KASP molecular marker tightly linked to the major QTL for plant height in highland barley, its primers, and their application
By developing the PH_K02 KASP molecular marker on chromosome 3 of high barley, the problem of identifying high-trait traits in high barley plants was solved, high-throughput rapid identification and breeding assistance were achieved, and high-yield, resistant to lodging breeding of high barley was supported.
Patent Information
- Application Number
- CN202211447065.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-18
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2042-11-18
AI Technical Summary
The lack of KASP molecular markers closely linked to the high traits of barley plants in the prior art, which makes it difficult to achieve high-throughput rapid identification and breeding of barley resistant to lodging.
The PH_K02 KASP molecular marker located on chromosome 3 of Qingbai was developed, with A/G mutations in the sequence, and forward primer F, reverse primer R1 and reverse primer R2 were designed for rapid identification and breeding assistance of high traits of Qingbai plant.
It has achieved high-throughput rapid identification of the high-rise barley plant height type during the seedling stage, and provided technical support for the selection and breeding of new varieties with high yield and lodging resistance, which has important application value.
Smart Images

Figure CN116042893B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to a KASP molecular marker tightly linked to a major effect QTL of highland barley plant height, a primer thereof and an application thereof. Background Art
[0002] Highland barley, a genus of the Poaceae family, is a cultivated barley variety known as naked barley because its inner and outer palea husks are separated from the grain, exposing its fruiting organs. On the Qinghai-Tibet Plateau, it is collectively referred to as highland barley. Highland barley is an important food crop, forage crop, and industrial raw material for brewing and functional food processing on the Qinghai-Tibet Plateau. It plays a vital and unique role in food security, regional stability, and industrial development in Tibet. Highland barley stems have a low degree of fibrosis and are prone to lodging under high-water and fertilizer conditions. With global warming, extreme rainfall is becoming more frequent in high-altitude and cold regions, making lodging of highland barley a major concern, leading to yield reductions or even total crop failure. Therefore, highland barley lodging has become a bottleneck limiting further increases in highland barley yields, making breeding for lodging resistance urgent. Dwarfism is the most important trait in field selection for lodging resistance breeding of highland barley. As a complex quantitative trait, there are few reports on its genetic laws, adaptation mechanisms, variety selection, and the pleiotropic effects of highland barley dwarfing genes on spike type-related traits. Although dwarfing genes have been located and utilized in barley production, the differences in genetic background between barley and highland barley limit the effective utilization of related loci in lodging resistance breeding of highland barley.
[0003] KASP (Kompetitive Allele-Specific PCR), or competitive allele-specific PCR, can accurately identify biallelic loci for SNPs and InDels at specific loci in a wide range of genomic DNA samples (even those with complex genomes). This method can be applied to QTL fine mapping, molecular-assisted breeding, germplasm resource identification, and large-sample molecular marker validation. Therefore, the development of KASP molecular markers tightly linked to the dwarf trait in highland barley allows for high-throughput and rapid identification of plant height types at the seedling stage, providing effective technical support for the breeding of new high-yield and lodging-resistant highland barley varieties and possessing significant application value.
[0004] However, there are currently no reports of KASP molecular markers that are closely linked to the plant height trait of highland barley. Summary of the Invention
[0005] The purpose of the present invention is to provide a KASP molecular marker tightly linked to a major QTL for plant height in highland barley, so as to provide a basis for breeding new high-yield and lodging-resistant highland barley varieties.
[0006] The present invention provides a KASP molecular marker tightly linked to a major QTL for plant height in highland barley. The KASP molecular marker is PH_K02 located on chromosome 3 of highland barley, and the sequence is shown in SEQ ID NO.1. An A / G mutation exists at position 225 of PH_K02.
[0007] Furthermore, the above-mentioned A / G mutation is located at position 464680174 of the full-length sequence of highland barley chromosome 3.
[0008] The present invention also provides the application of the KASP molecular marker in the positioning of highland barley plant height genes or as a molecular marker for highland barley auxiliary breeding.
[0009] The present invention also provides primers for amplifying the above-mentioned KASP molecular marker.
[0010] Furthermore, the above primers include a forward primer F, a reverse primer R1 and a reverse primer R2; the nucleotide sequence of the forward primer F is shown in SEQ ID NO.2, the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer R2 is shown in SEQ ID NO.4.
[0011] The present invention also provides a kit for detecting the plant height trait of highland barley, comprising the above primers.
[0012] The present invention also provides the application of the primers or kit in highland barley gene typing, plant height trait identification or assisted breeding.
[0013] The present invention also provides a method for identifying highland barley plant height traits, comprising the step of using the above-mentioned kit to perform PCR amplification reaction on the extracted highland barley germplasm resource genomic DNA.
[0014] Furthermore, the above method comprises the following steps:
[0015] (1) Extracting genomic DNA from the highland barley germplasm resources to be tested;
[0016] (2) performing a PCR amplification reaction on the DNA obtained in step (1) using the kit according to claim 6;
[0017] (3) Read the fluorescence data of the reaction product and determine the genotype based on the fluorescence signal results;
[0018] (4) Determine the height of highland barley plants based on genotype.
[0019] Furthermore, in step (4), the genotype is G:G genotype, and the barley is judged to be dwarf barley; or, the genotype is A:A genotype, and the barley is judged to be tall barley.
[0020] Beneficial effects of the present invention: The present invention utilizes F2 and F 2:3 A major QTL for plant height in highland barley, cqPH3H-1, was identified, and a KASP molecular marker, PH_K02, was successfully developed in this major QTL region. This KASP molecular marker is the first reported to be tightly linked to the dwarf trait in highland barley. The KASP molecular marker PH_K02 contains an A / G mutation at position 225 (464,680,174 bp on chromosome 3 of the highland barley genome), indicating that the variant site G is tightly linked to the dwarf trait, while the variant site A is tightly linked to the tall trait. This marker can be used to screen for the dwarf trait in highland barley, enabling high-throughput and rapid identification of highland barley plant height types during the seedling stage. This provides effective technical support for the selection and breeding of highland barley varieties with ideal plant structure and possesses significant application value.
[0021] The term QTL in the present invention is the abbreviation of quantitative trait locus, which can be translated into quantitative trait locus or quantitative trait gene locus in Chinese, and refers to the position of the gene controlling the quantitative trait in the genome.
[0022] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.
[0023] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 This is a comparison chart of plant height of parental materials.
[0025] Figure 2 The distribution of plant height QTL on seven chromosomes of highland barley.
[0026] Figure 3 This is the genotyping map of KASP molecular marker PH_K02 in 380 germplasm resources. DETAILED DESCRIPTION
[0027] Unless otherwise specified, the experimental methods used in the present invention are conventional methods, and the raw materials and equipment used in the present invention are known products purchased through commercial channels.
[0028] The high-stalk, large-grain barley variety 56 ( Figure 1Left), 417 dwarf, dense straight-spike highland barley varieties and 380 germplasm resources are breeding materials collected by the Plateau Ecological Agriculture Research Center of the Northwest Plateau Institute of Biology, Chinese Academy of Sciences.
[0029] Example 1. QTL Mapping of Highland Barley Plant Height Traits
[0030] Using highland barley varieties 56 ( Figure 1 left) and 417( Figure 1 Right) Configure hybrid combinations, self-pollinate the resulting F1, and obtain F2 populations and F 2:3 Family lineage.
[0031] 2. Phenotypic Investigation
[0032] F2 and F 2:3 Carry out multi-year and multi-environment deployment, 2020 / 2021 Huangzhong, 2020 Yunnan, 2021 Wuwei, 2021 Gannan, each F 2:3 Sow 15 grains of barley, and record the height of each plant when the barley matures, and use the average value of the 15 plants as the corresponding F2 phenotypic value. 2:3 Plant height had a unimodal skewed normal distribution and was a quantitative trait.
[0033] 3. Construction of genetic linkage map
[0034] Genomic DNA was extracted from 220 F2 lines and their parents. The DNA was then tested, library constructed, sequenced, and quality-controlled. The lines were then aligned to the reference genome of the barley database (http: / / plants.ensembl.org / Hordeum_vulgare / Info / Index) for single nucleotide polymorphism screening (SNPs), polymorphic marker development between the parents, progeny genotyping, and genetic marker screening. A genetic linkage map was constructed using JoinMap 4.0, combining the genotypes of the developed molecular markers.
[0035] 4. QTL Mapping of Plant Height
[0036] Combined with linkage map marker genotypes and multi-environment phenotypic data, WinQTLCart2.5 CIM mapping method was used to map the F2 and F 2:3 QTL analysis of plant height was performed, and a major QTL locus cqPH3H-1 for plant height was located in multiple environments. It is located in the 463.5Mb-466.2Mb segment of chromosome 3H, explaining 26.40% to 67.35% of the phenotypic variation in plant height. Figure 2 Based on the above results, the major QTL locus cqPH3H-1 for highland barley plant height was obtained.
[0037] Example 2: Development of KASP molecular markers tightly linked to the major QTL for highland barley plant height and primers thereof
[0038] Based on the cqPH3H-1 mapping region and collinear alignment with barley homologs, the barley BRI1 gene was identified as a candidate gene. Analysis of the BRI1 gene structure revealed a single exon, and amplification primers were designed based on the BRI1 sequence. Allelic sequencing revealed two single nucleotide polymorphisms (SNPs) at positions 1767 and 2570, with the SNP at position 2570 being a non-synonymous mutation. This mutation, when expressed as a G:G pair, is closely linked to the dwarf trait in highland barley. Primers were designed using the Gramene website, flanking 200 bp of the SNP on either side of the barley reference gene. A KASP molecular marker targeting this SNP was designed and named PH_K02.
[0039] The sequence of PH_K02 (SEQ ID NO.1) is:
[0040] TGCTGCATTTGAGAAGCCACTGCAGAAACTCACCTTGGGTGATCTTGTTGAGGCCACCAATGGCTTCCACAATGATAGCTTGATTGGGTTCTGGTGGATTTGGTGATGTCTACAAGGCACAGCTCAAGGATGGGAGGGTTGTTGCTATCAAGAAGCTAATACATGTGAGTGGCCAGGGTGACCGGGAGTTCACAGCGGAAATGGAGACCATTGGCAAGATCAAAC [A / G] CCGCAACCTTGTTCCGCTCCTCGGCTACTGCAAGATCGGCGAGGAGCGGCTGCTGATGTATGACTTCATGAAGTATGGCAGCTTGGAGGATGTGCTGCACGACCGCAAAAAGATTGGGGTAAGGCT (the underlined part is the SNP variation site).
[0041] The designed molecular marker primers include forward primer F, reverse primer R1 and reverse primer R2; the 5' end of reverse primer R1 is connected to a fluorescent tag sequence of the FAM group, and the 5' end of reverse primer R2 is connected to a fluorescent tag sequence of the VIC group.
[0042] The nucleotide sequence of the forward primer F (SEQ ID NO.2) is:
[0043] CGGAAATGGAGACCATTGGCAAG,
[0044] The nucleotide sequence of reverse primer R1 (SEQ ID NO.3) is:
[0045] GAAGGTGACCAAGTTCATGCT GCGGAACAAGGTTGCGGT (the underlined part is the fluorescent tag sequence of the FAM group);
[0046] The nucleotide sequence of reverse primer R2 (SEQ ID NO.4) is:
[0047] GAAGGTCGGAGTCAACGGATT GCGGAACAAGGTTGCGGC (the underlined part is the fluorescent tag sequence of the VIC group).
[0048] Example 3: Application of molecular marker PH_K02 in natural populations
[0049] 380 germplasm resources were genotyped using KASP molecular marker PH_K02 primers. The specific operation method is as follows:
[0050] Young leaves of 380 germplasm resources were extracted, and genomic DNA of the samples was obtained by CTAB extraction. PCR amplification was performed using the primer set designed in Example 2. The PCR amplification reaction system is shown in Table 1. PCR amplification was completed in a water bath thermal cycler. The touchdown PCR reaction conditions were as follows: pre-denaturation at 94°C for 15 minutes; the first amplification reaction was denaturation at 94°C for 20 seconds, annealing and extension at 65°C to 57°C for 60 seconds, for 10 cycles, with the annealing and extension temperature decreasing by 0.8°C each cycle; the second amplification reaction was denaturation at 94°C for 20 seconds, annealing and extension at 57°C for 60 seconds, for 30 cycles. In the described typing method, after the reaction is completed, the KASP reaction product is fluorescently read using an Arraytape scanning system, and the results of the fluorescence scanning are automatically converted into graphics. When PH_K02 is aggregated on the X-axis and the fluorescence signal is blue, it is a dwarf barley genotype (G:G genotype); when PH_K02 is aggregated on the Y-axis and the fluorescence signal is red, it is a tall barley genotype (A:A genotype).
[0051] Table 1. KASP detection reaction system
[0052]
[0053]
[0054] The results of the test on 380 germplasm resources are shown in Table 2 and Figure 3. The genotype of 373 samples among the 380 resources was "A:A"; the allele type of 7 samples was "G:G". Combining the phenotypic and genotypic analysis of the tested materials, it was found that the 7 test materials with the genotype of "G:G" were all dwarf types. This shows that when the SNP variant site at the 464680174bp position on chromosome 3 is G, it is closely linked to the dwarf trait of highland barley. The corresponding PH_K02 is a KASP molecular marker closely linked to cqPH3H-1, which can effectively detect the dwarf trait of highland barley.
[0055] Table 2. Detection results of PH_K02 marker in 380 germplasm resources
[0056]
[0057]
[0058]
[0059]
[0060] At the same time, multiplex PCR primers were designed targeting the BRI1 gene sequence and amplified from 380 natural resources. Haplotypes (SNPs) were counted, resulting in 101 haplotypes (SNPs). GWAS analysis was performed using all SNPs, combined with the plant height phenotype. The strongest association signal was located at the SNP at position 464,680,174 bp on chromosome 3 (p = 2.05E-06). The GWAS results were consistent with those of the KASP marker, demonstrating the accuracy of the KASP marker detection results. These results further confirm that the KASP marker PH_K02 can efficiently and stably detect the dwarf trait in highland barley, enabling high-throughput and rapid identification of plant height types in highland barley at the seedling stage. This provides effective technical support for the selection and breeding of ideal highland barley varieties with ideal plant structure and has important application value.
Claims
1. A KASP molecular marker tightly linked to the main QTL for plant height in highland barley, characterized by: The KASP molecular marker is PH_K02 located on chromosome 3 of highland barley, and the sequence is shown in SEQ ID NO.
1. There is an A / G mutation at position 225 of PH_K02.
2. Use of the KASP molecular marker according to claim 1 in the positioning of the highland barley plant height gene cqPH3H-1 or as a molecular marker for auxiliary breeding of highland barley plant height traits.
3. A method for identifying highland barley plant height traits, characterized in that: The identification method comprises the following steps: (1) Extracting genomic DNA from the highland barley germplasm resources to be tested; (2) performing a PCR amplification reaction on the DNA obtained in step (1); (3) Read the fluorescence data of the reaction product and determine the genotype based on the fluorescence signal results; (4) Determine the height of highland barley plants based on genotype; The amplification in step (2) is performed by amplifying the KASP molecular marker according to claim 1 using a forward primer F having a nucleotide sequence as shown in SEQ ID NO.2, a reverse primer R1 having a nucleotide sequence as shown in SEQ ID NO.3, and a reverse primer R2 having a nucleotide sequence as shown in SEQ ID NO.4; The genotype of step (4) is G:G genotype, and the highland barley is judged to be short-stalked highland barley; or, the genotype is A:A genotype, and the highland barley is judged to be tall-stalked highland barley.