggaatggcagaaagcgcgtgatagcgtcaaaaccatcaaagggattaaacgctataaacagagccagctactggcggtggggaatccaaccgatctggcgattgaagccatccgtagtctgcgtaccagtttgcacttcgcgatgatgcaggcacagaacaatgtgttgatgatgaccggggttagcccgtcaattggtaaaacctttgtctgcgccaacctggcggcggtgatcagccagaccaataaacgcgtgttgttgatcgactgcgatatgcgcaaaggctacacccacgagctgttgggcactaataacgttaatggcctgtcggaaattctgattggtcagggcgatattactaccgctgctaaaccgacctctattgccaaatttgacctgatcccgcgcggtcaggtgccgccaaatccttctgaactgttgatgagcgaacgctttgccgaactggtgaactgggcgagtaaaaactatgacctggtgttgattgatacgccgccgattctggcagtgaccgatgcggcaattgttggtcgtcatgtcggaaccacgttaatggtggcgcgttatgcggtcaacacattgaaagaagtggaaaccagtctgagccgctttgagcaaaacggtattccggtgaaaggggtgattctgaactccatcttccgccgcgccagcgcgtatcaggattatggctattacgaatacgaatataagtcggatgcgaaataacgacgcctgcattcgcaccgccccgtaggccggataaggcgttcacgccgcatccggcaagcaaaccagctcataagccgggagaacaacct。

[0121] SEQ ID No: 8

[0122] Homologous template HR2

[0123] atgtcaaaagtcgctctcatcaccggtgtaaccggacaagacggttcttacctggcagagtttctgctggaaaaaggttacgaggtgcatggtattaagcgtcgcgcatcgtcattcaacaccgagcgcgtggatcacatttatcaggatccgcacacctgcaacccgaaattccatctgcattatggcgacctgagtgatacctctaacctgacgcgcattttgcgtgaagtacagccggatgaagtgtacaacctgggcgcaatgagccacgttgcggtctcttttgagtcaccagaatataccgctgacgtcgacgcgatgggtacgctgcgcctgctggaggcgatccgcttcctcggtctggaaaagaaaactcgtttctatcaggcttccacctctgaactgtatggtctggtgcaggaaattccgcagaaagagaccacgccgttctacccgcgatctccgtatgcggtcgccaaactgtacgcctactggatcaccgttaactaccgtgaatcctacggcatgtacgcctgtaacggaattctcttcaaccatgaatccccgcgccgcggcgaaaccttcgttacccgcaaaatcacccgcgcaatcgccaacatcgcccaggggctggagtcgtgcctgtacctcggcaatatggattccctgcgtgactggggccacgccaaagactacgtaaaaatgcagtggatgatgctgcagcaggaacagccggaagatttcgttatcgcgaccggcgttcagtactccgtgcgtcagttcgtggaaatggcggcagcacagctgggcatcaaactgcgctttgaaggcacgggcgttgaagagaagggcattgtggtttccgtcaccgggcatgacgcgccgggcgttaaaccgggtgatgtgattatcgctgttgacccgcgttacttccgtccggctgaagttgaaacgctgctcggcgacccgaccaaagcgcacgaaaaactgggctgga。

Claims

1. A method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG, characterized in that: Using Escherichia coli as the starting strain, knocking out its metabolic genes wcaA, wcaB, wcaC, wcaD, wcaE and wcaF for biosynthesis of colanic acid, and knocking in the expression regulatory component of the gmd-wcaG gene before the gmd gene, to obtain recombinant Escherichia coli that efficiently expresses gmd and wcaG; The regulatory components of the gmd-wcaG gene include a promoter and a ribosome binding site; the starting strain is Escherichia coli carrying gmd-wcaG.

2. The method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG as claimed in claim 1, characterized in that: The starting strain is Escherichia coli BL21 series, JM109 series, K12 or MG1655.

3. The method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG as claimed in claim 2, characterized in that: The starting strain is JM109 (DE3) or BL21 (DE3).

4. The method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG as claimed in claim 1, characterized in that: The promoter is selected from T7, tac, J23119 or lacI promoter.

5. The method for constructing a recombinant Escherichia coli that efficiently expresses gmd and wcaG according to claim 1, 2, 3 or 4, characterized in that: The ribosome binding site is selected from BBa_B0034, BBa_B0030, BBa_B0032 or BBa_BJ61101, and the coding sequences are shown in SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, and SEQ ID No: 4, respectively.

6. The recombinant Escherichia coli obtained by the construction method according to any one of claims 1 to 5.

7. Use of the recombinant Escherichia coli obtained by the construction method according to any one of claims 1 to 5 for fermentation production of GDP-L-fucose.

Images