Methods and kits for whole transcriptome sequencing of a small amount of tumor cells from fresh samples
Through specific cell lysis reagents and magnetic bead binding technology, the genome contamination and heterogeneity problems in transcriptome sequencing of small amounts of fresh tumor cell samples were solved, and efficient full-length cDNA library construction and high-quality sequencing results were achieved.
Patent Information
- Application Number
- CN202310097499.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-10
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2043-02-10
AI Technical Summary
The prior art is difficult to effectively deal with transcriptome sequencing of small samples of fresh tumor cell, especially due to the RNA extraction and sequencing accuracy caused by small sample size, poor cell activity, tumor heterogeneity and immune infiltrating microenvironment, which leads to the sequencing results being of no clinical value.
Using specific cell lysis reagents and magnetic bead binding technology, the Oligo(dT) Primer reverse transcription and streptavidin magnetic beads specifically bound to eliminate genomic contamination, and DNA fragmentation and amplification were performed using transposase to simplify the library construction process.
High-quality full-length cDNA library was obtained from 5,000 tumor cell starting samples within 8-9 hours, with an amplification success rate of more than 95%, ensuring the accuracy and consistency of the sequencing data, and overcoming the challenges brought by sample size and heterogeneity in traditional methods.
Smart Images

Figure BDA0004072108090000101 
Figure BDA0004072108090000102 
Figure BDA0004072108090000103
Abstract
Description
Technical Field
[0001] The present invention relates to the field of sequencing dedicated to tumor cells, and particularly to a method and a kit for whole transcriptome sequencing of a small amount of tumor cells from fresh samples. Background Art
[0002] The transcriptome refers to the collection of all transcribed mRNA products in a cell of a certain species or specific cell under a certain physiological function state, including time and space limitations, and is an inevitable link connecting the genetic information of the genome and the proteome of biological functions. As an important omics research in the post-genome era, transcriptome research not only provides important means and methods for studying gene expression and regulation, but also provides an important path for exploring functional genes, and is the basis and starting point for the research of gene function and structure. Transcriptome sequencing of tumor cells, especially transcriptome sequencing of tumor cells from fresh tumor tissue samples, is of great significance for studying the occurrence and development of tumors, the development of anti-tumor drugs, the research on anti-tumor drug resistance mechanisms, the screening of anti-tumor drugs, the evaluation and guidance of clinical anti-tumor drugs.
[0003] Conventional RNA extraction methods lysate cells and tissues through denaturing agents such as guanidine isothiocyanate, while the proteins on ribosomes are denatured and nucleic acids are released; the released DNA and RNA are located in the middle phase and aqueous phase of the whole system respectively due to their different solubilities at a specific pH, so as to be separated; then organic solvents such as chloroform are used for extraction and precipitation to obtain pure RNA. Since RNA samples are easily degraded by environmental factors, especially RNase, extracting high-quality RNA is the key to successful sequencing. At present, in scientific research activities in the field of life sciences, low-sample RNA extraction is very challenging, and there are very strict requirements for sample selection and processing.
[0004] For a small number of cells, some dead cells will spontaneously lyse and release genomic substances into the system. Conventional reverse transcription methods cannot remove these contaminated genomes, and non-essential genomic data contamination is often introduced in the secondary PCR amplification after reverse transcription. After amplification and library construction, the background of the data in the final sequencing data will also increase, affecting the analysis of normal data. This method connects biotin to one end of the reverse transcription primer, and after reverse transcription, specifically binds the biotin-reverse transcription product through streptavidin magnetic beads, which can effectively eliminate genomic contamination, thereby further improving the quality of the final RNA sequencing data.
[0005] Compared to RNA extraction and sequencing in general scientific research activities, accurate mRNA sequencing of tumor cells from fresh ex vivo tumor tissue samples from cancer patients or PDX (patient-derived xenografts) is very difficult, especially when dealing with small sample sizes.
[0006] First, there are the issues of small tumor cell sample size and low “quality.” On the one hand, patients in the late stages of cancer are often unable to tolerate surgery and can only undergo puncture at best, resulting in a very small sample size. On the other hand, due to anti-tumor treatment causing some tumor cells to die or become inactive, the effective tumor cells in the tumor sample tissue that can be obtained become very limited. Due to the limited sample size and activity issues, this has invisibly hindered the further application of a small number of tumor cells in functional studies and supplementary omics data (transcriptome high-throughput sequencing) in clinical practice.
[0007] Currently, high-throughput transcriptome sequencing (RNA-Seq) of tumor cells requires a high starting RNA quantity, generally requiring at least micrograms (μg) of RNA. Tumor cells from inoperable cancer patients, obtained solely through biopsy, rarely meet this minimum sample size requirement, making further transcriptome sequencing library construction and sequencing impossible, or resulting sequencing results lack clinical value.
[0008] Secondly, because the preparation of tumor cell suspension using tumor cells derived from fresh tumor cell samples is very demanding, the activity of tumor cells from fresh tumor samples varies greatly compared to cultured genetically stable cell lines and other normal cells. If the cell activity in the cell suspension is insufficient, RNA degradation will occur.
[0009] The third issue is the tumor immune infiltration microenvironment. On the one hand, tumor cells isolated from ex vivo tumor tissue samples are inevitably contaminated with connective tissue, fibroblasts, necrotic cells, and other cells. Furthermore, because the tumor microenvironment can lead to abnormal cellular metabolism, tumor cells isolated from ex vivo tumor tissue samples will produce various abnormal tumor-related metabolites. These abnormal tumor-related metabolites can easily bind to RNA and be extracted together with RNA, hindering the isolation of biologically active RNA. These factors can seriously affect the accuracy of RNA extraction and subsequent sequencing.
[0010] Next, there is the problem of tumor heterogeneity. Different from commonly used normal cells such as embryonic cells and stem cells, or tumor cell lines after passage culture, the tumor cell heterogeneity of fresh ex vivo tumor tissue samples from tumor patients or PDX is relatively obvious. Tumor cells from the same sample may belong to different subsets, and there will also be variation phenomena even among tumor cells belonging to the same subset. Due to the existence of heterogeneity, the components and morphologies of tumor cell membranes are also different, resulting in very strict conditions for lysis. It is necessary to ensure the lysis of all tumor cells while ensuring that RNA is not degraded. Conventional cell lysates such as proteinase K and surfactants often result in RNA degradation or incomplete lysis, ultimately leading to sequencing failure.
[0011] In addition, due to the existence of heterogeneity, mRNA sequencing of individual tumor cells is worthless and cannot provide any guiding significance for scientific research or clinical medication. If mRNA sequencing is performed on all tumor cells in a tumor sample, a huge amount of tumor cells is required, and the cost of performing all mRNA sequencing on a conventional clinical sample will be astronomical.
[0012] Therefore, there is an urgent need in the art to establish a method for RNA extraction and high-throughput transcriptome sequencing lysis specifically for a small number of tumor cells from fresh tumor tissue samples on the basis of traditional transcriptome high-throughput sequencing. Through the method of the present invention, from the limited tumor samples taken from tumor patients, only 5,000 - 10,000 tumor cells can be left while the remaining small amount of samples can meet the requirements of RNA and transcriptome sequencing when used for other detection items. Summary of the Invention
[0013] Object of the Invention: To provide a method and kit for whole transcriptome sequencing of a small number of tumor cells from fresh samples with better effects. The specific objects can be seen in multiple substantial technical effects in the specific implementation part. In particular, to solve the technical problems described in
[0005] -
[0010] .
[0014] To achieve the above object, an embodiment of the present invention adopts the following technical solution:
[0015] A method for whole transcriptome sequencing of a small number of tumor cells from fresh tumor tissue samples, characterized in that the method comprises the following steps:
[0016] 1) Isolate tumor cells from a fresh tumor tissue sample, wherein the fresh tumor tissue sample is from a tumor patient or from a PDX mouse model (patient-derived xenograft model (PDX model));
[0017] 2) Lysing the isolated tumor cells: Put the isolated tumor cells into 500 μL of cell lysis reagent for lysis; the components of the cell lysis reagent are as follows: 2 - 5 mol / L of guanidine isothiocyanate, water-saturated phenol with a volume ratio of 1 - 25%, 2 mol / L of sodium acetate, 0.1 - 0.5 mol / L of dithiothreitol, 10 - 30 mmol / L of potassium dihydrogen phosphate, and 10 - 15% (by mass) of Sarcosyl;
[0018] 3) Further separating mRNA after extracting trace total RNA;
[0019] 4) Using Oligo(dT) Primer as the 3'-end reverse transcription primer, reverse transcribing mRNA under the action of reverse transcriptase to obtain the first strand of full-length cDNA;
[0020] 5) Adding an adapter primer to the 3'-end of the obtained first strand of cDNA without depending on the template under the Template-switching action of reverse transcriptase;
[0021] 6) Using the cDNA obtained in step 5) as a template, specifically binding with streptavidin magnetic beads, and then using specific upstream and downstream primers to perform cDNA second strand generation and amplification under the action of high-fidelity amplification enzyme;
[0022] 7) After the second strand is generated, adding a transposase adapter mixture and fragmentation buffer for fragmentation, end repair, and ligation of the adapter reaction. After the reaction is completed, terminating the reaction with a termination reaction solution 5xTS to inactivate the transposase;
[0023] 8) Adding high-fidelity amplification enzyme, amplification buffer, and adapter primer to the product obtained in step 7) for PCR amplification;
[0024] 9) Sorting the fragments of the amplification product in step 8) with magnetic beads to obtain a library for sequencing.
[0025] As a further preference, for tumor cells isolated from a fresh tumor tissue sample, using 1X collagenase to digest the fresh tumor tissue sample, and using CD45 cell sorting magnetic beads and / or fibroblast sorting magnetic beads for tumor cells. After digestion and sorting, the density of tumor cells in the tumor cell suspension is adjusted to (1 - 10)×10 5 cells / ml.
[0026] As a further preference, the separation reagent used for separating mRNA in the above step 3) is: 1-6 μL of reaction solution S, 0.5-2 μL of protease inhibitor, 1-4 μL of dNTP Mix (10 mM), and 1-4 μL of Oligo(dT)VN Primer. Among them, the components of reaction solution S are Triton X-100 with a mass percentage of 0.1-0.5%, 15-30 mM Tris-HCl pH 7.0-8.0, 10-15 mM NaCl, 0.5-2 μL of proteinase K, and 5-10 mM EDTA.
[0027] As a further preference, the high-fidelity amplification enzyme is selected from one or more of KAPA HiFi DNA Polymerase, NEBNext High Fidelity PCR Master Mix, and Vazyme TruePrep Amplify Enzyme, preferably NEBNext High Fidelity PCR Master Mix.
[0028] As a further preference, the tumor cells can be derived from tumor tissues of various tumor types, including but not limited to tumors located in the following parts: digestive system (such as stomach, intestine, duodenum, colon, pancreas, bile duct, anal canal, etc.), breast, lung, liver, endocrine glands (such as adrenal gland, parathyroid gland, pituitary gland, testis, ovary, thymus, thyroid gland), urogenital system (such as kidney, bladder, ovary, testis, prostate, etc.), skeletal muscle system (such as bone, smooth muscle, striated muscle, etc.), nervous system (such as brain), skin, head and neck, blood system, etc. For example, the tumor cells can be tumor cells derived from gastric cancer, duodenal cancer, and lung cancer. The tumor cells can be any type of tumor cells of the tumors in the above parts. As a further preference, the tumor cells are derived from lung cancer. In another embodiment, the tumor cells are derived from a PDX mouse model of the triple-mutant lung cancer cell line LUPF104.
[0029] As a further preference, the tumor cells of the present invention are isolated tumor cells that have been digested and sorted, preferably primary tumor cells. As a further preference, the digestion is carried out by the following method: removing non-tumor tissues and necrotic tissues, cutting the tumor sample into small pieces, rinsing and collecting the tissue pieces with HBSS, and digesting the tumor pieces with 1X collagenase at 37 °C for 1-2 hours.
[0030] As a further preference, the sorting is carried out by the following method: Dilute the termination digestion with serum medium at a ratio of 1:1, collect the cell suspension by passing through a 70-μm sieve; centrifuge at 1000 rpm for 3 minutes to remove the supernatant, resuspend the cells with 10 ml of PBS containing 1% FBS, wash, and adjust the cell density to 1×108 / ml; add CD45 cell sorting magnetic beads and fibroblast sorting magnetic beads at a concentration of 20 μl / 107 cells, and incubate at room temperature for 30 min; add PBS containing 1% FBS to wash the cells, and resuspend with 2 ml of PBS containing 1% FBS. Place the magnetic beads on a magnet, and rinse the magnetic beads with PBS containing 1% FBS; add the cells to the rinsed magnetic column, wait for the liquid to drain, wash the column twice with 3 ml of PBS containing 1% FBS, and collect the flowing liquid; centrifuge the collected liquid at 1000 rpm for 3 minutes to remove the supernatant, resuspend with cell culture medium, count, and adjust the cell density to (1-10)×10 5 cells / ml.
[0031] As a further preference, after the tumor cells are lysed, the following steps are further included:
[0032] I. Add 135-200 μL of ice-cold chloroform, mix well by shaking, and centrifuge at 13000 rpm at 4℃ for 15-30 minutes;
[0033] II. Carefully pipette 300-350 μL of the supernatant into a new 1.5-mL centrifuge tube;
[0034] III. Add 340-500 μL of ice-cold isopropanol, mix well by shaking, and centrifuge at 13000 rmp at 4℃ for 20-30 minutes;
[0035] IV. Carefully pour out the liquid in the centrifuge tube; add 700-1000 μL of 75% ice-cold ethanol, and invert 4 times;
[0036] V. Centrifuge at 13000 rmp at 4℃ for 15-30 minutes;
[0037] VI. Carefully pour out the liquid in the centrifuge tube, and invert it onto a blotting paper and let it stand for 1 minute;
[0038] VII. Open the lid and place it in a 37℃ metal bath to incubate for 3-5 minutes to fully evaporate the ethanol;
[0039] VIII. Add 30-50 μL of 10 mM Tris-HCL buffer, mix well by shaking and centrifuge briefly.
[0040] As a further preference, the steps for capturing mRNA are as follows: Take 2 μL of a micro - volume tumor cell lysate sample and add it to a PCR tube. Then add 1 μL of reaction solution S. The components of reaction solution S are Triton X - 100 at a mass percentage of 0.1 - 0.5%, 15 - 30 mM Tris - HCl pH 7.0 - 8.0, 10 - 15 mM NaCl, 0.5 μL of proteinase K (Tiangen Biochemical, RT403), 5 - 10 mM EDTA; add 0.5 μL of protease inhibitor (Invitrogen TM , 10777019), 1 μL of dNTP Mix (10 mM) and 1 μL of Oligo(dT)VN Primer - biotin (Biotin - 5’ - AAGCAGTGGTATCAACGCAGAGTACT 30 VN - 3’). After mixing by oscillation and centrifugation, place it in a PCR instrument and set it at 72 °C for annealing for 3 minutes. Immediately after completion, place it on ice for 5 min.
[0041] As a further preference, the steps for mRNA reverse transcription and enrichment are as follows: During the first - strand cDNA synthesis, a linker sequence is added to the 3’ end of the cDNA by utilizing the Template - switching activity of SMARTScribe Reverse Transcriptase (Clontech).
[0042] As a further preference, streptavidin magnetic beads are used to specifically bind to the Biotin - cDNA product. After purification, using this cDNA as a template, specific upstream and downstream primers are used to generate and amplify the second - strand cDNA under the action of a high - fidelity amplification enzyme. Subsequent PCR amplification is carried out through this linker sequence to obtain a full - length cDNA amplification product.
[0043] As a further preference, after the generation of the second - strand cDNA, add 2.5 μL of a commonly used reverse transcription buffer RT (100 - 500 mM Tris - HCL pH 8.0, 100 - 500 mM KCL, 1 - 50 mM MgCl2, 1 - 500 mM DTT), 0.5 μL of RNase inhibitor (Invitrogen TM , 10777019), 0.5 μL of TS Oligo Primer (5’ - AAGCAGTGGTATCAACGCAGAGTACATRGRGRG - 3’) and 1 μL of SMARTScribe Reverse Transcriptase (Clontech). After mixing by oscillation, place it in a PCR instrument and carry out reverse transcription at 42 °C for 90 minutes, inactivate the enzyme at 70 °C for 15 minutes, and hold at 4 °C.
[0044] After the reaction is completed, take out the reacted product and add 15 uL of BeyoMag TM Streptavidin MagneticBeads (Beyotime), elute with 0.1% Tween, add 0.5 uL of PCR Primer (5’-AAGCAGTGGTATCAACGCAGAGT-3’), 12.5 uL of NEBNext High Fidelity PCR Master Mix (NEB, M0541L), supplement ddH2O to 25 uL, mix well by oscillation, place it in a PCR instrument and run at 98°C for 3 min, 98°C for 15 s, 63°C for 15 s, 72°C for 6 min, cycle 8 times, 72°C for 5 min, hold at 4°C.
[0045] In a further embodiment of the present invention, after PCR is completed, 1× magnetic beads (VAHTS DNAcleanbeads (Vazyme, N411)) are used for DNA purification, and finally the product fragments are analyzed by Agilent 2I00 Bioanalyzer and the product concentration is measured by Qubit3.0. The quality of the product is judged according to the fragment length distribution.
[0046] Take 6 uL of cDNA product, add 4 uL of TTBL and 5 uL of TTE Mix (Vazyme, TD503), supplement ddH2O to 20 uL, mix well by oscillation, place it in a PCR instrument, fragment at 55°C and add adapters for 10 min. Immediately after the reaction is completed, add 5 uL of reagent TS (Vazyme, TD503) and incubate at room temperature for 5 min to terminate the fragmentation reaction. The fragmented product is amplified by primers N5 (N5XX) and N7 (N7XX)( Index Kit V2, Vazyme, TD202) through NEBNext High Fidelity PCR MasterMix (NEB, M0541L). Finally, the amplified product is purified by magnetic beads to obtain a sequencing library.
[0047] In a further embodiment of the present invention, the library is quality inspected: the quality inspection of the library uses Agilent2I00 Bioanalyzer to analyze the product fragments and Qubit3.0 to measure the product concentration. The quality of the product is judged according to the fragment length distribution and concentration.
[0048] A further technical solution of the present invention is that the tumor cells are from a PDX mouse model constructed with the triple-mutant lung cancer cell line LUPF104.
[0049] A further technical solution of the present invention is that it is a high-throughput sequencing method for trace full-length transcriptome using tumor cells from a PDX mouse model constructed from a triple-mutant lung cancer cell line LUPF104;
[0050] 1. Perform a lysis experiment on trace tumor cells from the PDX mouse model of the LUPF104 cell line;
[0051] Lyse approximately 5000 LUPF104 tumor cells using a cell lysis reagent;
[0052] 2. Take 2 μL of the lysed sample above for amplification and enrichment of trace mRNA: Refer to the above steps to obtain a full-length cDNA amplification product, and use the Qubit3.0 HS DNA kit (Thermofisher, USA) for nucleic acid quantification, which is 1.26 ng / μL;
[0053] 3. Take 6 μL of the cDNA amplification product to construct a library. Refer to the above library construction steps to obtain a cDNA sequencing library, and use the Qubit3.0 HS DNA kit (Thermofisher, USA) for nucleic acid quantification, which is 19.3 ng / μL. After passing the detection by the Agilent2100 Bioanalyzer (Agilent, USA), it is used as the cDNA library for RNA-Seq sequencing;
[0054] 4. High-throughput sequencing was performed using Illumina Nova S4, and the basic sequencing data was analyzed: A total of sufficient Clean_Reads were obtained: 127,228,429, and Base>=Q30(%): 94.67. The present invention adopting the above technical solution has the following beneficial effects compared with the prior art: The present invention can start from a sample lysed from 5,000 to 10,000 tumor cells within 8-9 hours. Under the action of reverse transcriptase, the mRNA therein is reverse transcribed to obtain the first strand of cDNA. Then, a linker sequence (with an expression quantification molecular tag) is added to the 3' end of the cDNA by the Template-switching patent technology, and the second strand of cDNA is generated. Then, with the linker region as the primer anchoring site, exponential amplification is carried out while adding Illumina library linkers to both ends of the cDNA to obtain a high-quality cDNA library meeting the requirements of downstream analysis. Depending on the input amount, 10-20 ng of high-quality full-length double-stranded cDNA can be amplified in one reaction, with a reverse transcription and amplification library construction success rate of more than 95%. The cDNA library is fragmented by a new transposase method, turning the cumbersome steps of DNA fragmentation, end repair, and linker ligation reactions into a simple one-step enzymatic reaction. The library off-machine data (5M Reads) can detect more than 90% of gene expression, and the gene expression consistency exceeds 90%, with no obvious amplification bias. It overcomes the problem that the starting loading amount of existing complex types of trace tumor cell samples is difficult to meet the requirements of transcriptome high-throughput sequencing technology. The lysis step of this patent can well overcome the problem of the difference between necrotic cells and tumor cell monomers. Detailed implementation manners
[0055] The present invention will be further clarified below in conjunction with the detailed implementation manners. It should be understood that the following detailed implementation manners are only used to illustrate the present invention and not to limit the scope of the present invention.
[0056] Sample collection
[0057] Take freshly collected clinical tumor surgical samples or mouse PDX samples containing the patient's tumor cells in a transport and storage tube, transport them on ice, and transport them to the laboratory in the shortest possible time.
[0058] Tumor cell digestion and sorting
[0059] After removing non-tumor tissues and necrotic tissues in a biosafety cabinet, the tumor samples were cut into small pieces of 1-3 cubic millimeters, rinsed with HBSS and the tissue pieces were collected. The supernatant was removed by centrifugation at 1000 rpm for 3 minutes. The tumor pieces were digested with 1X collagenase (purchased from Gibco) at 37 °C for 1-2 hours; the digestion was terminated by diluting with serum medium (purchased from Life Technologies) at a ratio of 1:1 and the cell suspension was collected by passing through a 70 μm sieve; the supernatant was removed by centrifugation at 1000 rpm for 3 minutes, the cells were resuspended with 10 ml of PBS containing 1% fetal bovine serum (FBS) and washed, then the cells were resuspended in PBS containing 1% FBS, counted, and the cell density was adjusted to 1×10 8 / ml; added commercially available CD45 cell sorting magnetic beads (purchased from Miltenyi Biotec) and fibroblast sorting magnetic beads (purchased from Miltenyi Biotec) at a concentration of 20 μl / 10 7 cells, incubated at room temperature for 30 min; added PBS containing 1% FBS to wash the cells and resuspended them with 2 ml of PBS containing 1% FBS. At the same time, the magnetic beads were placed on a magnet and rinsed with PBS containing 1% FBS; the cells were added to the rinsed magnetic column, and after the liquid drained, the column was washed twice with 3 ml of PBS containing 1% FBS, and the drained liquid was collected; the collected liquid was centrifuged at 1000 rpm for 3 minutes to remove the supernatant, and the cells were resuspended with cell culture medium PC-1 (purchased from Lonza), counted, and the cell density was adjusted to (1-10)×10 5 cells / ml.
[0060] Lysis of tumor cells
[0061] 2-5 mol / L guanidine isothiocyanate, water-saturated phenol with a volume ratio of 1-25%, 2 mol / L sodium acetate, 0.1-0.5 mol / L dithiothreitol, 10-30 mmol / L potassium dihydrogen phosphate, 10-15% (mass percentage) Sarcosyl; the cell lysis reagent was prepared according to the above ratio, and then the tumor cells were placed in 500 uL of the cell lysis reagent for lysis.
[0062] Extraction of total RNA
[0063] After lysis, add 135 μL of ice-cold chloroform, mix well by vortexing, and centrifuge at 13,000 rpm at 4°C for 30 minutes. Carefully aspirate 300 μL of the supernatant with a pipette into a new 1.5 mL centrifuge tube. Add 340 μL of ice-cold isopropanol, mix well by vortexing, and centrifuge at 13,000 rpm at 4°C for 20 minutes. V. Carefully pour out the liquid in the centrifuge tube. Add 700 μL of 75% ice-cold ethanol, gently invert 4 times. Centrifuge at 13,000 rpm at 4°C for 15 - 30 minutes. Carefully pour out the liquid in the centrifuge tube, and invert it onto absorbent paper and let it stand for 1 minute. Open the lid and place it in a 37°C metal bath to incubate for 3 - 5 minutes to completely evaporate the ethanol. Add 30 - 50 μL of 10 mM Tris-HCL buffer, mix well by vortexing and centrifuge briefly. After completion, measure the RNA concentration using a qubit.
[0064] Amplification and enrichment of mRNA and cDNA amplification
[0065] Take 2 μL of total RNA extracted from a small amount of tumor cells and add it to a PCR tube. Add 1 μL of reaction solution S (0.1% TritonX-100, 15 mM Tris-HCl pH 7.0, 10 mM NaCl, 0.5 μL of proteinase K (Tiangen Biochemical, RT403), 10 mM EDTA), add 0.5 μL of RNA enzyme inhibitor (Invitrogen TM , 10777019), 1 μL of dNTP Mix (10 mM) and 1 μL of Oligo(dT)VN Primer, mix well by vortexing and centrifuge, then place it in a PCR instrument and set it to anneal at 72°C for 3 minutes, and immediately place it on ice for 5 minutes after completion.
[0066] During the first-strand cDNA synthesis, a linker sequence is added to the 3' end of the cDNA using the Template-switching activity of SMARTScribe Reverse Transcriptase (Clontech). Subsequent PCR amplification is carried out through this linker sequence to obtain a full-length cDNA amplification product: Add 2.5 μL of a commonly used reverse transcription buffer RT (100 mM Tris-HCL pH 8.0, 100 mM KCL, 1 mM MgCl2, 1 - 500 mM DTT (self-prepared buffer)), 0.5 μL of RNA enzyme inhibitor (Invitrogen TM, 10777019), 0.5 μL TS Oligo Primer and 1 μL SMARTScribe Reverse Transcriptase (Clontech), mix well by oscillation and place it in a PCR instrument for reverse transcription at 42 °C for 90 minutes, inactivate the enzyme at 70 °C for 15 minutes, and hold at 4 °C; take out the reacted product, add 0.5 μL PCR Primer, 12.5 μL NEBNext High Fidelity PCR Master Mix (NEB, M0541L), make up to 25 μL with ddH2O, mix well by oscillation and place it in a PCR instrument to run at 98 °C for 3 min, 98 °C for 15 s, 63 °C for 15 s, 72 °C for 6 min, cycle 8 times, 72 °C for 5 min, and hold at 4 °C to maintain a constant temperature. After PCR is completed, use 1× magnetic beads (VAHTS DNA clean beads (Vazyme, N411)) for DNA purification, and finally use an Agilent 2100 Bioanalyzer to analyze the product fragments and a Qubit 3.0 to measure the product concentration, and judge the quality of the product according to the fragment length distribution.
[0067] Construct a cDNA Illumina - solexa sequencing library
[0068] Use the novel transposase Tn5 for DNA fragmentation, turning the cumbersome steps such as DNA fragmentation, end repair, and adapter ligation reactions into a single simple enzymatic reaction, significantly reducing the input amount of the starting template and shortening the library construction time: take 6 μL of cDNA product, add 4 μL of TTBL and 5 μL of TTE Mix (Vazyme, TD503), make up to 20 μL with ddH2O, mix well by oscillation and place it in a PCR instrument, fragment and add adapters at 55 °C for 10 min. Immediately after the reaction ends, add 5 μL of reagent TS (Vazyme, TD503) and incubate at room temperature for 5 min to terminate the fragmentation reaction. The fragmented product is amplified with primers N5 (N5XX) and N7 (N7XX) ( Index Kit V2, Vazyme, TD202) through NEBNext High Fidelity PCR Master Mix (NEB, M0541L). Finally, the amplified product is purified with magnetic beads to obtain a sequencing - ready library. The quality inspection of the library uses an Agilent 2100 Bioanalyzer to analyze the product fragments and a Qubit 3.0 to measure the product concentration, and judge the quality of the product according to the fragment length distribution and concentration.
[0069] High - throughput sequencing
[0070] High-throughput sequencing was performed using Illumina Nova S4, and the basic sequencing data was analyzed: A total of sufficient Clean Reads were obtained: 127,228,429, and the Base>=Q30(%) was 94.67. This result indicates that the sequencing results of the full-length transcriptome of a small number of tumor cells in the present invention have sufficient data volume and high quality; through the basic analysis of the sequencing results, it shows that the method of the present invention is reliable and can be well applied to the high-throughput sequencing of the full-length transcriptome in small tumor cell samples.
[0071] When amplifying and enriching trace mRNA, the following steps are adopted:
[0072] I. Configure the following reaction system according to the following table:
[0073]
[0074] II. Prepare the annealing reaction system according to the following table:
[0075]
[0076] III. Run the following program in the PCR instrument:
[0077]
[0078] IV. Prepare the reverse transcription reaction system according to the following table:
[0079]
[0080]
[0081] V. Run the following program in the PCR instrument:
[0082]
[0083] VI. Capture with 10uL BeyoMag TM Streptavidin Magnetic Beads:
[0084] 1. Preparation of magnetic beads before capture:
[0085] a. Gently pipette to fully resuspend the streptavidin magnetic beads. Take 10uL of magnetic beads (for each sample) into a 200uL PCR tube, place it on the magnetic rack and let it stand for 2 minutes. After the solution becomes clear, aspirate and remove the supernatant;
[0086] b. Remove the PCR tube from the magnetic stand, add 200 uL of Bind and Wash Buffer (2X) (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 2 M NaCl, 0.01%-0.1% Tween-20), vortex to mix the magnetic beads evenly, centrifuge briefly and then place on the magnetic stand for 2 min. After the solution becomes clear, aspirate and remove the supernatant;
[0087] c. Repeat the above step b once;
[0088] d. Add 10 ul of Bind and Wash Buffer (2X) to resuspend the magnetic beads for later use.
[0089] 2. Streptavidin magnetic bead capture:
[0090] a. Add all of the above resuspended magnetic beads to the reaction solution after binding in step V, and shake at room temperature for 15 min;
[0091] b. Centrifuge briefly and then place on the magnetic stand for 2 min. After the solution becomes clear, aspirate and remove the supernatant;
[0092] c. Remove the PCR tube from the magnetic stand, add 100 uL of 1x Bind and Wash Buffer, resuspend the magnetic beads, centrifuge briefly and then place on the magnetic stand for 2 min. After the solution becomes clear, aspirate and remove the supernatant;
[0093] d. Remove the PCR tube from the magnetic stand, add 100 uL of 0.1% Tween, resuspend the magnetic beads, centrifuge briefly and then place on the magnetic stand for 2 min. After the solution becomes clear, aspirate and remove the supernatant;
[0094] e. Remove the PCR tube from the magnetic stand, add 12 uL of 0.1% Tween, resuspend the magnetic beads, centrifuge briefly and then place in the PCR instrument and run the following program: 95°C for 3 min, 25°C for ∞;
[0095] f. After the program ends, vortex and centrifuge briefly, place on the magnetic stand for 2 min, and aspirate 10 uL for the following experiment.
[0096] VII. Configure the PCR amplification reaction system according to the following table:
[0097]
[0098] VIII. Run the following program in the PCR instrument:
[0099]
[0100] IX. After the Clean Beads are balanced to room temperature, vortex and mix well. Pipette 25 μl of the beads into the above cDNA amplification reaction system, and use a pipette to mix more than 10 times to ensure the uniformity of the whole system;
[0101] X. Incubate at room temperature for 5 min. Briefly centrifuge the reaction tube and place it on a magnetic rack to separate the beads and the liquid. After the solution becomes clear (about 5 min), carefully remove the supernatant;
[0102] XI. Keep the PCR tube on the magnetic rack all the time. Add 200 μl of freshly prepared 80% ethanol, incubate at room temperature for 30 sec, carefully remove the supernatant, and repeat once for a total of two washes;
[0103] XII. After the beads are dried, remove the PCR tube from the magnetic rack, add 17 μl of Tris-Buffer to cover the beads, and use a pipette to blow and mix the beads well. Incubate at room temperature for 2 min, briefly centrifuge the PCR tube to collect it and then place it in the magnetic rack to separate the beads and the liquid until the solution becomes clear (about 5 min). Carefully pipette 15 μl of the supernatant and transfer it to a new low-binding EP tube, and store it at -20°C or proceed to the next step immediately.
[0104] For library construction and sequencing of the full-length cDNA amplification products, the following steps are adopted:
[0105] I. Prepare the following reaction system in a sterilized PCR tube:
[0106]
[0107]
[0108] II. Place the reaction tube in a PCR instrument and run the following reaction program:
[0109]
[0110] III. Immediately add 5 μl of 5×TS to the product after the reaction is completed, gently blow and mix well with a pipette, and place it at room temperature for 5 min;
[0111] IV. Place the PCR tube on ice and prepare the following reaction system:
[0112]
[0113] *8 types of N5XX and 12 types of N7XX can be optimized and selected according to the sample quantity and Index pairing strategy.
[0114] V. Gently blow and mix well with a pipette, place the reaction tube in a PCR instrument and run the following reaction program:
[0115]
[0116] VI. Vortex and mix the Clean Beads, and pipette 30 μL into 50 μL of the above PCR product. Vortex or pipette up and down 10 times to mix well, and incubate at room temperature for 5 min;
[0117] VII. Briefly centrifuge the reaction tube and place it on a magnetic stand to separate the magnetic beads from the liquid. After the solution becomes clear (about 5 min), carefully transfer the supernatant to a new sterile PCR tube and discard the magnetic beads;
[0118] VIII. Vortex and mix the Clean Beads, and pipette 7.5 μL into the supernatant. Vortex or pipette up and down 10 times to mix well, and incubate at room temperature for 5 min;
[0119] IX. Briefly centrifuge the reaction tube and place it on a magnetic stand to separate the magnetic beads from the liquid. After the solution becomes clear (about 5 min), carefully remove the supernatant;
[0120] X. Keep the reaction tube on the magnetic stand all the time, add 200 μL of freshly prepared 80% ethanol to wash the magnetic beads. Incubate at room temperature for 30 sec, carefully remove the supernatant, and repeat this step for a total of two washes;
[0121] XI. Keep the reaction tube on the magnetic stand all the time, open the lid and air-dry the magnetic beads for about 5 min. Take the reaction tube off the magnetic stand, add 22 μL of sterile ultrapure water for elution. Vortex or pipette up and down 10 times to mix well, and incubate at room temperature for 5 min;
[0122] XII. Briefly centrifuge the reaction tube and place it on a magnetic stand to separate the magnetic beads from the liquid. After the solution becomes clear (about 5 min), carefully pipette 20 μL of the supernatant into a new sterile PCR tube, and store it at -20°C or use it for next-generation sequencing.
[0123] As a control, the following conventional method was used to extract RNA from a small amount of tumor samples:
[0124] Select mRNA-seq V3 Library Prep Kit for Illumina (Vazyme)
[0125] 1. Take about 10 - 20 mg of fresh tissue (preserved in RNAlater solution), and extract total RNA using a commercially available tissue total RNA extraction kit, and perform quality control;
[0126] 2. Dissolve 100 ng of total RNA in nuclease-free ddH2O to a total volume of 50 μL, and place it on ice for later use;
[0127] 3. Slowly invert to thoroughly mix the mRNA Capture Beads. Pipette 50 μl and add it to the prepared RNA sample. Gently pipette up and down 10 times to mix well.
[0128] 4. Perform the first mRNA binding in a PCR machine: 65 °C for 5 min, 25 °C for 5 min.
[0129] 5. Place it on a magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant.
[0130] 6. Remove the sample from the magnetic stand, add 200 μl of Beads Wash Buffer to resuspend the magnetic beads. Gently pipette up and down 10 times to mix well and place it on the magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant.
[0131] 7. Remove the sample from the magnetic stand, add 50 μl of Tris Buffer to resuspend the magnetic beads. Gently pipette up and down 10 times to mix well.
[0132] 8. Perform mRNA elution in a PCR machine: 80 °C for 2 min, hold at 25 °C.
[0133] 9. Add 50 μl of Beads Binding Buffer. Gently pipette up and down 10 times to mix well.
[0134] 10. Let it stand at room temperature for 5 min to allow the mRNA to bind to the magnetic beads.
[0135] 11. Place it on a magnetic stand to separate the mRNA from the total RNA. After the solution becomes clear (about 5 min), carefully remove the supernatant.
[0136] 12. Remove the sample from the magnetic stand, add 200 μl of Beads Wash Buffer to resuspend the magnetic beads. Gently pipette up and down 10 times to mix well and place it on the magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant.
[0137] 13. Remove the sample from the magnetic stand, add 19.5 μl of Frag / Prime Buffer to resuspend the magnetic beads. Gently pipette up and down 10 times to mix well. Place the sample in a PCR machine. Fragmentation conditions: 94 °C for 8 min, hold at 4 °C.
[0138] 14. Place the sample on a magnetic stand. After the solution becomes clear (about 5 min), carefully pipette 17 μl of the supernatant into a new nuclease-free PCR tube and immediately perform the first-strand cDNA synthesis reaction. 15. Take out the 1st Strand Buffer from -20 °C, thaw it and invert it to mix well. Prepare the first-strand cDNA synthesis reaction mixture in the PCR tube: Fragmented mRNA
[0139] 16. Use a pipette to gently pipette up and down 10 times to mix well.
[0140] 17. Perform the first-strand cDNA synthesis reaction in a PCR machine: Heat lid at 105 °C on, 25 °C for 10 min, 42 °C for 15 min, 70 °C for 15 min, 4 °C hold.
[0141] 18. Take out the 2nd Strand Buffer from -20 °C, thaw it and invert it to mix well. Prepare the second-strand cDNA synthesis reaction mixture in the PCR tube: 1st Strand cDNA.
[0142] 19. Use a pipette to gently pipette up and down 10 times to mix well.
[0143] 20. Perform the second-strand cDNA synthesis reaction in a PCR machine: Heat lid at 30 °C on, 16 °C for 60 min, 4 °C hold.
[0144] 21. Pipette 90 μl (1.8×) of magnetic beads into the double-stranded cDNA purification, add 52.5 μl of nuclease-free H2O for elution, and pipette 50 μl of the supernatant into a new nuclease-free PCR tube.
[0145] 22. Take out the End Prep Mix 3 from -20 °C, thaw it and invert it to mix well. Prepare the end repair reaction mixture in the PCR tube: 50 μL of ds cDNA, End Prep Mix.
[0146] 23. Use a pipette to gently pipette up and down 10 times to mix well.
[0147] 24. Perform the end repair reaction in a PCR machine: Heat lid at 105 °C on, 20 °C for 15 min, 65 °C for 15 min, 4 °C hold.
[0148] 25. Prepare the following reaction in the PCR tube: 65 μL of End Preparation product, 25 μL of Rapid Ligation buffer, Rapid DNA Ligase.
[0149] 26. Perform the ligation reaction in a PCR instrument: Set the heated lid to 105°C On, hold at 20°C for 15 min, and hold at 4°C;
[0150] 27. Purify the ligation product using magnetic beads: Pipette 100 μl (1×) of magnetic beads into the ligation product for purification. Add 52.5 μl of nuclease-free ddH2O to elute the magnetic beads, and carefully pipette 50 μl of the supernatant into a new nuclease-free PCR tube;
[0151] 28. Pipette 50 μl (1×) of magnetic beads into the purified product from the previous step for purification. Add 22.5 μl of nuclease-free ddH2O to elute the magnetic beads, and carefully pipette 20 μl of the supernatant into a new nuclease-free PCR tube, and immediately perform PCR;
[0152] 29. Prepare the PCR reaction mixture in a PCR tube: 20 μl of the purified adapter-ligated product, 5 μl of PCR Primer Mix, and 25 μl of Amplification Mix 1;
[0153] 30. Place the sample in a PCR instrument and perform library amplification reaction: Set the heated lid to 105°C On, 98°C for 30 sec, 98°C for 10 sec, 60°C for 30 sec, 72°C for 30 sec, for 15 cycles, 72°C for 5 min, and hold at 4°C; 31. Pipette 50 μl (1×) of magnetic beads into the PCR product for purification. Add 25 μl of nuclease-free ddH2O to elute the magnetic beads, and carefully pipette 22.5 μl of the supernatant into a new nuclease-free PCR tube; 32. Evaluate the library quality using an Agilent 2100 Bioanalyzer, and assess the library concentration using Qubit. After passing the quality inspection, load the sample onto the sequencer for sequencing and analysis.
[0154] Example 1 Tumor cells from fresh puncture tissue of non-small cell lung cancer patients
[0155] Use a small number of tumor cells from fresh puncture tissue of non-small cell lung cancer patients to perform i) sequencing using the method of the present invention with a small sample size (5000 cells); ii) sequencing using the conventional mRNA sequencing disclosed in this specification with a small sample size (5000 cells): The results are shown in the following table:
[0156]
[0157]
[0158] Note: Reference range for qualified sequencing data of the library transfer combination:
[0159] Aligned_reads (%) > 70
[0160] mRNA_bases (%) > 60
[0161] Aligned_reads > 25,000,000
[0162] Example 2 Tumor cells from fresh tumor tissue of lung cancer patients
[0163] Using tumor cells from fresh tumor tissue of lung cancer patients, respectively, for i) conventional mRNA sequencing; ii) sequencing using a small sample size (5000) of tumor cells with the method of the present invention; iii) sequencing using a small sample size (5000) of tumor cells with the conventional mRNA sequencing disclosed in this specification: The results are shown in the following table:
[0164] Note: The reference range for qualified sequencing data of the library transfer combination:
[0165] Aligned_reads (%) > 70
[0166] mRNA_bases (%) > 60
[0167] Aligned_reads > 25,000,000
[0168] Example 3 Tumor cells in the blood of acute myeloid leukemia
[0169] Using tumor cells in the blood of acute myeloid leukemia, respectively, for i) conventional mRNA sequencing; ii) sequencing using a small sample size (5000) of tumor cells with the method of the present invention; iii) sequencing using a small sample size (5000) of tumor cells with the conventional mRNA sequencing disclosed in this specification: The results are shown in the following table:
[0170]
[0171] Note: The reference range for qualified sequencing data of the library transfer combination:
[0172] Aligned_reads (%) > 70
[0173] mRNA_bases (%) > 60
[0174] Aligned_reads > 25,000,000
[0175] By comparing the data of Example 1, Example 2, and Example 3, it shows that the mRNA sequencing with a small sample size using the method of the present invention has obvious non-obviousness.
[0176] Some beneficial effects of the present invention:
[0177] Through the comprehensive technical means such as the cell lysis reagent, separation reagent, high-fidelity amplification enzyme, and novel transposase Tn5 disclosed in the present invention, the library construction of cDNA products from a small number of tumor cells is satisfied. It is possible to construct a library and sequence for 5,000 - 10,000 tumor cells from fresh tumor samples. At the same time, it can well solve the problem that common single-cell amplification kits on the market cannot be directly used for transcriptome sequencing of tumor cells from fresh tumor samples. Through the technical solution disclosed in the present invention, starting from a sample lysed by more than 5,000 tumor cells from fresh tumor samples within 8 - 9 hours, the first strand of cDNA is obtained, and then the second strand of cDNA is generated. Then, with the linker segment as the primer anchor site, exponential amplification is carried out while adding Illumina library linkers to both ends of the cDNA to obtain a high-quality cDNA library that meets the requirements of downstream analysis. It is possible to amplify 10 - 20 ng of high-quality full-length double-stranded cDNA, with a reverse transcription and amplification library construction success rate of more than 95%. The cDNA library is fragmented by the transposase method, turning the cumbersome multi-step process into a simple one-step enzymatic reaction. More than 90% of gene expression can be detected in the library off-machine data, and the gene expression consistency exceeds 90%, with no obvious bias in amplification.
[0178] A kit for whole transcriptome sequencing of a small number of tumor cells from fresh samples, characterized in that it applies cell sorting magnetic beads, a cell lysis reagent, a separation reagent, a high-fidelity amplification enzyme, and transposase Tn5; wherein, the tumor cells are isolated from tumor tissue samples of tumor patients or PDX mouse models and are isolated tumor cells after digestion and cell sorting;
[0179] The components of the cell lysis reagent are as follows: 2 - 5 mol / L guanidine isothiocyanate, water-saturated phenol with a volume ratio of 1 - 25%, 2 mol / L sodium acetate, 0.1 - 0.5 mol / L dithiothreitol, 10 - 30 mmol / L potassium dihydrogen phosphate, and Sarcosyl with a mass percentage of 10 - 15%;
[0180] The components of the separation reagent are as follows: 1 - 6 μL of reaction solution S, 0.5 - 2 μL of protease inhibitor, 1 - 4 μL of dNTP Mix (10 mM), and 1 - 4 μL of Oligo(dT)VN Primer, wherein the components of reaction solution S are 0.1 - 0.5% Triton X-100 by mass percentage, 15 - 30 mM Tris-HCl pH 7.0 - 8.0, 10 - 15 mM NaCl, 0.5 - 2 μL of proteinase K, and 5 - 10 mM EDTA;
[0181] The high-fidelity amplification enzyme is NEBNext High Fidelity PCR Master Mix.
[0182] The cell sorting magnetic beads are selected from CD45 cell sorting magnetic beads and fibroblast sorting magnetic beads.
[0183] Regarding the technical problem described in
[0003] , that is, "Conventional RNA extraction methods lysate cells and tissues through denaturing agents such as guanidine isothiocyanate, while the proteins on ribosomes are denatured and nucleic acids are released; the released DNA and RNA are located in the middle phase and aqueous phase of the whole system respectively due to their different solubilities at a specific pH, so as to be separated; then organic solvents such as chloroform are used for extraction and precipitation to obtain pure RNA. Since RNA samples are easily degraded by environmental factors, especially RNase, extracting high-quality RNA is the key to successful sequencing. Currently, in scientific research activities in life sciences, low-sample RNA extraction is very challenging, and there are very strict requirements for sample selection and processing." The outstanding substantial technical effect of the solution provided by this patent is: Solution: "The components of the cell lysing reagent are as follows: 2 - 5 mol / L guanidine isothiocyanate, water-saturated phenol with a volume ratio of 1 - 25%, 2 mol / L sodium acetate, 0.1 - 0.5 mol / L dithiothreitol, 10 - 30 mmol / L potassium dihydrogen phosphate, and Sarcosyl with a mass percentage of 10 - 15%." Substantial technical effect: After testing, this lysate has good lysing effects on different tumor cells, can effectively inhibit the action of nucleases compared with conventional surfactants or enzymatic methods, and can effectively exclude other interferences to ensure the integrity and concentration of RNA.
[0184] Regarding the technical problem described in
[0004] , namely, "Compared to RNA extraction and sequencing in general scientific research activities, it is very difficult to accurately sequence mRNA in tumor cells from fresh ex vivo tumor tissue samples from tumor patients or PDX (patient-derived xenografts), especially when a small number of samples are used, the challenge is even greater." The outstanding substantial technical effect of the solution provided by this patent is that the present invention can, starting from a sample of 5,000 to 10,000 tumor cells after lysis, reverse transcribe the mRNA therein under the action of reverse transcriptase and obtain the first-strand cDNA within 8-9 hours, and then use the patented template-switching technology to add a linker sequence (with an expression quantitative molecular tag) to the 3' end of the cDNA and generate a second-strand cDNA, and then use the linker segment as a primer anchor site for exponential amplification while adding Illumina library linkers to both ends of the cDNA to obtain a high-quality cDNA library that meets the requirements of downstream analysis. A single reaction can amplify 10-20ng of high-quality, full-length double-stranded cDNA, depending on the input, with a 95%+ success rate for reverse transcription and amplification library construction. This performance, particularly for tumor cells, especially fresh ones, is groundbreaking.
[0185] Regarding the technical problems described in
[0005] , namely, "first, there is the problem of small tumor cell sample size and low quality. On the one hand, patients in the late stage of cancer are often unable to tolerate surgery and can only undergo puncture at most, and the amount of sample that can be obtained is very small; on the other hand, due to the death of some tumor cells and low activity caused by anti-tumor treatment, the effective tumor cells in the tumor sample tissue that can be obtained will become very limited. Due to the limitation of sample size and activity issues, this has invisibly hindered the further application of a small number of tumor cells in functional research while supplementing omics data (transcriptome high-throughput sequencing) in clinical practice." The outstanding substantial technical effect of the solution provided by this patent is that the patented technology can innovatively eliminate the influence of adverse factors such as tumor cell death and low activity in tumor cells on RNA extraction.
[0186] In response to the technical problem described in
[0006] , namely, "Currently, high-throughput transcriptome sequencing (RNA-Seq) of tumor cells has high requirements for the starting RNA amount of the sample, generally requiring at least micrograms (μg) of RNA. Tumor cells from tumor tissue samples obtained only by biopsy from inoperable tumor patients are difficult to meet the minimum sample size requirement, and further transcriptome sequencing library construction and sequencing cannot be carried out, or the sequencing results obtained are not of clinical value." The outstanding substantial technical effect of the solution provided by this patent is that the embodiments of this patent can use picograms (pg) of RNA in actual measurements.
[0187] Regarding the technical problem described in
[0007] , that is, "Secondly, since the preparation of tumor cell suspensions using tumor cells derived from fresh tumor cell samples has high requirements, compared with cell lines with stable heredity through culture and other normal cells, the tumor cell activities from fresh tumor samples vary greatly. If the cell activity in the cell suspension is insufficient, it will lead to RNA degradation." The outstanding substantive technical effect of the solution provided by this patent is that the suspension provided during the implementation of this patent can reduce the RNA degradation rate to the lowest level.
[0188] Regarding the technical problem described in
[0008] , that is, "Thirdly, it is the problem of the tumor immune infiltration microenvironment. On the one hand, the tumor cells isolated from in vitro tumor tissue samples will inevitably be mixed with connective tissue, fibroblasts, necrotic cells and other cells. On the other hand, due to the tumor microenvironment can lead to abnormal cell metabolism, the tumor cells isolated from in vitro tumor tissue samples will have various abnormal tumor-related metabolites. These tumor-related abnormal metabolites are sometimes prone to bind to RNA and be extracted together with RNA, hindering the separation of biologically active RNA. These factors will seriously affect the accuracy of RNA extraction and subsequent sequencing." The outstanding substantive technical effect of the solution provided by this patent is that this patent can break through the influence of cells such as connective tissue, fibroblasts, and necrotic cells innovatively, and can exclude the influence of related metabolites, achieving an extremely high success rate.
[0189] Regarding the technical problem described in
[0009] , that is, "Fourthly, it is the problem of tumor heterogeneity. Different from commonly used normal cells such as embryonic cells and stem cells or tumor cell lines after passage culture, the tumor cells from fresh in vitro tumor tissue samples of tumor patients or PDX have obvious heterogeneity. Different tumor cells from the same sample may belong to different subpopulations, and even tumor cells belonging to the same subpopulation will have variation phenomena. Due to the existence of heterogeneity, the components and morphologies of tumor cell membranes are also different, making the lysis conditions very harsh. It is necessary to ensure the lysis of all tumor cells while ensuring that RNA is not degraded. Conventional cell lysates such as proteinase K and surfactants often result in RNA degradation or incomplete lysis, ultimately leading to sequencing failure." The outstanding substantive technical effect of the solution provided by this patent is that this patent can ensure the lysis of all tumor cells while ensuring that RNA is not degraded, overcoming the chronic problems in the prior art.
[0190] Regarding the technical problem described in
[0010] , namely, "In addition, due to the existence of heterogeneity, mRNA sequencing of individual tumor cells is worthless and cannot provide any guidance for scientific research or clinical drug use. If mRNA sequencing is performed on all tumor cells in a tumor sample, a huge amount of tumor cells is required. On the one hand, the cost of performing full mRNA sequencing on a conventional clinical sample will be astronomical." The prominent substantive technical effect of the solution provided by this patent is: extremely low cost, achieving the best results with the most suitable samples. Additionally, it should be emphasized that the comprehensive solution of this patent simultaneously achieves the above effects.
[0191] The Chinese explanations and terms corresponding to all the English in the text and the table are as follows: cDNA: Complementary deoxyribonucleic acid
[0192] mRNA: Messenger ribonucleic acid
[0193] RNA: Ribonucleic acid
[0194] DNA: Deoxyribonucleic acid
[0195] Sarcosyll: Sodium lauroyl sarcosinate
[0196] PDX: Patient-derived xenograft model
[0197] RNA-Seq: Ribonucleic acid sequencing
[0198] PCR: Polymerase chain reaction
[0199] 5Prime3Prime_bias: 5' and 3' primer bias rate
[0200] Clean_reads: Clean data
[0201] Aligned_reads(%): Alignment data rate
[0202] Aligned_bases(%): Alignment base rate
[0203] mRNA_bases(%): Messenger RNA base rate
[0204] Ribosomal_bases(%): Ribosomal base rate
[0205] Coding_bases(%): Coding base rate
[0206] UTR_bases(%): Untranslated region base rate
[0207] Intronic_bases(%): Intron base rate
[0208] Intergenic_bases(%):Intergenic base rate
[0209] Aligned_reads:Aligned data
[0210] Read_length_mean:Average read length of data
[0211] Total_bases:Total number of bases
[0212] Aligned_bases:Number of aligned bases
[0213] Ribosomal_bases:Number of ribosomal bases
[0214] Coding_bases:Number of coding bases
[0215] UTR_bases:Number of bases in the untranslated region
[0216] Intronic_bases:Number of intronic bases
[0217] Intronic_bases:Number of intronic bases
[0218] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the claimed invention.
Claims
1. A method for whole transcriptome sequencing of tumor cells from a small amount of fresh samples, characterized in that, The method comprises the following steps: 1) Isolating tumor cells from a fresh tumor tissue sample, wherein the fresh tumor tissue sample is from a tumor patient or a PDX mouse model; 2) Lysing the isolated tumor cells: putting the isolated tumor cells into 500 uL of cell lysis reagent for lysis; the components of the cell lysis reagent are as follows: 2 - 5 mol / L guanidine isothiocyanate, water-saturated phenol with a volume ratio of 1 - 25%, 2 mol / L sodium acetate, 0.1 - 0.5 mol / L dithiothreitol, 10 - 30 mmol / L potassium dihydrogen phosphate, and Sarcosyl with a mass percentage of 10 - 15%; 3) Extracting trace total RNA and then further isolating mRNA; 4) Using Oligo(dT)Primer-biotin as the 3'-end reverse transcription primer, and performing reverse transcription on mRNA under the action of reverse transcriptase to obtain the first strand of full-length cDNA; 5) Adding an adapter primer to the 3'-end of the obtained first strand of cDNA without depending on a template under the Template-switching action of reverse transcriptase; 6) Using the cDNA obtained in step 5) as a template, specifically binding and eluting with streptavidin magnetic beads, and then using specific upstream and downstream primers to perform cDNA second strand generation and amplification under the action of a high-fidelity amplification enzyme; 7) After the second strand is generated, adding a transposase adapter mixture and a fragmentation buffer for fragmentation, end repair, and adapter ligation reactions, and terminating the reaction with a termination reaction solution 5xTS after the reaction ends, inactivating the transposase; 8) Adding a high-fidelity amplification enzyme, an amplification buffer, and an adapter primer to the product obtained in step 7) for PCR amplification; 9) Using magnetic beads to perform fragment sorting on the amplification product in step 8) to obtain a library for sequencing; Only 5000 - 10,000 tumor cells can meet the requirements of RNA and transcriptome sequencing for the remaining small amount of samples.
2. The whole transcriptome sequencing method for a small number of tumor cells from a fresh sample as claimed in claim 1, wherein For the tumor cells isolated from the fresh tumor tissue sample, the fresh tumor tissue sample is digested with 1X collagenase, and for the tumor cells using CD45 cell sorting magnetic beads and / or fibroblast sorting magnetic beads, after digestion and sorting, the tumor cell density in the tumor cell suspension is adjusted to (1-10)×10 5 cells / ml.
3. The whole transcriptome sequencing method for a small amount of tumor cells from a fresh sample as described in claim 1, wherein The separation reagent used for isolating mRNA in step 3) is: 1 - 6 μL of reaction solution S, 0.5 - 2 μL of RNase inhibitor, 1 - 4 μL of dNTP Mix (10 mM), and 1 - 4 uL of Oligo(dT)VN Primer, wherein the components of the reaction solution S are Triton X-100 with a mass percentage of 0.1 - 0.5%, 15 - 30 mM Tris-HCl pH 7.0 - 8.0, 10 - 15 mM NaCl, 0.5 - 2 μL of proteinase K, and 5 - 10 mM EDTA; the high-fidelity amplification enzyme is selected from one or more of KAPA HiFi DNA Polymerase, NEBNext High Fidelity PCR Master Mix, and Vazyme TruePrep Amplify Enzyme.
4. The method for whole transcriptome sequencing of a small amount of tumor cells from a fresh sample according to any one of claims 1-3, characterized in that, The tumor cells described above are derived from tumors in the following parts: digestive system, breast, lung, liver, endocrine gland, urinary and reproductive system, skeletal muscle system, nervous system, skin, head and neck, and blood system.
5. The whole transcriptome sequencing method for a small amount of tumor cells from a fresh sample as claimed in claim 4, wherein The tumor cells described above are tumor cells from fresh tumor tissues of lung cancer patients or tumor cells in the blood of patients with acute myeloid leukemia.
6. The method for whole transcriptome sequencing of tumor cells from a small amount of fresh samples as described in claim 5, wherein The tumor cells of fresh tumor tissues of the lung cancer patients described above are fresh puncture tissue tumor cells of non-small cell lung cancer.
7. The method for whole transcriptome sequencing of tumor cells from a small amount of fresh samples as described in claim 1, characterized in that, The transposase adapter mixture and fragmentation buffer are 4 μL TTBL and 5 μL TTE Mix (Vazyme, TD503).
8. Kit for whole transcriptome sequencing of a small number of tumor cells from fresh samples, characterized in that, It applies cell sorting magnetic beads, cell lysis reagents, separation reagents, high-fidelity amplification enzymes, and transposase Tn5; among them, The tumor cells are isolated from tumor tissue samples of tumor patients or PDX mouse models, and are isolated tumor cells that have been digested and cell sorted; The components of the cell lysis reagent are as follows: 2 - 5 mol / L guanidine isothiocyanate, water-saturated phenol with a volume ratio of 1 - 25%, 2 mol / L sodium acetate, 0.1 - 0.5 mol / L dithiothreitol, 10 - 30 mmol / L potassium dihydrogen phosphate, and Sarcosyl with a mass percentage of 10 - 15%; The components of the separation reagent are as follows: 1 - 6 μL reaction solution S, 0.5 - 2 μL protease inhibitor, 1 - 4 μL dNTP Mix (10 mM), and 1 - 4 μL Oligo(dT)VN Primer. Among them, the components of reaction solution S are Triton X-100 with a mass percentage of 0.1 - 0.5%, 15 - 30 mM Tris-HCl pH 7.0 - 8.0, 10 - 15 mM NaCl, 0.5 - 2 μL protease K, and 5 - 10 mM EDTA; The high-fidelity amplification enzyme is NEBNext High Fidelity PCR Master Mix.
9. The kit for whole transcriptome sequencing of a small number of tumor cells from a fresh sample as claimed in claim 8, wherein, The cell sorting magnetic beads are selected from CD45 cell sorting magnetic beads and fibroblast sorting magnetic beads.
Citation Information
Patent Citations
Transcription isothermal amplification technique for reducing nonspecific amplification of primer dimers
CN102533963A
Sequencing library construction method and kit for pathogenic microorganism detection
CN111188094A
Construction method of single cell transcriptome sequencing library and applications thereof
CN113444770A
Top-speed RNA library building method and kit
CN113718343A