Chimeric antigen receptor targeting cea and uses thereof
By designing a chimeric antigen receptor targeting CEA and activating T cells using the nanobody 14F1 and its signaling region, the lack of CAR-T products targeting CEA in existing technologies has been solved, achieving highly efficient killing and enhanced penetration of CEA-positive tumors.
Patent Information
- Application Number
- CN202210920213.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-01
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2042-08-01
AI Technical Summary
There is a lack of effective CAR-T products that target CEA in the current technology, and single-chain antibodies have certain limitations as CAR targeting domains, making it difficult to efficiently treat solid tumors that express CEA.
A chimeric antigen receptor targeting CEA was designed, using the nanobody 14F1 as the variable region, combined with the CD8α hinge region, CD28 transmembrane region, CD28 and CD137 signaling regions, etc., to activate T cells to kill tumor cells expressing CEA, and enhance the infiltration ability of T cells by degrading the extracellular matrix through HAase.
This study achieved T-cell-specific killing of tumor cells targeting CEA, enhanced the therapeutic effect on CEA-positive tumors, and improved the penetration and therapeutic effect of CAR-T cells in solid tumors.
Smart Images

Figure CN116063552B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a kind of chimeric antigen receptor and the T cell containing the chimeric antigen receptor, belong to polypeptide and cell technical field. BACKGROUND
[0002] Carcinoembryonic antigen (CEA, also known as CEACAM-5 or CD66e) is a glycoprotein with a molecular weight of about 180 kDa. CEA is a member of the immunoglobulin superfamily and contains seven domains linked to the cell membrane via a glycosylphosphatidylinositol (GPI) anchor. The seven domains include a single N-terminal Ig variable domain and six domains homologous to Ig constant domains (A1-B1-A2-B2-A3-B3). CEA was originally classified as a protein expressed only in fetal tissues, and has now been identified in several normal adult tissues. Excessive expression of CEA is observed in many types of cancer, including colorectal cancer, pancreatic cancer, lung cancer, gastric cancer, hepatocellular carcinoma, breast cancer and thyroid cancer. Therefore, CEA has been used as a broad-spectrum tumor marker. More importantly, CEA has been used not only for clinical detection and diagnosis, but also as a potentially useful tumor-associated antigen for targeted therapy. Two methods of using CEA-targeted immunotherapy to treat cancer have been reported. One method uses anti-CEA antibodies to trigger the lytic activity of immune cells, especially through antibody-dependent cellular cytotoxicity (ADCC) or complement-dependent cellular cytotoxicity (CDC), to eliminate tumor cells expressing CEA. The other method is to conjugate anti-CEA antibodies or antibody fragments with effector molecules such as drugs, toxins, radionucleotides, immunomodulators or cytokines to specifically target tumor cells expressing CEA, thereby exerting the therapeutic effect of the effector molecules. A variety of monoclonal antibodies against CEA have been developed and applied in ADC drugs, bispecific antibodies, radioimmunotherapy, chimeric antigen receptor T cell therapy (CAR-T therapy) and surgical navigation systems.
[0003] CAR-T therapy is short for Chimeric Antigen Receptor T-Cell Immunotherapy. It is a new precise targeted therapy for treating tumors, which has achieved good results in clinical tumor treatment in recent years through optimization and modification. It is a very promising new tumor immunotherapy method that can accurately, quickly and efficiently cure cancer. The skilled person activates T cells through genetic engineering technology, and installs tumor chimeric antigen receptors on them to specifically recognize tumor cells in the body and release a large number of various effector factors through immune action. They can efficiently kill tumor cells, thereby achieving the purpose of treating malignant tumors. At present, countries around the world are carrying out clinical trials of CAR-T therapy. Among them, the United States has the largest number of experiments, including hematological tumors and solid tumors. The CAR-T products targeting CEA developed by Merus, Shanghai Jikai Gene and Cancer Research Technology have all entered the clinical trial stage. However, there is no CAR-T product targeting CEA that has really been put on the market, and single-chain antibodies as CAR targeting domains have certain limitations.
[0004] In the camelids (camels, dromedaries and llamas) there is a class of heavy chain-only antibodies H2, which are mainly of the IgG2 and IgG3 type. This class of antibodies is called heavy chain-only-like antibodies (HCAbs) due to the lack of light chains, and their antigen-binding site consists of one domain, called the VHH region, so this class of antibodies is also called single-domain antibodies or sdAbs. Due to the variable region sequence after removing the constant region, the molecular weight of this class of antibodies is only 15 kD, and the diameter is about 10 nm, so it is also called nanobody (Nbs). Compared with the conventional four-chain antibody scFv, nanobody is comparable to its corresponding scFv in affinity, but it surpasses scFv in solubility, stability, resistance to aggregation, refoldability, expression yield, and ease of DNA manipulation, library construction and 3-D structure determination. The small molecular weight of nanobody makes it easy to penetrate into some hard-to-reach cancerous tissues and has better distribution uniformity. Compared with human VH antibodies, nanobody has longer CDR1 and CDR3 regions, and the longer CDR3 region can form a disulfide bond with the adjacent CDR2 or CDR1 region to stabilize its structure. This CDR3 forms a protruding loop that can specifically recognize hidden epitopes that cannot be recognized by conventional antibodies. Therefore, nanobody as an alternative CAR targeting domain has special advantages, mainly due to the low immunogenicity, stability, specificity and high affinity of nanobody, and the simple and feasible development process. Many research results have confirmed that in preclinical and clinical environments, nanobody-based CAR-T can function as well as single-chain antibody-based CAR-T.
[0005] In view of the current lack of good treatment methods for CEA-expressing solid tumors, and the lack of successful CEA-targeting CAR-T products on the market, the purpose of the present application is to provide a chimeric antigen receptor targeting CEA, and a T cell containing the chimeric antigen receptor and its application in treating solid tumors. SUMMARY
[0006] Based on the above-mentioned purposes of the application, the present application first provides a nanobody against CEA CAM-5 antigen, the variable region of the nanobody has three complementarity determining regions CDR1, CDR2 and CDR3, wherein the CDR1 sequence consists of the amino acid sequence of SEQ ID NO. 11, the CDR2 sequence consists of the amino acid sequence of SEQ ID NO. 12, and the CDR3 sequence consists of the amino acid sequence of SEQ ID NO. 13.
[0007] In a preferred technical solution, the variable region sequence of the nanobody consists of the amino acid sequence described by SEQ ID NO. 10. A preferred embodiment of the nanobody having this variable region sequence in the present application is nanobody 14F1.
[0008] Secondly, the present application also provides a chimeric antigen receptor targeting CEA, which consists of, in sequence, a nanobody against CEACAM-5 antigen, an extracellular hinge region, a transmembrane region and an intracellular signal region, a self-cleaving polypeptide T2A and a hyaluronidase HAase, wherein the nanobody against CEACAM-5 antigen consists of the amino acid sequence after humanization of the variable region sequence of the 14F1 nanobody; the extracellular hinge region is a CD8α hinge region, the amino acid sequence of which is shown as SEQ ID NO: 2; the transmembrane region is a CD28 transmembrane region, the amino acid sequence of which is shown as SEQ ID NO: 3; the intracellular signal region comprises a costimulatory signal region and a first signal region, wherein the costimulatory signal region comprises a CD28 signal region and a CD137 signal region, the amino acid sequence of the CD28 signal region is shown as SEQ ID NO: 4, the amino acid sequence of the CD137 signal region is shown as SEQ ID NO: 5, and the first signal region is a CD3ζ signal region, the amino acid sequence of which is shown as SEQ ID NO: 6; the amino acid sequence of the self-cleaving polypeptide T2A is shown as SEQ ID NO. 22; and the amino acid sequence of the HAase is shown as SEQ ID NO. 24.
[0009] In a preferred technical solution, the amino acid sequence of the nanobody against CEACAM-5 antigen after humanization is shown as SEQ ID NO. 1.
[0010] More preferably, the amino terminal of the chimeric antigen receptor is connected with a signal peptide, the amino acid sequence of which is shown as SEQ ID NO: 7.
[0011] Especially preferably, a connecting peptide is provided between the transmembrane region and the intracellular signal region, and the connecting peptide is (G4S) n , wherein n is an integer between 1 and 7.
[0012] Most preferably, n = 4, and the amino acid sequence of the chimeric antigen receptor is shown as SEQ ID NO. 26.
[0013] Thirdly, the present application provides a nucleic acid encoding the above-mentioned chimeric antigen receptor, the sequence of which is shown as SEQ ID NO. 27.
[0014] Fourthly, the present application also provides a chimeric antigen receptor T cell targeting CEA, which contains the above-mentioned chimeric antigen receptor.
[0015] Fifthly, the present application provides the use of the above-mentioned chimeric antigen receptor in the preparation of a medicament for treating tumors expressing CEACAM-5 antigen.
[0016] Finally, the present application provides the use of the above-mentioned chimeric antigen receptor T cell in the preparation of a medicament for treating tumors expressing CEACAM-5 antigen.
[0017] The anti-CEACAM-5 nanobody provided by the present application can specifically bind to the CEACAM-5 antigen, and the affinity can be up to 10 nM or more. The second aspect, the chimeric antigen receptor (14F1CAR-CEA) targeting CEA provided by the present application can make the T cells containing it specifically target and kill the positive tumor cells (LoVo cells and SW480 cells) expressing CEA. After the 14F1CAR-CEA binds to the CEA on the surface of the tumor cells, the CD28 and CD137 signal regions are used as the co-stimulatory signal, the intracellular signal region in the 14F1CAR-T cell is activated, the proliferation of the T cell is promoted, and the killing effect on the malignant tumor cells (LoVo cells or SW480 cells) expressing CEA is further enhanced. The HAase connected by T2A can be normally translated and expressed after being introduced into the T cell, the HAase can degrade the hyaluronic acid in the extracellular matrix, reduce the viscosity of the hyaluronic acid, and enhance the permeability of the extracellular matrix tissue, which is conducive to the entry of the CAR-T cell into the solid tumor and the infiltration in the solid tumor, thereby enhancing the therapeutic effect of the CAR-T cell. This shows that the chimeric antigen receptor and the CAR-T cell of the present application have application value in the clinical treatment of CEA-positive tumors and the preparation of drugs. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 . Electrophoretic identification map of total RNA extraction;
[0019] Figure 2 . Electrophoretic identification map of first-round PCR amplification of antibody variable region genes;
[0020] Figure 3 . Electrophoretic identification map of second-round PCR amplification of antibody variable region genes;
[0021] Figure 4 . Electrophoretic identification map of pMES4 vector double enzyme digestion reaction product;
[0022] Figure 5 . Electrophoretic identification map of colony PCR identification of transformants;
[0023] Figure 6 . SDS-PAGE map of nanobody 14F1 purification;
[0024] Figure 7. Biacore analysis of nanobody 14F1 affinity curve chart before and after humanization;
[0025] Figure 8 . Humanized nanobody H-14F1 indirect immunofluorescence results chart of cell binding;
[0026] Figure 9 . Lentivirus titer determination method schematic diagram;
[0027] Figure 10 . 14F1CAR-CEA-T cell killing power detection results on target cells;
[0028] Figure 11 . 14F1CAR-CEA-T cell killing power detection results under different effector-target ratio conditions;
[0029] Figure 12 . 14F1CAR-CEA-T cell release IFN-γ content detection results after killing target cells;
[0030] Figure 13 . 14F1CAR-CEA-T cell and 14F1CAR-CEA1-HA-T cell tumor growth inhibition results in mice. DETAILED DESCRIPTION
[0031] The present application will be further described below in conjunction with specific examples, and the advantages and characteristics of the present application will become more apparent as the description proceeds. However, these examples are only exemplary and do not constitute any limitation on the protection scope defined by the claims of the present application.
[0032] Example 1. Screening of anti-CEACAM-5 nanobodies
[0033] 1.1 Immunization of a llama
[0034] A healthy adult llama was selected, and the recombinant antigen CEACAM-5 (manufacturer: Yiqiao God, product number 11077-H08H) was mixed with Freund's adjuvant at a ratio of 1:1. The llama was immunized by subcutaneous injection of 6-7 μg / kg of the mixture on the back in multiple points, and the immunization was performed a total of four times with an interval of 2 weeks. Then, 10 ml of peripheral blood of the llama was collected for construction of a phage display library.
[0035] 1.2 Isolation of camelid lymphocytes
[0036] The collected peripheral blood of the llama was separated into lymphocytes using a camel peripheral blood lymphocyte separation kit (Tianjin Haoyang Company, product number LTS1076) according to the instructions. 2.5 x 10 7Add 1 ml RNA isolation reagent to the live cells, take 1 ml for RNA extraction, and store the rest at -80°C.
[0037] 1.3 Total RNA extraction
[0038] Blow the 1 ml Tipure Isolation Reagent containing lymphocytes repeatedly, and let stand for 5 minutes. Add 200 μl chloroform, vortex for 30 seconds, and continue to stand for 5 minutes. Centrifuge at 4°C and 12000 g for 15 minutes, and transfer the water phase to a new EP tube. Add an equal amount of isopropanol, let stand for 10 minutes, centrifuge at 4°C and 12000 g for 10 minutes, discard the supernatant, wash with 1 ml pre-cooled 70% ethanol, centrifuge at 4°C and 7500 g for 5 minutes, discard the supernatant, and dry for 5 minutes. Add 30 μl RNase-free water to dissolve the precipitate, adjust the concentration to 1 μg / μl, and perform gel electrophoresis detection. The results are shown in Figure 1 .
[0039] 1.4 Reverse transcription to synthesize cDNA
[0040] According to the reverse transcription kit instructions (transcripor first stand cDNA synthesis KIT of Roche Company), the RNA obtained in step 1.3 is used as a template for reverse transcription cDNA.
[0041] 1.5 Amplification of antibody variable region genes
[0042] The cDNA obtained by reverse transcription is used as a template for PCR reaction. Two rounds of amplification are performed. The primer sequences of the first round of PCR are as follows:
[0043] CALL001: GTCCTGGCTGCTCTTCTACAAGG
[0044] CALL002: GGTACGTGCTGTTGAACTGTTCC
[0045] The PCR reaction conditions and procedures are as follows: 95°C for 5 minutes; 95°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds, 30 cycles; 72°C for 7 minutes. Use an agarose gel recovery kit to recover a band of about 700 bp, and finally adjust the nucleic acid concentration to 5 ng / μl Figure 2 : M is Trans 2K DNA Marker; 1 is the first round of PCR product). The primer sequences of the second round of PCR are as follows:
[0046] VHH-Back: GATGTGCAGCTGCAGGAGTCTGGRGGAGG
[0047] VHH-Rev: GATGGATCCGGAGTCGGAGTCGGCTGATATAC
[0048] PCR reaction condition and procedure: 95℃ 5min; 95℃ 30s, 55℃ 30s, 72℃ 30s, 15 cycles; 72℃ 7min. PCR products were purified by PCR product recovery kit Figure 3 : M is Trans 2K DNA Marker; 1 is the second round PCR product).
[0049] 1.6 Vector construction
[0050] PstI, BstEII double enzyme digestion was performed on pMES4 (purchased from Biovector) and the second PCR product respectively, 1.5 μg of the enzyme-digested vector and 450 ng of the enzyme-digested second PCR product were added with 15 μl of T4 DNA ligase, supplemented with buffer and water to a total volume of 150 μl, ligated at 16℃ overnight and the ligation product was recovered. The product was recovered using a PCR product recovery kit and eluted with 20 μl of water. 1% agarose gel electrophoresis was performed to detect the double enzyme digestion results of the pMES4 vector Figure 4 : M is Trans 5K plus DNA Marker; 1 is the pMES4 vector without enzyme digestion plasmid; 2 is the product after double enzyme digestion of the pMES4 vector).
[0051] 1.7 Electroporation and library capacity determination
[0052] 10 μl of the purified ligation product was added to a pre-cooled electroporation cup containing 50 μl of E. coli TG1 competent cells, and was placed in an electroporator (ECM630 electroporator from BTX, USA) for electroporation. The electroporation cup was removed, and the transformants were recovered and cultured. Randomly selected clones were subjected to colony PCR identification Figure 5 : M is 100 bp DNA Marker; N is negative control; 1-23 are PCR identification products of randomly selected single clones). The library capacity was calculated according to the PCR positive rate (library capacity = number of clones x dilution factor x PCR identification positive rate x 10). The primer sequences are as follows:
[0053] MP57: TTATGCTTCCGGCTCGTATG
[0054] GIII: CCACAGACAGCCCTCATAG.
[0055] 1.8 Phage amplification
[0056] The recovered bacterial liquid was inoculated into YT-AG medium and cultured at 37℃ and 200 rpm until the culture OD 600=0.5. Take out 10 ml of the bacterial solution and add 4x10 10 VCSM13, 37°C stationary infection for 30 minutes. 4000 rpm, 10 minutes at room temperature, remove the supernatant. Resuspend the bacterial body with 2xYT-AK (containing ampicillin and kanamycin) medium, 37°C 200 rpm culture overnight. Centrifugation and take 40 ml of supernatant, add 10 ml PEG / NaCl (20% / 2.5M) solution, mix well, centrifuge and discard the supernatant, wash the precipitate with 1 ml ice PBS and centrifuge, take 250 μl of pre-cooled PEG / NaCl, mix well and resuspend.
[0057] Determination of phage titer: TG1 was cultured to OD 600 =0.4, gradient dilution of phage with LB medium, take the dilution of phage TG1 culture and mix culture, the next day observe the formation of plaque in the culture plate, count the dilution gradient plate with plaque number of 30-300 and calculate the phage titer (pfu) according to the following formula.
[0058] Phage titer (pfu / ml) = dilution factor x plaque number x 100.
[0059] 1.9 Nanobody screening
[0060] Screen positive clones by ELISA method with antigen. Coat ELISA plate with antigen, block with 5% BSA, wash with PBST. Add 100 μl of phage supernatant to each well, 37°C for 1 hour. Discard the supernatant, add HRP labeled mouse anti-M13 secondary antibody, 37°C for 1 hour. Discard the supernatant, add TMB solution, incubate at room temperature for 5 hours, add 2M sulfuric acid to each well to stop the reaction, and read with a microplate reader at 450 nm.
[0061] 1.10 Expression and purification of nanobodies in E. coli
[0062] Select phage ELISA result positive clones, extract plasmid and transform into strain BL21 competent cells, induce nanobody protein expression with IPTG, collect supernatant (periplasmic extract), and dialyze the periplasmic extract into PBS, purify using Ni-NTA resin, elute and collect using different concentrations of imidazole, analyze the collected samples by reducing protein electrophoresis, and finally dialyze the nanobodies into PBS.
[0063] The nanobody against CEA is screened by immunizing a llama, separating cells, constructing a phage library, and screening nanobodies. The antibody light chain and heavy chain genes are analyzed by using Vector NTI software to determine the framework regions (FR) and complementary determining regions (CDR) of the variable region.
[0064] The nanobody of a preferred embodiment screened by the application is named 14F1. The nanobody 14F1 heavy chain nucleic acid sequence is shown in SEQ ID NO. 14, and the variable region amino acid sequence is shown in SEQ ID NO. 10, wherein the amino acid sequence at positions 1-25 is FR1, the amino acid sequence at positions 26-33 is CDR1, the amino acid sequence at positions 34-50 is FR2, the amino acid sequence at positions 51-58 is CDR2, the amino acid sequence at positions 59-96 is FR3, the amino acid sequence at positions 97-104 is CDR3, and the amino acid sequence at positions 105-115 is FR4.
[0065] Example 2. Preparation of nanobody 14F1
[0066] 2.1 Nanobody original strain TG1 amplification and nanobody recombinant plasmid transformation of E. coli BL21 (DE3)
[0067] The glycerol bacteria containing the nanobody nucleic acid original strain TG1 is inoculated in 5 ml of fresh LB-A medium at a ratio of 1:1000, and cultured at 37°C and 200 rpm overnight. The next day, the plasmid is extracted according to the instructions of Plasmid mini kit (OMEGA). After verification, 1 μl of the above plasmid is transformed into 100 μl of competent cells, mixed gently, placed on ice for 30 minutes, heat shocked at 42°C for 90 seconds, and cooled on ice for 3 minutes. 600 μl of LB medium is added to the centrifuge tube, and cultured at 37°C for 60 minutes. 100 μl of supernatant is used to coat an LB-A plate with a triangular spreader, and cultured at 37°C overnight.
[0068] 2.2 Induced expression of nanobody
[0069] The above monoclonal colonies are picked in LB-A medium and cultured at 37°C overnight. The next day, 100 ml of fresh LB-A medium is added to the bacterial solution at a ratio of 1:100, and cultured at 37°C for 3 hours to an OD 600=0.8, add final concentration of 1 mM IPTG, induce overnight at 30°C. On the third day, collect the bacteria by centrifugation at 8000 rpm for 10 min, resuspend the pellet with 1.5 ml pre-cooled TES buffer. After 2 min ice-bath, gently shake for 30 s, repeat this cycle for 6 times. Add 3.0 ml TES / 4 (dilute TES with water by 4 times), gently shake for 30 s, repeat the shaking and standing steps for 6 times. Collect the supernatant (periplasmic extract) by centrifugation at 9000 rpm for 10 min at 4°C, about 4.5 ml supernatant is collected.
[0070] 2.3 Purification and identification of Nanobody
[0071] After resuspension of IMAC Sepharose (GE), take 2 ml and add to the gravity column, stand for 30 min, let the sepharose settle at the bottom of the gravity column, flow out the storage buffer. Add 2 column volume of NiSO4solution (0.1 M), flow out the NiSO4solution at a flow rate of about 8 s / drop; add 10 column volume of equilibration buffer to equilibrate and wash the sepharose, maintain the flow rate; dilute the sample with equilibration buffer by 2 times, add to the gravity column, adjust the flow rate to 6 s / drop, collect the flow-through; add 10 column volume of washing buffer to wash the sepharose, maintain the flow rate, collect the washing liquid; add 3 column volume of elution buffer, maintain the flow rate at 6 s / drop, collect the eluate containing the target protein; finally, add 10 column volume of equilibration buffer, 10 column volume of pure water and 10 column volume of 20% ethanol to wash the sepharose, respectively, and finally reserve 4 ml of 20% ethanol to preserve the column. The collected samples are detected by SDS-PAGE, respectively. Figure 6 : M is a rainbow broad-spectrum protein marker; 1-2 are the purified nanobodies 14F1 from E. coli induced expression).
[0072] Example 3. Affinity activity assay of nanobody with antigen
[0073] 3.1 Chip antigen coupling
[0074] The antigen was prepared with different pH sodium acetate buffer (pH 5.5, pH 5.0, pH 4.5, pH 4.0) into 20 μg / ml working solution, while preparing 50 mM NaOH regeneration solution, using Biacore T100 protein interaction analysis system instrument in the template method of different pH conditions of antigen and chip (GE company) surface between the electrostatic binding analysis, signal increase in the amount of 5 times RL as the standard, select the appropriate most neutral pH system and adjust the antigen concentration as the conditions of coupling. According to the instrument in the template method of chip coupling: 1 channel selection blank coupling mode, 2 channel selection Target coupling mode, the target is set to the designed theoretical coupling amount. The coupling process takes about 60 minutes.
[0075] 3.2 analysis of the concentration of the setting conditions and regeneration conditions optimization
[0076] Manual injection mode was adopted, 1, 2 channel 2-1 mode injection was selected, and the flow rate was set to 30 μl / min. The injection condition was 120 seconds, 30 μl / min. The regeneration condition was 30 seconds, 30 μl / min. First, run the buffer continuously until all the baseline is stable. Prepare nanobody solution with a wide concentration span, configure with running buffer, set 200 μg / ml, 150 μg / ml, 100 μg / ml, 50 μg / ml, 20 μg / ml, 10 μg / ml, 2 μg / ml. Prepare regeneration solution, select four pH gradient of glutamic acid hydrochloride system regeneration solution: 1.5, 2.0, 2.5, 3.0. Manual injection of 200 μg / ml analyte sample, observe channel 2, from the most neutral pH regeneration buffer, until the response line of channel 2 after regeneration returns to the same height as the baseline. Again, manually inject 200 μg / ml analyte sample, observe the signal change of channel 2-1 and record the binding amount, and then regenerate with the regeneration solution that made the response line return to the baseline in the last step. Again, manually inject 200 μg / ml analyte sample, observe the signal change of channel 2-1 and record the binding amount, and compare it with the last binding amount. If the deviation is less than 5%, it is considered that the pH of the regeneration solution is the best. If the binding amount of the next injection is low, continue to use lower pH regeneration buffer for experiment. With the selected best regeneration solution as the regeneration reagent for the chip surface after each injection. Inject the analyte concentration samples set above, and analyze the binding amount of each concentration to determine the concentration gradient required for affinity test.
[0077] 3.3 affinity test
[0078] The optimized sample concentration gradient, regeneration solution, using the instrument with the template method (which set the injection conditions for 60 seconds, 30 μl / min; dissociation time: 600 seconds; regeneration conditions: 30 seconds, 30 μl / min) to test the affinity between the nanobodies and antigens. At any time, the signal of channel 2-1 was observed. The affinity test process took about 200 minutes.
[0079] 3.4 Result analysis
[0080] The binding dissociation curves of several appropriate concentration gradients were selected to fit all curves with 1:1 binding mode, and finally the affinity values and important parameters such as binding constant and dissociation constant were obtained (see Figure 7 ). The affinity value of anti-CEA nanobody 14F1 was 1.973E-9.
[0081] Example 4. Humanization of anti-CEA nanobody
[0082] At present, in the process of developing CAR-T, many chimeric antigen receptors are difficult to stably express on the T lymphocytes of patients, and most of them will gradually reduce the expression efficiency with the extension of cell culture time. The main reason for this phenomenon is the immunogenicity of the chimeric antigen receptor, thereby affecting its safety and effect in vivo.
[0083] Therefore, under the premise of keeping the CDR region in the amino acid sequence of 14F1 unchanged, according to the h-NbBcⅡ10 FGLA The CDR region of 14F1 was transplanted to the h-NbBcⅡ10 FGLA universal template of humanized nanobody, and the antibody was temporarily named h-NbBcⅡ10 FGLA -14F1, the amino acid sequence is shown as SEQ ID NO. 15. However, after measuring the affinity according to the affinity determination method of Example 3, it was found that the affinity of h-NbBcⅡ10 FGLA -14F1 was significantly decreased compared with 14F1, only 2.221E-8 (see Table 1 and Figure 7 ). On this basis, h-NbBcⅡ10FGLA -14 restore the amino acid mutations of individual sites. Specifically, Val→Gln at position 5, Leu→Met at position 34, Gly→Arg at position 35, Phe→Val at position 37, Qn→Lys at position 43, Ala→Leu at position 47, Tyr→Ser at position 59. Site-directed mutagenesis was performed using Mut express multiS fast mutagenesis kit V2 (Novagen, Cat. No. C215-01). Finally, the humanized nanobody 14F1 with substantially unchanged affinity was obtained and named H-14F1, and its amino acid sequence is shown in SEQ ID NO. 1. The affinity of H-14F1 was determined to be 3.959E-9 according to the affinity determination method of Example 3 (see Table 1 and Figure 7 , Figure 7 The upper graph in the middle is h-NbBcⅡ10 FGLA -14F1, abbreviated as NbBc-14F1, the middle graph is H-14F1, and the lower graph is H-14F1).
[0084] Table 1 Affinity determination results
[0085] .
[0086] Example 5. Identification of nanobody binding to positive cells
[0087] SW480 (human colon cancer cells, purchased from Shanghai Yuli Biological Technology Co., Ltd.) and LoVo cells (human colon cancer cells, Zhejiang Provincial Academy of Medical Sciences Experimental Animal Center) both secrete CEA antigen, while 293T cells (human embryonic kidney epithelial cells, Qingdao University) do not secrete CEA antigen. Using this characteristic, the indirect immunofluorescence method was used to identify whether the humanized nanobody H-14F1 can bind to CEA-expressing cells. The specific operation is as follows: 20 μl of complete culture solution was added to the bottom of a 24-well plate, and the cell climbing sheet was gently placed into the 24-well plate. After cell digestion, the cell concentration was adjusted to 5 x 104 / ml, 100 μl was added to each well, and it was placed in the incubator. After the cells grew to about 80%, the climbing sheet was taken out and placed on the glass slide. The fixing solution was prepared according to the ratio of formaldehyde to acetone 1:1. The fixing solution was dropped on the climbing sheet, and it was placed at room temperature for 15 min, and washed with PBST for 3 times, 5 min each time. 5% BSA solution was used for blocking at room temperature for 1 h, and washed with PBST for 3 times, 5 min each time. H-14F1 was diluted with 1% BSA solution (1 mg / ml, dilution ratio about 1:200), and incubated at room temperature for 2 h, and washed with PBST for 3 times, 5 min each time. The FITC-labeled Rabbit Anti-Camelid VHH Cocktail secondary antibody (Jinsirui Biological, product number A02017) was diluted with 1% BSA solution, and incubated at room temperature for 1 h in the dark, and washed with PBST for 5 times, 3 min each time. 30% glycerol was added to prevent drying, and observed under a microscope. The results are shown in Figure 8 . Humanized nanobody H-14F1 can be seen fluorescence phenomenon with LoVo cells and SW480 cells. Through microscopic observation, it can be seen that the fluorescence intensity of LoVo cells is slightly stronger than that of SW480 cells, and 293T cells do not show obvious fluorescence. This is consistent with the results of the current study that LoVo cells secrete more CEA than SW480 cells. And 293T cells do not secrete CEA antigen, so no obvious fluorescence is observed. From the results, it can be seen that the nanobody 14F1 targeting CEA can bind to CEA-expressing cells, and no non-specific binding is observed with cells that do not express CEA.
[0088] Example 6. Preparation of chimeric antigen receptor T cells targeting CEA
[0089] 6.1 Construction of CEA-targeting chimeric antigen receptor encoding gene
[0090] According to the currently commonly used CAR-T structure (see Table 2 for details), three CEA-targeting chimeric antigen receptors were designed for the H-14F1 antibody, and were named 14F1CAR-CEA-1, 14F1CAR-CEA-2, and 14F1CAR-CEA-3. The specific structures are as follows: 14F1CAR-CEA-1 is composed of CD8a signal peptide, H-14F1, CD8a hinge region, CD28 transmembrane region, CD28 signal region, CD137 signal region, and CD3 zeta signal region in series from N terminus to C terminus; 14F1CAR-CEA-2 is composed of CD8a signal peptide, H-14F1, CD8a hinge region, CD28 transmembrane region, CD278 signal region (amino acid sequence as shown in SEQ ID NO. 16), CD137 signal region, and CD3 zeta signal region in series from N terminus to C terminus; and 14F1CAR-CEA-3 is composed of CD8a signal peptide, H-14F1, CD8a hinge region, CD28 transmembrane region, CD27 signal region (amino acid sequence as shown in SEQ ID NO. 17), CD137 signal region, and CD3 zeta signal region in series from N terminus to C terminus. The specific preparation method is as follows: the gene sequences of each part are artificially synthesized, and the gene sequences of each part are sequentially connected from 5' end to 3' end by fusion PCR to obtain the coding gene of the CEA-targeting chimeric antigen receptor, wherein the 14F1CAR-CEA-1 nucleic acid sequence is as shown in SEQ ID NO. 9, and the amino acid sequence is as shown in SEQ ID NO. 8; the 14F1CAR-CEA-2 nucleic acid sequence is as shown in SEQ ID NO. 19, and the amino acid sequence is as shown in SEQ ID NO. 18; and the 14F1CAR-CEA-3 nucleic acid sequence is as shown in SEQ ID NO. 21, and the amino acid sequence is as shown in SEQ ID NO. 20.
[0091] Table 2 Structure of each part of CAR-T
[0092] .
[0093] 6.2 Preparation of CEA-targeting chimeric antigen receptor lentiviral vector
[0094] 6.2.1 Preparation of lentiviral vector plasmid
[0095] The coding genes of the three 14F1CAR-CEA were cloned into the pLVX-IRES-ZsGreen1 vector (purchased from GenScript) through EcoR I and Xba I restriction enzyme sites, and the plasmid was extracted using an endotoxin-free plasmid large extraction kit (Tiangen Biochemical Technology, product number DP117).
[0096] 6.2.2 Preparation of 293T cells
[0097] Under the microscope, 293T cells were in good condition (cell edges were smooth, small lobular, and cell nuclei were obvious). 10 ml pipette was used to discard the cell culture solution in the bottle, 3 ml PBS was added, the culture bottle was placed flat and gently shaken, and trypsin was evenly spread on the cell layer. The culture bottle was stood up, and 10 ml pipette was used to discard PBS. 10 ml pipette was used to add 3 ml trypsin, the culture bottle was placed flat and gently shaken, and trypsin was evenly spread on the cell layer. The culture bottle was placed in the cell culture box and stood for 2 min. After the cells were completely suspended under the microscope, 10 ml pipette was used to add 5 ml cell culture solution, and after gentle blowing, it was all transferred to a 15 ml centrifuge tube. Centrifugation was performed at 100 g for 5 min. The waste liquid was poured into the waste liquid tank, and the centrifuge tube was left to stand for 1-2 min. The residual waste liquid was sucked up with a 200 ul gun head, 10 ml virus packaging solution was added for resuspension, and after gentle blowing and mixing, the cell counting plate was counted. The cell concentration was adjusted to 6x10 5 Each added three holes gently blew the cell suspension; clockwise gently knocked the four edges of the six-hole plate to ensure uniform distribution of the cells. After checking under the microscope, it was placed in the cell culture box and cultured for 24 h.
[0098] 6.2.3 Lentivirus packaging
[0099] Two 1.5 ml sterile centrifuge tubes were taken and labeled as A tube and B tube, and 250 μl DMEM was added respectively. 7 μl lipo3000 was added to the A tube, and 1.5 μg of the plasmid of interest, 1 μg of psPAX2 packaging plasmid, 0.5 μg of pMD2G envelope plasmid, and 6 μl of P3000 were added to the B tube. The liquid in the A tube was slowly dropped into the B tube, and it was left to stand for 20 min. 1 ml of 293T cell culture solution in the six-hole plate was sucked out, and the liposome plasmid pre-mixture was slowly dropped into the corresponding hole along the hole wall edge. It was placed in the cell culture box and cultured. After standing for 6 h, the culture solution in the hole was discarded, and 2 ml of new preheated virus packaging solution was added. It was placed in the cell culture box and cultured. After 48 h, the culture solution in the six-hole plate was transferred to a 15 ml centrifuge tube, labeled and stored at 4°C. 2 ml of new preheated virus packaging solution was added, and it was placed in the cell culture box and cultured for another 24 h. The supernatant was collected in a 15 ml centrifuge tube, and a total of 4 ml of sample was collected. Centrifugation was performed at 2000 rpm for 10 min, and 0.45 μm filter membrane was used for filtration.
[0100] 6.2.4 Lentivirus concentration
[0101] The virus sample was mixed with the virus concentration solution (Jiman Biological, product number GM-040801-15) at a ratio of 4:1, and it was placed at 4°C overnight. Start to shake the centrifuge tube every half hour, a total of 3 times. Centrifugation was performed at 4000 g for 30 min at 4°C, the supernatant was discarded, and the resuspension was performed with PBS at 1 / 100 of the original liquid volume, 50 μl per tube. After aliquoting, it was frozen at -80°C.
[0102] 6.2.5 Determination of Viral Titer
[0103] After digesting 293T cells, the cell concentration was adjusted to 6 × 10⁻⁶ cells using complete culture medium. 4 Seed 100 μl of 10 mg / ml polybrene per well into a 96-well plate and incubate overnight in a cell culture incubator; add 5 μl of 10 mg / ml polybrene to 5 ml of complete culture medium and mix by pipetting; take a new 96-well plate, as follows Figure 9 As shown, add 135 μl of the above mixture to each of the 16 wells. Add 15 μl of virus sample to each of wells N1-N4, mix well by pipetting, and then take 15 μl of the diluent from each well and add it to the corresponding well in the next row, and so on. On the 4th day, discard the culture medium in the 96-well plate, add 100 μl of the premixed virus diluent to each well, centrifuge at 2000 rpm for 30 min, incubate in a cell culture incubator for 10 h, discard the sample in the well, add 100 μl of fresh preheated cell culture medium, and incubate in a cell culture incubator. Finally, observe the fluorescence. Calculate the titer using the following formula: Titer = (F×C / V)×D. Where F is the fluorescence positivity rate; C is the number of cells at infection; V is the infection volume; and D is the virus dilution factor.
[0104] 6.3 Preparation of CEA-targeting chimeric antigen receptor T cells
[0105] 6.3.1 Isolation of human peripheral blood mononuclear cells
[0106] Collect 20 ml of aseptic venous blood from the patient into a test tube containing anticoagulant and mix gently. Dilute with 20 ml of PBS solution, then slowly add 10 ml of Ficoll separation buffer (Soluble Biotech, Beijing, catalog number P9011). Centrifuge at 2000 rpm for 20 min. At this point, the suspension in the test tube will show three layers: a pale yellow plasma layer on top, red blood cells at the bottom, and a milky white layer of lymphocytes (normal peripheral blood mononuclear cells) closely adhering to the red blood cell layer. Use a capillary tube to aspirate the cell suspension rich in white lymphocytes in the middle and transfer it to another test tube. Add 5 times the volume of PBS solution, mix well, centrifuge at 2000 rpm for 10 min, discard the supernatant, and wash twice using the same method. Resuspend the precipitated cells in 2 ml of PBS solution and count them for later use.
[0107] 6.3.2 Screening for CD3-positive T lymphocytes
[0108] Take the separated PBMCs and wash them with an appropriate amount of MACS buffer (10). 7 / ml). After centrifugation, resuspend the PBMCs in MACS buffer, adding 10 ml of buffer every 10 ml. 7PBMC was added with 20 μl of CD3 immunomagnetic beads (Miltenyi, 130-111-551), mixed and incubated at 4°C for 20 min; washed once with MACS buffer; added with 500 μl of MACS resuspension, added to the pre-washed MS separation column, the first flow-out cells were CD3-negative T cells; washed the separation column with MACS buffer for 3 times; added with 1 ml of eluted cells, and the obtained CD3-positive T cells were resuspended in X-VIVO medium.
[0109] 6.3.3 Lentivirus infection of CD3-positive T cells
[0110] According to the MOI=1 and virus titer, the volume of the infection virus was determined, and polybrene was added at a ratio of 1 / 1000, and incubated with CD3+T cells for 6-12 h, then the culture medium was replaced, and the fluorescence efficiency was observed after 2-4 d of culture.
[0111] 6.3.4 Flow cytometry sorting of positive clones
[0112] CEA was labeled with Alexa Fluor® 647 Coupling Kit (Fast) - Lightning-Link® (manufacturer: Abeam, 269823) to red fluorescence, and the labeled protein concentration was determined by BCA; the labeled CEA-647 was adjusted to a concentration of 5 μg / ml with FACE-Buffer (1% FBS+PBS); the CD3+T cells infected with trypsin were adjusted to a concentration of 3×10 6 6 cells / ml with FACE-Buffer; 500 μl of cell suspension was added to a 1.5 ml centrifuge tube, and centrifuged at 500 g for 5 min; resuspended with 50 μl of CEA-647, mixed by blowing, and incubated at 4°C for 30 min; centrifuged at 500 g for 5 min, resuspended with PBS; centrifuged at 500 g for 5 min again, resuspended with 1 ml of FACE-Buffer, and stored on ice in the dark; set up CD3+T cell control group and CD3+T cell+CEA-647 control group. Finally, the sorted positive cells were cultured, and 14F1CAR-CEA-T cells were obtained.
[0113] Example 7. Killing ability of 14F1CAR-CEA-T cells on tumor cells and detection of CAR-T cell viability
[0114] The killing ability of different antigen chimeric receptor T cells on LoVo cells and SW480 cells was detected by xCELLigence RTCA real-time label-free cell function analyzer, and the specific operation was as follows: on the first day, LoVo cells or SW480 cells were diluted to 2×10 6cells (3 x 10 4 Figure 10 Figure 11 Figure 12 Figure 10 Figure 11 Figure 12 Figure 12
[0115] Example 8. Tumor inhibition effect of CAR-T cells on colorectal cancer mouse model
[0116] 8.1 Construction of antigen chimeric receptor 14F1CARCEA1-HA
[0117] In order to make CAR-T play a better effect in the treatment of solid tumors, T2A and hyaluronidase HAase sequences were cloned at the C-terminal of the gene of 14F1CAR-CEA-1 to construct 14F1CARCEA1-HA. The HAase enzyme connected by T2A can degrade the hyaluronic acid in the extracellular matrix, reduce the viscosity of the hyaluronic acid, and enhance the permeability of the extracellular matrix tissue, which is conducive to the infiltration of CAR-T cells into solid tumors and solid tumors, thereby enhancing the therapeutic effect of CAR-T cells. The amino acid sequence of T2A is shown as SEQ ID NO. 22, and the nucleic acid sequence is shown as SEQ ID NO. 23; the amino acid sequence of HAase is shown as SEQ ID NO. 24, and the nucleic acid sequence is shown as SEQ ID NO. 25. The amino acid sequence of 14F1CARCEA1-HA is shown as SEQ ID NO. 26, and the nucleic acid sequence is shown as SEQ ID NO. 27.
[0118] 8.2 Preparation of 14F1CARCEA1-HA-T cells
[0119] The preparation method is the same as that of Example 6.
[0120] 8.3 Activity detection of hyaluronidase
[0121] The supernatant of 14F1CARCEA1-HA-T cells was collected, concentrated, and then appropriately diluted with 50mM sodium acetate-acetic acid buffer (pH 6.0), and the hyaluronidase activity at 37°C was determined by the p-dimethylaminobenzaldehyde method. The results show that the enzyme activity is 327.6U / mg.
[0122] LoVo cells in the logarithmic growth phase were diluted to 2.5×10 7 Female nude mice (C57) of about 20g were selected, and each was subcutaneously inoculated with 200μl on the right abdominal skin. The tumor growth condition was observed regularly, and drug intervention was started when the tumor diameter was about 80mm 3 There were three groups, namely the CAR-T-HA treatment group, the CAR-T treatment group and the control group, each group having 8 mice. The CAR-T-HA treatment group was injected with 2×10 6 14F1CAR-CEA-1-T cells in the tail vein, and the second injection was performed 7 days after the first injection, with the same dose and method; the CAR-T treatment group was injected with 2×10 6 14F1CARCEA1-HA-T cells in the tail vein, and the second injection was performed 7 days after the first injection, with the same dose and method; the control group was injected with the same number of T cells in the tail vein. The tumor diameter was detected every two days, and the average value was plotted to draw the tumor growth inhibition curve, and the results are shown inFigure 13 Figure 13 untransducted) control group of T cells not transfected with CAR). Both 14F1 CAR CEA1-HA-T and 14F1 CAR CEA-1-T were able to inhibit tumor growth, with 14F1 CAR CEA1-HA-T being more effective.
Claims
1. A chimeric antigen receptor targeting CEA, characterized in that, The chimeric antigen receptor is composed of anti-CEACAM-5 antigen nanobody, extracellular hinge region, transmembrane region, intracellular signal region, self-cleavage polypeptide T2A and hyaluronidase HAase in sequence, wherein the amino acid sequence of the anti-CEACAM-5 nanobody is shown as SEQ ID NO:
1.
2. The chimeric antigen receptor of claim 1, wherein, The extracellular hinge region is a CD8 alpha hinge region, and the amino acid sequence is shown as SEQ ID NO: 2; the transmembrane region is a CD28 transmembrane region, and the amino acid sequence is shown as SEQ ID NO: 3; the intracellular signal region comprises a costimulatory signal region and a first signal region, wherein the first signal region is a CD3 zeta signal region, and the amino acid sequence is shown as SEQ ID NO: 6; the costimulatory signal region comprises a CD28 signal region and a CD137 signal region, wherein the amino acid sequence of the CD28 signal region is shown as SEQ ID NO: 4, and the amino acid sequence of the CD137 signal region is shown as SEQ ID NO: 5; the amino acid sequence of the self-cleavage polypeptide T2A is shown as SEQ ID NO. 22; and the amino acid sequence of the HAase is shown as SEQ ID NO.
24.
3. The chimeric antigen receptor of claim 2, wherein, The amino terminal of the chimeric antigen receptor is connected with a signal peptide, and the amino acid sequence is shown as SEQ ID NO:
7.
4. The chimeric antigen receptor of claim 3, wherein, The amino acid sequence of the chimeric antigen receptor is shown as SEQ ID NO:
26.
5. A nucleic acid encoding the chimeric antigen receptor sequence of claim 4. The sequence of the nucleic acid is shown as SEQ ID NO.
27.
6. A chimeric antigen receptor T cell targeting CEA, characterized in that, The T cell contains the chimeric antigen receptor according to any one of claims 1-4.
7. Use of the chimeric antigen receptor according to any one of claims 1-4 in the preparation of a drug for treating colon cancer, pancreatic cancer, breast cancer, lung cancer or gastric cancer.
8. Use of the chimeric antigen receptor T cell according to claim 6 in the preparation of a drug for treating colon cancer, pancreatic cancer, breast cancer, lung cancer or gastric cancer.
Citation Information
Patent Citations
Preparation method and application of safety anti-CEA (anti-carcinoembryonic antigen) chimeric antigen receptor modified T cells
CN107164412A
Anticancer embryo antigen antibody as well as preparation method and application thereof
CN110713539A