Medical use of substances for knocking down or inhibiting long non-coding RNA JPX

Abstract

The present application provides the medical use of substances that knock down or inhibit long non-coding RNA JPX, specifically, the use of substances that knock down or inhibit lncRNA JPX in the preparation of drugs for preventing and treating cardiovascular diseases caused by aging; in patients with atherosclerosis caused by aging and cells and animal models related to atherosclerosis, it was found that inhibiting lncRNA JPX can inhibit aging and delay the progression of atherosclerosis; the present application provides a new target for the diagnosis and treatment of vascular diseases related to atherosclerosis caused by aging, and opens up a new direction for the preparation of preventive and therapeutic drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and relates to the medical use of a substance that knocks down or inhibits long non-coding RNA JPX, and specifically relates to the use of a substance that knocks down or inhibits lncRNA JPX in the preparation of a drug for preventing and treating vascular diseases related to atherosclerosis caused by aging. Background Art

[0002] With the development of society, cardiovascular diseases (CVDs) are gradually becoming a global problem threatening human health due to their high morbidity, high disability rate and high mortality rate. It is expected that by 2030, CVDs will continue to be the main cause of death in the world. Among them, atherosclerosis (AS) is the common pathological and physiological basis of stroke, ischemic heart disease and peripheral vascular disease. It is caused by multiple risk factors such as hypertension, hyperlipidemia and genetics. In addition, some unhealthy lifestyles will aggravate the occurrence and development of AS, such as high-fat and high-cholesterol diet, obesity, smoking, lack of exercise and long-term sitting. The pathological development of AS is a typical age-dependent process. AS is a chronic vascular inflammatory disease, and its main pathological features are lipid deposition in the vascular endothelium, accompanied by smooth muscle cell and fibrous matrix proliferation, which gradually develops into AS plaques. With the deepening of research, researchers have found that various senescent cells in blood vessels are closely related to the pathological and physiological changes of AS. At the same time, the SASP secreted by senescent cells can also lead to the progression and imbalance of AS plaques. Under the stimulation of pathogenic factors, senescent vascular smooth muscle cells (HVSMCs) can form a variety of SASPs, promote monocyte chemotaxis, stimulate and affect the homeostasis of adjacent non-senescent HVSMCs cells and tissues; senescent HVSMCs can also secrete matrix-degrading proteases, leading to reduced cell proliferation, promoting thinning of the fibrous cap, and affecting the stability of plaques; at the same time, senescent HVSMCs produce less collagen than normal HVSMCs, which will further affect the stability of plaques. Therefore, cell senescence has gradually been regarded as one of the main risk factors for AS-related cardiovascular disease.

[0003] With the in-depth study of epigenetics, people are increasingly aware that long non-coding RNAs (lncRNAs) show high cell and tissue specificity, as well as their role as regulatory factors in cells. Many studies have shown that lncRNAs are closely related to embryonic development, cell apoptosis, tissue growth, etc., and are a type of regulatory factor that is widely expressed in human tissues. In recent years, the modification role of lncRNA in the pathogenesis of AS has also attracted widespread attention. Studies have confirmed that lncRNA H19, lncRNA MALAT1, lncRNA P21, lncRNA ANRIL, etc. can participate in the influence of cell proliferation, apoptosis and other processes through the two main regulatory pathways of p53 / p21 and p16 / Rb, thereby participating in cell senescence and the occurrence and development of AS. Many lncRNAs have been reported to regulate the activation of nuclear factor κB (NF-κB) and its downstream target genes. These findings have raised the hypothesis that lncRNAs may play a key role in SASP-induced AS during aging. The lncRNA JPX gene is located at site 12 on the long arm of the X chromosome. It is an activator of the XIST gene and a molecular switch for X chromosome inactivation. It can positively regulate the expression of XIST, thereby participating in X chromosome inactivation. As a lncRNA, JPX has been shown to target hundreds of autosomal genes. Compared with its performance in the genome, it prefers to bind to promoters, proximal regions of transcription start or transcription termination sites, exons and introns. JPX can regulate gene expression by expelling transcription factors or cooperating with many important transcription factors. Related literature reports that lncRNA JPX can promote tumor cell proliferation, migration and invasion, and participate in the occurrence and development of various cancers such as lung cancer, gastric cancer and cervical cancer. However, whether lncRNA JPX can participate in cell senescence by regulating the SASP gene and thus affect AS has not been reported. Summary of the invention

[0004] In response to the above problems, the present application provides a medical use of a substance for knocking down lncRNA JPX.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] Use of a substance that knocks down or inhibits lncRNA JPX in the preparation of a drug for preventing and treating cardiovascular diseases caused by aging. As a preferred embodiment of the present invention, the substance that knocks down or inhibits lncRNA JPX includes a small interfering RNA that knocks down lncRNA JPX or a gene editing system that knocks out lncRNA JPX, such as a currently known gene editing system that can knock out or inhibit a target gene, such as a CRISP / Cas9 gene editing system.

[0007] As a further preferred embodiment of the present invention, the siRNA sequence for knocking down lncRNA JPX is shown as CCAGUUAAUAGUAUUGUGUTT (SEQ ID NO.1) and ACACAAUACUAUUAACUGGTT (SEQ ID NO.2). As a preferred embodiment of the present invention, the drug for preventing and treating cardiovascular diseases caused by aging includes a drug for preventing and treating atherosclerosis.

[0008] Application of lncRNA JPX as a target in screening drugs for preventing and treating cardiovascular diseases caused by aging.

[0009] A method for screening drugs for preventing and treating cardiovascular diseases caused by aging, comprising administering a candidate drug to Ras-induced senescent HVSMCs, detecting the expression of lncRNA JPX, and if lncRNA JPX is inhibited, it indicates that the candidate drug has in vitro activity for preventing and treating cardiovascular diseases caused by aging; or administering a candidate drug to an animal model of cardiovascular diseases caused by aging, detecting the expression of lncRNA JPX, and if lncRNA JPX is inhibited, it indicates that the candidate drug has in vivo activity for preventing and treating cardiovascular diseases caused by aging.

[0010] Application of lncRNA JPX as a detection target in the preparation of auxiliary detection reagents for aging-induced atherosclerosis.

[0011] Application of substances for detecting lncRNA JPX in preparing auxiliary detection reagents for aging-induced atherosclerosis.

[0012] As a preferred embodiment of the present invention, the substance for detecting lncRNA JPX is a substance for quantitatively detecting lncRNA JPX.

[0013] As a further preferred embodiment of the present invention, the substance for quantitatively detecting lncRNA JPX is a specific primer pair of lncRNA JPX.

[0014] Beneficial effects:

[0015] This application uses Western Blot, cell immunofluorescence and other methods to study the Apoe - / - The expression of lncRNA JPX in mouse aorta tissue and human vascular smooth muscle. Knockout mice that specifically interfere with lncRNA JPX were constructed and synthesized; 8-week-old Apoe - / -Mice were randomly divided into a control group and a lncRNA JPX knockout group. The mice in the control group and the lncRNA JPX knockout group were intravenously injected with nonspecific control or lncRNA JPX gapmeRs (10 mg / kg per mouse) twice a week, and continuously injected and fed with a high-fat diet for 16 weeks to construct an AS mouse model. The present invention clarifies for the first time the regulatory mechanism of lncRNA JPX on HVSMCs, effectively prevents the aging of HVSMCs and the occurrence of AS caused by it, and provides a new preventive and therapeutic drug development approach and drug action target for the diagnosis and treatment of AS, which has very important medicinal value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the expression level of lncRNA JPX in normal HVSMCs (denoted by Con in the figure) and Ras-induced senescent HVSMCs (denoted by Ras in the figure);

[0017] The detection method was to detect the expression levels of lncRNA JPX in normal and Ras-induced senescent HVSMCs by real-time quantitative PCR (RT-qPCR).

[0018] Figure 2 Schematic diagram of knocking out lncRNA JPX in HVSMCs, giving Ras stimulation, and detecting the expression levels of P16, P21, and P53 proteins by Western Blot;

[0019] The detection method was as follows: HVSMCs were stimulated with silncRNA JPX for 24 hours to knock down lncRNA JPX, and then stimulated with Ras for 24 hours, and the expression levels of P16, P21, and P53 proteins were detected by Western Blot.

[0020] Figure 3 Schematic diagram of knocking out lncRNA JPX in HVSMCs, giving Ras stimulation, and detecting HVSMCs senescence by β-galactosidase staining;

[0021] The detection method is: give HVSMCs silncRNA JPX stimulation for 24 hours to knock down lncRNA JPX, then give Ras stimulation for 24 hours, and use β-galactosidase staining experiment to detect the aging of HVSMCs.

[0022] Figure 4Schematic diagram of knocking out lncRNA JPX in HVSMCs, giving Ras stimulation, and detecting the expression levels of SASP genes such as IL-6, IL-8, IL-1β, CCL2, ICAM-1, and TNF-α by real-time quantitative PCR (RT-qPCR); the detection method is: giving HVSMCs lncRNA JPX stimulation for 24 hours to knock down lncRNA JPX, then giving Ras stimulation for 24 hours, extracting cell RNA, and using qRT-PCR to detect the expression levels of SASP genes such as IL-6, IL-8, IL-1β, CCL2, ICAM-1, and TNF-α.

[0023] Figure 5 Apoe in normal (NC) and high-fat (HFD) diets - / - Schematic diagram of the expression level of lncRNA JPX in mouse vascular tissue.

[0024] Detection method: Select 8-week-old Apoe - / - Mice were randomly divided into a control group and a high-fat diet group, and the AS mouse model was established by high-fat diet for 16 weeks. Subsequently, the mouse vascular tissues were collected, and RNA was extracted for qRT-PCR experiments to detect the expression level of lncRNA JPX in blood vessels of normal diet and high-fat diet.

[0025] Figure 6 This is the picture of Oil Red O staining test results of mouse model;

[0026] The detection method is: select 8-week-old Apoe - / - Mice were randomly divided into a control group and a lncRNA JPX knockout group. The control group and lncRNA JPX knockout group mice were intravenously injected with nonspecific control or lncRNA JPXgapmeRs (10 mg / kg per mouse) twice a week, and continued to be injected and fed with a high-fat diet for 16 weeks to establish the AS mouse model. Subsequently, the aorta was collected and the size of the plaque was detected by Oil Red O staining.

[0027] Figure 7 Schematic diagram of detecting the expression levels of P16, P21, and P53 proteins in mouse vascular tissue by Western Blot;

[0028] The detection method is: select 8-week-old Apoe - / -Male mice were randomly divided into a control group and a lncRNA JPX knockout group. The control group and the lncRNA JPX knockout group were intravenously injected with nonspecific control or lncRNA JPXgapmeRs (10 mg / kg per mouse) twice a week, and the injection was continued and the mice were fed a high-fat diet for 16 weeks to establish the AS mouse model. Subsequently, the mouse vascular tissue was collected, the mouse vascular tissue protein was extracted, and the expression levels of p-STING, STING, p-TBK1, TBK1, p-IRF3, IRF3, P16, P21, and P53 proteins were detected by Western Blot.

[0029] Figure 8 This is a picture of the immunofluorescence test results of the mouse model;

[0030] The detection method is: select 8-week-old Apoe - / - Male mice were randomly divided into a control group and a lncRNA JPX knockout group. The control group and lncRNA JPX knockout group mice were intravenously injected with nonspecific control or lncRNA JPXgapmeRs (10 mg / kg per mouse) twice a week, and continued to be injected and fed with a high-fat diet for 16 weeks to establish an AS mouse model. The expression levels of P21 and α-SMA in mouse aortic tissue sections were measured: the mouse aortic tissue was extracted and embedded in OCT, and the expression of P21 and α-SMA was detected by immunofluorescence after frozen sections. Red (A) represents P21, green (C) represents α-SMA, and blue (B) represents the nucleus. The white arrows indicate the co-localization yellow area of ​​red and green.

[0031] Fig. 9 Schematic diagram of the expression levels of SASP genes such as IL-6, IL-8, IL-1β, CCL2, ICAM-1, and TNF-α detected by real-time quantitative PCR (RT-qPCR) in mouse vascular tissue;

[0032] The detection method is: select 8-week-old Apoe - / - Male mice were randomly divided into a control group and a lncRNA JPX knockout group. The control group and lncRNA JPX knockout group mice were intravenously injected with nonspecific control or lncRNA JPXgapmeRs (10 mg / kg per mouse) twice a week, and continued to be injected and fed with a high-fat diet for 16 weeks to construct an AS mouse model. RNA was extracted from the mouse aorta tissue, and the expression levels of SASP genes such as IL-6, IL-8, IL-1β, CCL2, ICAM-1, and TNF-α were detected by qRT-PCR. DETAILED DESCRIPTION

[0033] The following examples will enable those skilled in the art to fully understand the present invention, but are not intended to limit the present invention in any way.

[0034] The sources of cells and reagents involved in the following examples are:

[0035] Human vascular smooth muscle cells (HVSMCs) were purchased from ScienCell.

[0036] Apoe - / - Mice: 8-week-old male mice were purchased from Weitonglihua Experimental Animal Technology Co., Ltd.

[0037] The cell experiments involved in the following examples were approved by the Ethics Committee of Nanjing Medical University.

[0038] siJPX: synthesized by Shanghai Genema Gene Co., Ltd. The nucleotide sequence of the sense strand is: 5'-CCAGUUAAUAGUAUUGUGUTT-3' (SEQ ID NO.1), and the nucleotide sequence of the antisense strand is: 5'-ACACAAUACUAUUAACUGGTT-3' (SEQ ID NO.2).

[0039] Example 1 Detection of the correlation between lncRNA JPX and AS caused by aging

[0040] In order to explore the level of lncRNA JPX in normal and Ras-induced senescent HVSMCs and verify whether lncRNA JPX is involved in AS, the present example used qRT-PCR to detect the expression level of lncRNA JPX in normal and Ras-induced senescent HVSMCs.

[0041] Referring to Oncogenic ras Provokes Premature Cell Senescence Associated with Accumulation of p53 and p16INK4a, the experimental steps for constructing senescent HVSMCs are as follows:

[0042] (1) Plant 5x10 in a 10 cm dish 6 Phoenix cell culture;

[0043] (2) Change the medium on the second day and add 6 mL of fresh culture medium to continue culturing;

[0044] (3) Take 20 μg of the target plasmid (pBabe-H-Ras V12 ) + 0.4 μg VSV-G plasmid was dissolved in 1 mL Opti-MEM and gently mixed;

[0045] (4) Dissolve 12 μL of lipo2000 in 1 mL of Opti-MEM and mix gently;

[0046] (5) Both were left to stand at room temperature for 5 min;

[0047] (6) Combine the plasmid and lipo2000 and let stand for 20 minutes;

[0048] (7) Add the above mixture dropwise to the culture dish seeded with cells and gently shake to mix;

[0049] (8) After culturing at 37°C for 15 h, the medium was changed and discarded, and 6 mL of fresh medium was added to each dish of cells;

[0050] (9) After 48 h of culture, the first cell supernatant was collected, filtered through a 0.45 μm filter, and stored at 4°C;

[0051] (10) Add 6 mL of fresh culture medium and continue culturing the cells for 8 h. Collect the second supernatant, filter it through a 0.45 μm filter membrane, and store it at 4°C.

[0052] (11) HVSMCs were cultured in six-well plates;

[0053] (12) During infection, an appropriate amount of the first supernatant was mixed with the culture medium and cultured at 37°C for 12 h;

[0054] (13) The infection process was repeated with the second supernatant and selection was performed with 2 μg / mL puromycin for 3 days.

[0055] The experimental steps for total RNA extraction are as follows:

[0056] (1) Collect the treated samples and extract total RNA according to the Trizol kit. Use RNase-free pipette tips, DEPC water, and wear a mask (to avoid RNase and prevent RNA degradation);

[0057] (2) Wash the cells with PBS and add 1 mL of Trizol to each well;

[0058] (3) After 10 seconds, transfer the cell lysate to EP and place on ice for 10 minutes;

[0059] (4) Add 200 μL of chloroform, shake to mix, and place on ice for 10 min;

[0060] (5) Centrifugation at 12,000 rpm for 15 min at 4°C;

[0061] (6) Carefully pipette the supernatant into a new EP tube, add isopropanol, mix by inverting, and place on ice for 10 min.

[0062] (7) Centrifuge at 12000 rpm, 4°C for 15 min and discard the supernatant;

[0063] (8) Invert onto paper to absorb the remaining liquid, add 75% ethanol diluted with DEPC water, and gently blow it away with a gun. A white feather-like precipitate will be visible;

[0064] (9) Centrifugation: 4°C, 12,000 rpm, 15 min;

[0065] (10) Discard the supernatant ethanol, blot dry with paper, and place in the cell room super clean bench ventilation hole to air dry (5-10 minutes)

[0066] (11) Add DEPC water to dissolve RNA;

[0067] (12) Measure RNA concentration using NanoDrop and store in a -80°C refrigerator until use.

[0068] The reverse transcription experimental steps are as follows:

[0069] (1) Use II 1st Strand cDNA Synthesis Kit for reverse transcription, the total reaction volume was 20 μL, and the specific composition is as follows:

[0070] RNase free ddH2O To 20μL

[0071] Total RNA 1μg

[0072] II Buffer plus 4μL

[0073] (2) After mixing evenly, reverse transcription is performed using a PCR instrument:

[0074] 25℃ 5min

[0075] 42℃ 30min

[0076] 85℃ 5min

[0077] (3) After reverse transcription, the cDNA was diluted with DEPC water at a ratio of 1:3 or 1:4 and stored at -80°C for later use.

[0078] The real-time PCR experimental steps are as follows:

[0079] (1) This experiment qPCR SYBR Green Master Mix was used to perform relative quantitative detection of the target gene. The PCR reaction system was as follows:

[0080] cDNA template 1 μL

[0081] qPCR SYBR Green Master Mix 5μL

[0082] Upstream primer: TGCAGTCAGAAGGGAGCAAT, 1 μM 1 μL

[0083] Downstream primer: CACCGTCATCAGGCTGTCTT, 1 μM 1 μL

[0084] Ultrapure water 2 μL

[0085] (2) Grouping and calculation of systems (add cDNA at the end);

[0086] (3) Seal the film, centrifuge the 384-well plate, and place it in a fluorescent quantitative PCR instrument;

[0087] (4) The reaction was carried out on a Bio-Rad 480 ΙΙ quantitative PCR instrument.

[0088] Test results such as Figure 1 As shown in the figure, the expression level of lncRNA JPX in Ras-induced senescent HVSMCs was significantly increased compared with that in the normal group.

[0089] In order to further clarify whether lncRNA JPX is involved in HVSMCs aging and thus leads to AS, we constructed small interfering RNA (siRNA) of lncRNA JPX. After transfecting siRNA to knock down lncRNA JPX in HVSMCs, Ras stimulation was given, cell proteins were extracted, and the expression of aging markers such as P16, P21, and P53 was detected by Western Blot.

[0090] The Western Blot assay steps are as follows:

[0091] (1) Prepare SDS polyacrylamide gel: Prepare separation gel according to the molecular weight of the protein, add various reagents in different ratios to a 50 mL centrifuge tube to prepare separation gel, vortex and shake for 30 seconds to mix, pour into the vertical sandwich glass plate to the upper middle part of the glass plate, then slowly add ddH2O for liquid sealing, and solidify at room temperature for 45 minutes. Concentration gel: Mix the reagents according to the formula and pour them on the top of the separation gel to the top of the glass plate, insert a comb (to avoid mixing bubbles), and use a pipette to add the remaining liquid from both sides of the comb. After the colloid solidifies, set aside.

[0092] (2) Sample loading and electrophoresis separation: Before loading, centrifuge the protein sample instantaneously and then shake it gently. Generally, the loading amount is the volume of the solution with a total mass of 30 μg of protein. Fix the gel plate in the electrophoresis tank of the electrophoresis device, fill the space between the two gel plates with 1x electrophoresis buffer, pull out the comb and load the sample. After loading, fill the liquid and start electrophoresis. Run the electrophoresis at a constant voltage of 80V until bromophenol blue reaches the junction of the concentrated gel and the separation gel and the protein samples in each lane are basically on the same horizontal line. Adjust to 120V and stop the electrophoresis when the bromophenol blue approaches the bottom.

[0093] (3) Transfer: Remove the glass plate and cut the gel. Cut the PVDF membrane according to the size of the gel, activate it with methanol for 1 min in advance, and then put it into 1x transfer buffer together with the sponge, filter paper, and gel and soak it for 5-10 min. Then arrange them in order and be careful to remove bubbles during placement. Put the transfer tank into the box, keep the voltage at 120V, and select the transfer time according to the molecular weight of the protein (heat is generated during the transfer process, and ice bags and water are placed around to simulate a low temperature environment of 4°C).

[0094] (4) Blocking: After transfer, remove the membrane and place it in 5% skim milk (prepared in TBS-T), and shake on a decolorizing shaker at room temperature for 1 hour.

[0095] (5) Primary antibody incubation: After blocking, wash the milk with TBS-T, seal the membrane in plastic film, add the corresponding primary antibody, and shake in a refrigerator at 4°C overnight.

[0096] (6) Secondary antibody binding: The membrane was washed four times with TBS-T for 10 min, 10 min, 5 min, and 5 min, respectively, incubated with the corresponding secondary antibody on a decolorization shaker at room temperature for 1 h, and then washed with TBS-T for 10 min, 10 min, 5 min, and 5 min, respectively.

[0097] (7) ECL color development: Before color development, mix equal volumes of ECL color development solution A and solution B evenly (protect from light), develop the image in a fluorescent chemiluminescent gel imaging system, take pictures and keep records.

[0098] Test results such as Figure 2 As shown in the figure, compared with normal HVSMCs, the expression levels of P16, P21, and P53 proteins in Ras-induced HVSMCs decreased after interfering with lncRNA JPX. This means that lncRNA JPX is involved in the regulation of HVSMCs aging, and interfering with lncRNA JPX can reduce Ras-induced aging, thereby inhibiting the occurrence and development of AS.

[0099] At the same time, the β-galactosidase staining experiment (β-Gal staining experiment) was performed, and the test results were as follows Figure 3 As shown, after interfering with lncRNA JPX, the number of senescent HVSMCs (blue) was significantly reduced.

[0100] The experimental steps of β-galactosidase staining are as follows:

[0101] (1) Aspirate the culture medium and wash the cells with PBS three times, 5 min each time.

[0102] (2) Add an appropriate volume of β-galactosidase staining fixative to fully cover the cells and fix at room temperature for at least 15 min.

[0103] (3) Aspirate the fixative and wash the sections with PBS three times, 5 min each time.

[0104] (4) Add an appropriate amount of dye working solution (the preparation of dye working solution is 1 mL as an example)

[0105]

[0106] (5) Incubate at 37°C overnight. It is best to immerse the cells in the staining solution. Note: Incubation at 37°C cannot be performed in a CO2 incubator.

[0107] (6) Aspirate the staining solution and wash three times with PBS, 5 min each time.

[0108] (7) Add the detection solution and observe under a normal optical microscope. Under an optical microscope, cells expressing beta-galactosidase can be easily observed to turn blue.

[0109] At the same time, cell senescence can be further proved by verifying the SASP gene level. Figure 4As shown, interfering with lncRNA JPX can reduce the increase in the levels of SASP genes such as IL-6, IL-8, IL-1β, ICAM-1, CCL2, and TNF-α induced by Ras. The upstream primer sequence of IL-6 used in this example is: 5'-CTCCAGAACAGATTTGAGAG-3', and the downstream primer sequence is: 5'-GGGTCAGGGGTGGTTATTGC-3'; the upstream primer sequence of IL-8 is 5'-CTGAGGTGCCAGTGCATTAG-3', and the downstream primer sequence is: 5'-AGCACACCTCTCTTCCATCC-3'; the upstream primer sequence of IL-1β is 5'-TTGCCAGCCAGTGACACAAT-3', and the downstream primer sequence is: 5'-GAGAAGGTGGTTGTCTGGGAA T-3'; the upstream primer sequence of ICAM-1 is 5'-AGGTTGAACCCCACAGTCAC-3', and the downstream primer sequence is: 5'-TCTGAGACCTCTGGCTTCGT-3'; the upstream primer sequence of CCL2 is 5'-GATCTCAGTGCAGAGGCTCG-3', and the downstream primer sequence is: 5'-TCTGGGGAAAGCTAGGGGAA-3'; the upstream primer sequence of TNF-α is 5'-TAACAAGCCGGTAGCCCACG-3', and the downstream primer sequence is: 5'-TCTTGATGGCAGACAGGATG-3'.

[0110] Example 2 Mouse model test

[0111] In order to further verify the role of lncRNA JPX in AS caused by aging, this example constructs a knockout mouse that specifically interferes with lncRNA JPX. Antisense LNA GapmeRs are a class of antisense oligonucleotides that can effectively inhibit the functions of mRNA and lncRNA. They are generally 14-16 nucleotides long and are all thiophosphorylated. They can enter cells through cell membrane surface receptors to exert their functions and specifically interfere with lncRNA. - / -Male mice were randomly divided into a control group and a lncRNA JPX knockout group (reference for construction method: A Smooth Muscle Cell-Enriched LongNoncoding RNA Regulates Cell Plasticity and Atherosclerosis by InteractingWith Serum Response Factor). The control group and lncRNA JPX knockout group mice were intravenously injected with control (sequence 5'-CCTTCCCTGAAGGTTCCTCC-3') or lncRNA JPX gapmeRs (sequence 5'-TTCTTGTCATTGCTCCCTTC-3') twice a week at 10 mg / kg per mouse, and fed with a high-fat diet for 16 weeks to construct an AS mouse model. Subsequently, the mouse vascular tissues were collected, and the mouse AS-related vascular disease model was constructed by the above method.

[0112] At the same time, mouse vascular tissues were collected for RT-qPCR detection. The test results were as follows: Figure 5 As shown, it can be seen that lncRNA JPX was significantly activated after mice were given a high fat diet (HFD).

[0113] Experimental steps for RNA extraction from mouse tissue:

[0114] (1) After removing the tissue from liquid nitrogen, quickly take it to the clean bench, place it in a small dish, add Trizol reagent (100 mg of tissue is placed in 1.2 mL of Trizol reagent), and grind it with a syringe. Be careful to grind it skillfully and quickly.

[0115] (2) Centrifuge at 4°C, 12,000 rpm for 5 min and discard the precipitate. (Prepare an EP tube on the clean bench. After centrifugation, pipette the supernatant into the prepared EP tube.)

[0116] (3) Add chloroform at a rate of 200 μL chloroform / mL Trizol, shake vigorously for 15 seconds (by hand), incubate at 15-30°C for 2-3 minutes. Note: Do not use a vortex shaker to prevent the genomic DNA from breaking. (Chloroform is also called trichloromethane and is generally stored in a 4°C refrigerator).

[0117] (4) Centrifuge at 4°C, 12,000 rpm for 15 min. Aspirate the upper aqueous phase and transfer it to another centrifuge tube. Note: Be careful when aspirating the aqueous phase. Do not aspirate the intermediate interface. Use a small pipette tip to aspirate in small amounts multiple times. If DNA and protein are to be extracted at the same time, save the lower organic phase and store it in a 4°C refrigerator for later use. Otherwise, discard the lower organic phase.

[0118] (5) Add isopropanol at a ratio of 500 μL isopropanol / mL Trizol, shake by hand, and incubate at 15-30°C (room temperature is fine) for 10 min.

[0119] (6) Centrifuge at 2-8°C, 12,000 g for 10 min, discard the supernatant, and allow the RNA to settle to the bottom of the tube.

[0120] (7) Add 75% ethanol at a rate of 1 mL 75% ethanol / mL Trizol, vortex to mix, and suspend the precipitate. (Note: 75% ethanol is prepared with DEPC water)

[0121] (8) Centrifuge at 7500 rpm for 5 min at 4°C and discard as much supernatant as possible (Note: After using the centrifuge power, open the centrifuge cover for 30 min to cool down and then close the cover again). Air dry at room temperature or vacuum dry for 5-10 min. (Note: RNA cannot be dried by centrifugation. RNA samples should not be too dry, otherwise they will be difficult to dissolve.)

[0122] (9) Add DEPC water to dissolve RNA;

[0123] (10) Measure RNA concentration using NanoDrop and store in a -80°C refrigerator until use.

[0124] The reverse transcription experimental steps are as follows:

[0125] (1) Use II 1st Strand cDNA Synthesis Kit for reverse transcription, the total reaction volume was 20 μL, and the specific composition is as follows:

[0126] RNase free ddH2O To 20μL

[0127] Total RNA 1μg

[0128] II Buffer plus 4μL

[0129] (2) After mixing evenly, reverse transcription is performed using a PCR instrument:

[0130] 25℃ 5min

[0131] 42℃ 30min

[0132] 85℃ 5min

[0133] (3) After reverse transcription, the cDNA was diluted with DEPC water at a ratio of 1:3 or 1:4 and stored at -80°C for later use.

[0134] The real-time PCR experimental steps are as follows:

[0135] (1) This experiment qPCR SYBR Green Master Mix was used to perform relative quantitative detection of the target gene. The PCR reaction system was as follows:

[0136] cDNA template 1 μL

[0137] qPCR SYBR Green Master Mix 5μL

[0138] Upstream primer, 1 μM 1 μL

[0139] Downstream primer, 1μM 1μL

[0140] Ultrapure water 2 μL

[0141] (2) Grouping and calculation of systems (add cDNA at the end);

[0142] (3) Seal the film, centrifuge the 384-well plate, and place it in a fluorescent quantitative PCR instrument;

[0143] (4) The reaction was carried out on a Bio-Rad 480 ΙΙ quantitative PCR instrument.

[0144] The aorta of mice was collected and the size of plaques was detected by Oil Red O staining. Figure 6 Apoe - / - After HFD administration, vascular red plaques increased significantly, while knocking out lncRNA JPX significantly reduced the plaque area.

[0145] The steps for Oil Red O staining of aortic root vessels are as follows:

[0146] (1) After the aortic tree was isolated, it was placed in a clean six-well plate and fixed with 4% paraformaldehyde.

[0147] (2) Use microtweezers to take the aorta fixed with paraformaldehyde and place it in a new six-well plate. Rinse it with triple-distilled water for about 10 minutes.

[0148] (3) Use a pipette to remove the triple-distilled water in the six-well plate, add 60% isopropanol solution, and treat for 2 minutes.

[0149] (4) Use a pipette to remove the isopropanol in the six-well plate, add the filtered Oil Red O dye solution, and place on a horizontal shaker for staining for 1 hour.

[0150] (5) Use a pipette to remove the Oil Red O staining solution in the six-well plate, add 60% isopropanol solution and rinse for 1 min. Repeat this process three times until the blood vessel background is no longer red.

[0151] (6) Carefully remove the remaining fat on the outer wall of the blood vessels using microscissors under a microscope.

[0152] (7) Finally, spread the stained aortic tree flat on a black anatomical wax plate and take a photo.

[0153] At the same time, the mouse vascular tissue proteins were collected and Western Blot was used to detect aging markers such as P16, P21, and P53. Figure 7 As shown, it can be seen that after the control group mice were given HFD, the aging markers such as P16, P21, and P53 were significantly activated; in comparison, after the JPX gapmeRs mice were given HFD, the expression levels of P16, P21, and P53 proteins were significantly reduced.

[0154] Further vascular immunofluorescence detection was performed. After 16 weeks of high-fat feeding, aortic tissues of mice in different groups were extracted and embedded in optimal cutting temperature compound (OCT). After frozen sections, immunofluorescence was used to detect the expression of P21 and α-SMA. Figure 8 As shown, red represents P21, green represents α-SMA, blue represents the cell nucleus, and the white arrow indicates the co-localization yellow area of ​​red and green. - / - After HFD administration, the expression of P21 in the vascular endothelium increased significantly, and the co-localization of P21 and α-SMA was yellow; while after HFD administration in JPX gapmeRs mice, the expression of P21 in the vascular smooth muscle decreased, and the co-localization of P21 and α-SMA was significantly decreased in yellow.

[0155] Aortic tissues were extracted from mice in different groups, and RT-qPCR experiments were performed to detect the SASP gene level to further prove the role of lncRNA JPX in aging and AS. Fig. 9 It was found that after the control group mice were given HFD, the levels of SASP genes such as IL-6, IL-8, IL-1β, ICAM-1, CCL2, and TNF-α were significantly increased; in comparison, after JPX gapmeRs mice were given HFD, the increased levels of SASP genes such as IL-6, IL-8, IL-1β, ICAM-1, CCL2, and TNF-α were reversed.

[0156] It can be seen from the above examples that in patients with atherosclerosis caused by aging and in cells and animal models related to atherosclerosis, inhibiting or knocking out lncRNA JPX can inhibit aging and delay the progression of atherosclerosis. Therefore, substances that inhibit or knock out lncRNA JPX can be used to prepare drugs for treating cardiovascular diseases caused by aging, especially for preparing drugs for treating atherosclerosis caused by aging. lncRNA JPX can also be used as a target for screening drugs for treating cardiovascular diseases caused by aging, especially for screening drugs for treating atherosclerosis caused by aging.

[0157] The above examples are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of small interfering RNA for knocking down lncRNA JPX shown in SEQ ID NO.1 and SEQ ID NO.2 in the preparation of drugs for preventing and treating atherosclerosis.

Images