Primer pairs and methods for identifying species of Coptis chinensis

By designing specific primer pairs for Coptis chinensis and Coptis chinensis with short calyx for PCR amplification and sequencing, the problem of poor species identification of Coptis chinensis was solved, and accurate and efficient identification effects were achieved, which is suitable for the rapid identification of Chinese medicinal materials.

CN116024367BActive Publication Date: 2025-09-09INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211251623.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-13
Publication Date
2025-09-09
Estimated Expiration
2042-10-13

AI Technical Summary

Technical Problem

The existing technology has poor results in species identification of Coptis chinensis, especially Coptis chinensis and Coptis chinensis with short calyx, which are difficult to distinguish through flowering characteristics, resulting in inaccurate identification of Chinese medicinal materials and affecting people's health.

Method used

Specific primer pairs Cop 50F/Cop 50R, Cop 71F/Cop 71R and Cop 126F/Cop 126R were designed to perform PCR amplification and sequencing of chloroplast fragments of Coptis chinensis and Coptis chinensis with specific SNP sites for identification.

Benefits of technology

The accurate identification of Coptidis rhizome and Coptidis brachycalyx was achieved, the problems of multiple copies and microbial contamination were avoided, the PCR amplification efficiency of degraded materials was improved, and it is suitable for the rapid identification of Chinese medicinal materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116024367B_ABST
    Figure CN116024367B_ABST
Patent Text Reader

Abstract

The present invention provides a Coptidis species identification primer pair and a Coptidis species identification method, belonging to the field of molecular identification technology. The Coptidis species identification primer pair and the Coptidis species identification method provided by the present invention can overcome the problem of poor Coptidis species identification effect in the prior art. The identification region targeted by the Coptidis species identification primer pair provided by the present invention is a chloroplast fragment, not a nuclear gene fragment, and there is no multi-copy situation. At the same time, it can avoid the common microbial contamination problem of traditional Chinese medicine materials. The identification region fragment is short, with a length of only 400bp, which is much shorter than other DNA barcode fragments. Since degradation is a common phenomenon in traditional Chinese medicine materials, shorter barcode fragments are beneficial to improving the PCR amplification efficiency of degraded materials. It has strong practical application significance in Coptidis species identification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular identification, in particular to a primer pair for identifying coptis chinensis species and a coptis chinensis species identification method. Background Art

[0002] The Chinese medicinal herb Coptis chinensis (Coptis chinensis) is a staple herb in my country with a long history of medicinal use. It was first recorded in the Eastern Han Dynasty's "Shennong Bencao Jing," stating, "The roots are connected in beads and are yellow, hence the name." It is bitter and cold in nature, non-toxic, and has the effects of purging heat and detoxifying, clearing heat and drying dampness. Modern pharmacological research has found that Coptis chinensis has anti-tumor, antibacterial, antiviral, and blood sugar and blood pressure lowering properties. The Chinese Pharmacopoeia specifies that the source plant of the Chinese medicinal herb Coptis chinensis is the dried rhizome of Coptis chinensis, Coptis trifoliata, and Coptis yunnanensis. Among these, Coptis chinensis has the largest cultivated area, far exceeding that of other species, and is the most important group in the domestic Coptis chinensis industry.

[0003] Currently, the Flora of China records six species and one variety in the genus Coptis, including Coptis deltoidei (C. deltoidei CYCheng et Hsiao), C. omeiensis (Chen) CYCheng, C. quinquefolia Miq, C. quinquesecta W.T. Wang, C. teeta Wall., C. chinensis var. chinensis Franch., and its variant C. chinensis var. brevisepala W.T. Wang et Hsial. Coptis chinensis and C. chinensis var. brevisepala are morphologically very similar, with the Flora describing them as differing only in calyx length. However, both have short flowering periods, and C. chinensis is used medicinally as a rhizome, making identification based on calyx morphology impractical. Inaccurate identification of Chinese medicinal materials has significant consequences for public health.

[0004] DNA barcoding is a new biological identification system that uses standardized, short gene fragments with sufficient variation to rapidly and accurately identify species. Conventional DNA barcoding primers are not necessarily optimal for identifying every species and may lack resolution for closely related species. Furthermore, ITS are nuclear gene fragments, which can pose issues such as multiple copies and contamination by foreign organisms. Summary of the Invention

[0005] The purpose of the present invention is to provide a primer pair for identifying Coptis chinensis species and a method for identifying Coptis chinensis species, so as to solve the problem that the identification effect of Coptis chinensis species in the prior art is relatively poor.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a primer pair for identifying Coptis chinensis species, comprising a primer Cop 50F having a nucleotide sequence as shown in SEQ ID NO.1 and a primer Cop 50R having a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The present invention also provides another primer pair for identifying Coptis chinensis species, comprising a primer Cop 71F having a nucleotide sequence as shown in SEQ ID NO.3 and a primer Cop 71R having a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The present invention also provides another primer pair for identifying Coptis chinensis species, comprising a primer Cop 126F having a nucleotide sequence as shown in SEQ ID NO.5 and a primer Cop 126R having a nucleotide sequence as shown in SEQ ID NO.6.

[0010] The present invention also provides a method for identifying species of Coptis chinensis, comprising the following steps:

[0011] The genomic DNA of the sample was amplified by PCR using a primer pair including primer Cop 50F and primer Cop 50R to obtain the target sequence Cop50. The target sequence Cop50 was sequenced, and the sequencing results were as follows:

[0012] (1) The base at 21 bp is C;

[0013] (2) The base at 34bp is A;

[0014] (3) The base at bp 191 is C;

[0015] (4) The base at 21 bp is T;

[0016] (5) The base at 34 bp is C;

[0017] (6) The base at 191 bp is T;

[0018] When the sequencing results show one or more of (1) to (3), the sample is Coptis chinensis;

[0019] When the sequencing results show one or more of (4) to (6), the sample is Coptis chinensis.

[0020] The present invention also provides another method for identifying species of Coptis chinensis, comprising the following steps:

[0021] The genomic DNA of the sample was amplified by PCR using a primer pair including primer Cop 71F and primer Cop 71R to obtain the target sequence Cop71. The target sequence Cop71 was sequenced, and the sequencing results were as follows:

[0022] (1) The base at 189bp is T;

[0023] (2) The base at 211 bp is T;

[0024] (3) The base at bp 239 is C;

[0025] (4) The base at 189 bp is C;

[0026] (5) The base at 211 bp is C;

[0027] (6) The base at 239bp is T;

[0028] When the sequencing results show one or more of (1) to (3), the sample is Coptis chinensis;

[0029] When the sequencing results show one or more of (4) to (6), the sample is Coptis chinensis.

[0030] The present invention also provides another method for identifying species of Coptis chinensis, comprising the following steps:

[0031] The genomic DNA of the sample was amplified by PCR using a primer pair including primer Cop126F and primer Cop126R to obtain the target sequence Cop126. The target sequence Cop126 was sequenced, and the sequencing results were as follows:

[0032] (1) The base at 126 bp is G;

[0033] (2) The base at 142 bp is C;

[0034] (3) The base at 354 bp is C;

[0035] (4) The base at 126 bp is T;

[0036] (5) The base at 142 bp is A;

[0037] (6) The base at 354bp is A;

[0038] When the sequencing results show one or more of (1) to (3), the sample is Coptis chinensis;

[0039] When the sequencing results show one or more of (4) to (6), the sample is Coptis chinensis.

[0040] Preferably, the reaction system of the PCR amplification is calculated in 20 μL as follows:

[0041] ddH2O 11.8μL, 10× Taq buffer 2μL, dNTPs at a concentration of 2 mmol / L 2μL, forward and reverse primers at a concentration of 5μmol / L 2μL, Taq enzyme at a concentration of 2.5U / μL 0.2μL, DNA template 2μL.

[0042] Preferably, the reaction conditions of the PCR amplification are:

[0043] Pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 35 cycles; final extension at 72°C for 5 min.

[0044] The present invention also provides application of the primer pair in identifying Coptidis rhizome and Coptidis rhizome short-calyx.

[0045] The present invention also provides a kit for identifying Coptidis rhizome species, comprising the above primer pair and a detection reagent.

[0046] The technical effects and advantages of the present invention are as follows:

[0047] The Coptidis species identification primer pair provided by the present invention targets chloroplast fragments, not nuclear gene fragments, and thus does not contain multiple copies. This also avoids the common microbial contamination problem of traditional Chinese medicine materials. The identification region fragment is short, only 400 base pairs in length, which is much shorter than other DNA barcode fragments. Since degradation is a common phenomenon in traditional Chinese medicine materials, shorter barcode fragments are beneficial for improving the PCR amplification efficiency of degraded materials. This method has strong practical application significance in Coptidis species identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 It is the species-specific mutation site of Cop50;

[0049] Figure 2 It is the species-specific mutation site of Cop71;

[0050] Figure 3 It is the species-specific mutation site of Cop126;

[0051] Figure 4 Verification results of Cop126 species-specific variant sites for samples 1 to 50.

[0052] Figure 5 Verification results of Cop126 species-specific variant sites for samples 51 to 100.

[0053] Figure 6 Verification results of Cop126 species-specific variant sites for samples 101 to 150.

[0054] Figure 7Verification results of Cop126 species-specific variant sites for samples 151-200.

[0055] Figure 8 Verification results of Cop126 species-specific mutation sites for samples 201 to 220.

[0056] Figure 9 Verification results of Cop71 species-specific variant sites for samples 1 to 100.

[0057] Figure 10 Verification results of Cop71 species-specific variant sites for samples 101 to 200.

[0058] Figure 11 Verification results of Cop71 species-specific mutation sites for samples 201 to 220.

[0059] Figure 12 Verification results of Cop50 species-specific variant sites for samples 1 to 50.

[0060] Figure 13 Verification results of Cop50 species-specific variant sites for samples 51 to 100.

[0061] Figure 14 Verification results of Cop50 species-specific variant sites for samples 101 to 150.

[0062] Figure 15 Verification results of Cop50 species-specific variant sites for samples 151 to 220. DETAILED DESCRIPTION

[0063] Source of samples of the present invention:

[0064] Based on the distribution of Coptidis rhizome and Coptidis brachycalyx, we sampled Coptidis rhizome (Ccc) and Coptidis brachycalyx (Ccb) by population. We selected one to two sampling sites in each province, with at least ten individual samples collected at each site. A total of 11 populations and 220 individuals were used in the experiment.

[0065] The sources of the samples are shown in Table 1 below:

[0066] Table 1 Sample source record

[0067]

[0068]

[0069]

[0070]

[0071] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0072] Example 1

[0073] The inventors obtained three species-specific regions of Coptis chinensis through research and designed the following primers:

[0074] Cop 50F: GGGATGAAAATTTCCCCTC, as shown in SEQ ID NO. 1;

[0075] Cop 50R: AGTTAATGGCCGTATAGTAGA, as shown in SEQ ID NO. 2;

[0076] Cop 71F: ACTGATCTTGATATAAGCCAA, as shown in SEQ ID NO. 3;

[0077] Cop 71R: GTGATTTTCTCGCCTACTACG, as shown in SEQ ID NO. 4;

[0078] Cop126F: CATTCGCATTAACATCTAATT, as shown in SEQ ID NO. 5;

[0079] Cop126R:TGGCATTTATCCGGATTTCGT, as shown in SEQ ID NO.6.

[0080] Among the sequences amplified using the above primers:

[0081] In the Cop50 sequence, species-specific SNPs exist at bp 21 (Ccb is c, Ccc is t), bp 34 (Ccb is a, Ccc is c), and bp 191 (Ccb is c, Ccc is t);

[0082] In the Cop71 sequence, species-specific SNPs are present at bp 189 (Ccb is t, Ccc is c), bp 211 (Ccb is t, Ccc is c), and bp 239 (Ccb is c, Ccc is t);

[0083] Species-specific SNPs exist at the 104th bp (Ccb is g, Ccc is t), the 142th bp (Ccb is c, Ccc is a), and the 354th bp (Ccb is c, Ccc is a) in the Cop126 sequence.

[0084] The above primers were used to perform PCR amplification on the genomic DNA of 22 samples. The reaction system was:

[0085] ddH2O 11.8μL, 10× Taq buffer 2μL, dNTPs at a concentration of 2 mmol / L 2μL, forward and reverse primers at a concentration of 5μmol / L 2μL, Taq enzyme at a concentration of 2.5U / μL 0.2μL, DNA template 2μL.

[0086] The reaction conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; and final extension at 72°C for 5 min.

[0087] The amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0088] Sequencing comparison results are as follows Figures 1 to 3 As shown, Figure 1 is the species-specific mutation site of Cop50, Figure 2 is the species-specific mutation site of Cop71. Figure 3 It is the species-specific mutation site of Cop126.

[0089] The results showed that in the Cop50 sequence, Ccb was c and Ccc was t at the 21st bp, Ccb was a and Ccc was c at the 34th bp, and Ccb was c and Ccc was t at the 191st bp; in the Cop71 sequence, Ccb was t and Ccc was c at the 189th bp, Ccb was t and Ccc was c at the 211th bp, and Ccb was c and Ccc was t at the 239th bp; in the Cop126 sequence, Ccb was g and Ccc was t at the 104th bp, Ccb was c and Ccc was a at the 142nd bp, and Ccb was c and Ccc was a at the 354th bp, all of which were consistent with the species-specific SNP situation.

[0090] The above primers and identification methods were used to verify 220 individuals. The verification results of the Cop126 species-specific variant sites of the samples are as follows: Figures 4 to 8 As shown in the figure, the verification results of Cop71 species-specific variant sites are as follows Figures 9 to 11 The results of the validation of Cop50 species-specific variant sites are shown in Figures 12 to 15 As shown in the figure, the results showed that all 220 individuals conformed to the variation patterns of the above species-specific SNPs. Due to the wide sampling coverage of the samples of Coptis chinensis and Coptis chinensis brachycalyx (covering almost all the distribution areas of both species) and the large number of validation samples, the identification method obtained has practical application significance.

[0091] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for identifying species of Coptis chinensis, characterized in that: The steps include: The genomic DNA of the sample was amplified by PCR using primer Cop50F with a nucleotide sequence as shown in SEQ ID NO.1 and primer Cop50R with a nucleotide sequence as shown in SEQ ID NO.2 to obtain the target sequence Cop50. The target sequence Cop50 was sequenced, and the sequencing results were as follows: (1) The base at 21 bp is C; (2) The base at 34bp is A; (3) The base at bp 191 is C; (4) The base at 21 bp is T; (5) The base at 34 bp is C; (6) The base at 191 bp is T; When the sequencing results show (1) to (3), the sample is Coptis chinensis C. chinensis var. brevisepala WT Wang et Hsial; When the sequencing results show (4) to (6), the sample is Coptis chinensis C. chinensis var. chinensis Franch.

2. A method for identifying species of Coptis chinensis, characterized in that: The steps include: The genomic DNA of the sample was amplified by PCR using primer Cop71F with a nucleotide sequence as shown in SEQ ID NO.3 and primer Cop71R with a nucleotide sequence as shown in SEQ ID NO.4 to obtain the target sequence Cop71. The target sequence Cop71 was sequenced, and the sequencing results were as follows: (1) The base at 189bp is T; (2) The base at 211 bp is T; (3) The base at bp 239 is C; (4) The base at 189 bp is C; (5) The base at 211 bp is C; (6) The base at 239bp is T; When the sequencing results show (1) to (3), the sample is Coptis chinensis C. chinensis var. brevisepala WT Wang et Hsial; When the sequencing results show (4) to (6), the sample is Coptis chinensis C. chinensis var. chinensis Franch.

3. A method for identifying species of Coptis chinensis, characterized in that: The steps include: The genomic DNA of the sample was amplified by PCR using primer Cop126F with a nucleotide sequence as shown in SEQ ID NO.5 and primer Cop126R with a nucleotide sequence as shown in SEQ ID NO.6 to obtain the target sequence Cop126. The target sequence Cop126 was sequenced, and the sequencing results were as follows: (1) The base at 126 bp is G; (2) The base at 142 bp is C; (3) The base at 354 bp is C; (4) The base at 126 bp is T; (5) The base at 142 bp is A; (6) The base at 354bp is A; When the sequencing results show (1) to (3), the sample is Coptis chinensis C. chinensis var. brevisepala WT Wang et Hsial; When the sequencing results show (4) to (6), the sample is Coptis chinensis C. chinensis var. chinensis Franch.

4. The method for identifying species of Coptis chinensis according to any one of claims 1 to 3, characterized in that: The reaction system of the PCR amplification is calculated in 20 μL as follows: ddH2O 11.8μL, 10× Taq buffer 2μL, dNTPs at a concentration of 2 mmol / L 2μL, forward and reverse primers at a concentration of 5μmol / L 2μL, Taq enzyme at a concentration of 2.5U / μL 0.2μL, DNA template 2μL.

5. The method for identifying species of Coptis chinensis according to any one of claims 1 to 3, characterized in that: The reaction conditions of the PCR amplification are: Pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 35 cycles; final extension at 72°C for 5 min.