A poxvirus and its application
By isolating and developing the locust poxvirus preparation of turtle horns, the problem of hazards of grassland locusts has been solved, efficient and environmentally friendly biological control effects have been achieved, and economic and social benefits have been improved.
Patent Information
- Application Number
- CN202211091614.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-07
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2042-09-07
AI Technical Summary
The existing technology is difficult to effectively prevent and control the harm of horned locusts on grassland areas to grass family grasslands, affecting the economic development of the animal husbandry, and traditional chemical control methods are harmful to the environment.
The locust poxvirus was isolated and identified, and developed into a biological control preparation. The insect poxvirus preparation was inoculated or sprayed, and the locust population was controlled by using its pathogenicity to locusts.
Significantly reduce the use of chemical pesticides, improve the quality of agricultural and sideline products, protect the ecological environment, bring economic and social benefits, and provide efficient and lasting locust control effects.
Smart Images

Figure CN116064414B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control technology, specifically to an entomopoxvirus and its application in biological control. Background Technology
[0002] The hairy-footed locust (Dasyhippus barbipes) belongs to the superfamily Acridoidea, family Gomphoceridae, and genus Dasyhipps in taxonomy. It primarily feeds on gramineous forage grasses such as sheepgrass and needlegrass kirch, and is an important early dominant species in grassland areas. In slightly degraded or lightly grazed grasslands, it occurs early and reaches high population densities, severely damaging the early growth of gramineous forage grasses and significantly impacting the development of the livestock economy. To protect the grassland ecological environment and ensure the safety of agricultural and livestock products, biological control products such as locust pathogens and integrated management technologies are applied to the monitoring and control of grassland locusts. Entomopoxvirus, belonging to the subfamily Entomopoxvirinae of the family Poxviridae, can alter the expression level of juvenile hormone in the host after infection, delaying host growth and development and inducing apoptosis; it is a pathogenic microorganism with biocontrol potential. Summary of the Invention
[0003] The inventors of this application isolated and identified an insect poxvirus from the grasshopper *Dasyhippus barbipes*, and named it *Dasyhippus barbipes entomopoxvirus*. Feeding inoculation demonstrated that this insect poxvirus exhibits strong pathogenicity against *Dasyhippus barbipes* and *Dasyhippus migratory grasshopper*. This provides a new material and theoretical basis for the development and application of insect poxviruses in insect pest biocontrol agents. Specifically:
[0004] In a first aspect, the present invention provides an entomopoxvirus.
[0005] The entomopoxvirus mentioned is Dasyhippus barbipes entomopoxvirus.
[0006] Preferably, the entomopoxvirus was deposited on August 9, 2022, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 45254.
[0007] Morphological and molecular identification by the College of Plant Protection, China Agricultural University, revealed that the *Trichodina trichodina* poxvirus belongs to the subfamily Entomopoxvirinae of the family Poxviridae. The *Trichodina trichodina* poxvirus consists of inclusion bodies and the viral particles enclosed within them. The inclusion bodies are mostly elliptical or circular with regular edges, ranging in diameter from 5.40±1.70 μm to 6.26±2.13 μm. After treatment with an alkaline solution at pH 11.5 for 30 min, the inclusion bodies show obvious swelling and rupture under an optical microscope. The *Trichodina trichodina* poxvirus particle has a structure similar to other poxvirus particles, consisting of a viral nucleus, lateral bodies, and a particle membrane, with a diameter of approximately 200-250 nm.
[0008] Preferably, the inclusion body gene sequence of the entomopoxvirus contains SEQ ID NO: 1.
[0009] CTAAAAATAGTGATGTTGTTAAAATTAGTACTAAATCTAATTGGCAAGAACCAATTATTGTATCAAATGCTGTAATGCGTGGTTCAAGTATTGAATTAACAAAATCATTAGAAGCAAGAAATTTACATGAATCAACAATTGGTGTTTTAGATATTTATGATACACCTGATCATGGTTCAAATGCTGGATTAATAAAAAGATTAACTATTGGTACAATTATTTCACATCATACATTAAAAATTAGAGAACGTATATTTAATGAAGTTAAAGATTTTATAACAAATTATGCTAAATCAAATAACATAATTAATATAAATAATGGTGTAATTATATCAATTATTGAAGAATCATCTGAATTTTATATAACTAGTATAGAACATTCAAAAGTTGAACAATTTGTAAAAGATATTAAATTAGCAAAAATATCAAATATATTTTGTACTAATGATATTGGCATTGAAGTTATTCCAATTCATGAAATGGATAAAATTAAAAAAATTAACGTTCCATCAAATAAATATTTTCAAATACGTATAAATGTTGGTAATAGAAGGGCATTACAACCAATGTTTATTGTTGATAATGGAATGTTAAATTTAGATAAGTATAAAATTAATAAAAATGAAATATTGTCATTTAGTGATCTATTAATAAAATATAATGATATAATTGAATTTGTTGATGTTGGACAAGCATTATATTCAACAATATGTAGTTCACTTAAATATTTTAGACAACTTAGTTTAGAAGCTAAAAAATCAATACAATATGTCAAATTACCAAATTATTTAGATTTTAGTCAATTAGTATCTTGTATGCATGATGTTGGTAAAATGGCTGGTGTTAGAGG(SEQ ID NO:1)
[0010] Preferably, the Entomopoxvirus is isolated from Dasyhippus barbipes.
[0011] In a second aspect, the present invention provides an inclusion body of the aforementioned entomopoxvirus.
[0012] Preferably, the nucleotide sequence of the inclusion body comprises SEQ ID NO: 1.
[0013] In a third aspect, the present invention provides a vector comprising inclusion bodies of the aforementioned entomopoxvirus.
[0014] In a fourth aspect, the present invention provides a cell comprising an inclusion body of the above-described entomopoxvirus or a vector described above.
[0015] In a fifth aspect, the present invention provides a microbial preparation comprising the aforementioned entomopoxvirus or its inclusion bodies.
[0016] Preferably, the microbial preparation further includes a culture medium or excipient for culturing entomopoxvirus. Preferably, the excipient can be a diluent, surfactant, solvent, etc.
[0017] Preferably, the microbial preparation is a liquid or a powder.
[0018] Preferably, the microbial preparation can be a mixture of one or more microorganisms.
[0019] Preferably, the active ingredient of the microbial preparation comprises at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% by mass of the above-mentioned entomopoxvirus or its inclusion bodies.
[0020] In a sixth aspect, the present invention provides a method for preparing the above-mentioned microbial preparation, the method comprising mixing the above-mentioned entomopoxvirus with a culture medium or excipients.
[0021] In a seventh aspect, the present invention provides a locust biological control agent, wherein the locust biological control agent comprises the above-mentioned entomopoxvirus or its inclusion bodies or the above-mentioned microbial preparations.
[0022] Preferably, the locust biological control agent may contain other locust-killing substances in addition to the aforementioned Entomopoxvirus or its inclusion bodies, such as reagents or locust-killing microorganisms that coexist with Entomopoxvirus.
[0023] Preferably, the locust biological control agent can be a liquid or a powder.
[0024] Preferably, the locusts are selected from the following species: Dasyhippus barbipes, Locus tamigratoria manilensis, or Oedaleus decorus asiaticus.
[0025] Preferably, the locusts are eggs, nymphs, or adults.
[0026] Preferably, the active ingredient of the locust biological control agent includes at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% by mass of the above-mentioned entomopoxvirus or its inclusion bodies.
[0027] In an eighth aspect, the present invention provides the application of the above-mentioned entomopoxvirus or its inclusion bodies, or the above-mentioned microbial preparations or the above-mentioned locust biocontrol agents in killing locusts.
[0028] Preferably, the locusts are selected from the following species: Dasyhippus barbipes, Locus tamigratoria manilensis, or Oedaleus decorus asiaticus.
[0029] Preferably, the locusts are eggs, nymphs, or adults.
[0030] A ninth aspect of the present invention provides a method for controlling locusts, the method comprising contacting locusts with the aforementioned entomopoxvirus or its inclusion bodies, the aforementioned microbial preparation or the aforementioned locust biological control agent.
[0031] Preferably, the locusts are selected from the following species: Dasyhippus barbipes, Locus tamigratoria manilensis, or Oedaleus decorus asiaticus.
[0032] Preferably, the locusts are eggs, nymphs, or adults.
[0033] Preferably, the contact can be feeding or spraying onto the body surface.
[0034] Preferably, at least 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 OBs / Headed Locusts.
[0035] In a tenth aspect, the present invention provides a method for causing locusts to die or reduce their number in grass plants, the method comprising applying the aforementioned entomopoxvirus or its inclusion bodies, the aforementioned microbial preparation, or the aforementioned locust biocontrol agent to the grass plants.
[0036] Preferably, the amount applied is at least 10. 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 OBs / Headed Locusts.
[0037] The entomopoxvirus or its inclusion bodies provided by this invention are pathogenic to the grasshopper locust, 10 5 Feeding occlusion bodies (OBs) about 8 days after inoculation can cause an average mortality rate of 90% for 4th instar larvae of the hairy-footed horned locust.
[0038] The entomopoxvirus provided by this invention has high pathogenicity against the dominant grassland locust, the hairy-footed horned locust, and has the potential to be used as a biological control agent for grassland locusts. It can bring significant economic, ecological and social benefits and is a development trend for maintaining fragile ecosystems such as grasslands.
[0039] Economic Benefits: Pest control in fragile ecosystems such as grasslands requires safe, green, and long-lasting methods. Locust poxviruses, due to inclusion body protection, exhibit strong resistance, and viral infections are characterized by rapid onset, high infectivity, and vertical transmission. Therefore, virus-based biocontrol agents offer highly effective and long-lasting protection, generating significant economic value at a relatively low cost.
[0040] Ecological benefits: The hairy-footed locust pox virus is a natural pathogenic microorganism of grassland locusts, which is harmless to humans and animals and environmentally friendly. The production process of the virus depends on the insect host and its cell line, and there are no toxic intermediate products, so it has no toxic side effects on the ecology.
[0041] Social benefits: Using viral agents to control pests can significantly reduce the use of chemical pesticides, reduce chemical residues, and improve the quality of agricultural products, thereby increasing the income and quality of life of people in pastoral areas, resulting in significant social benefits.
[0042] The "locusts" described in this invention belong to the order Orthoptera, including species from the superfamilies Tetrigoidea, Eustacoidea, and Locustoidea, distributed in tropical and temperate grasslands and deserts worldwide. They include, but are not limited to, migratory locusts or ground locusts. Examples of migratory locusts include the Oriental migratory locust (Locusta migratoriamanilensis (Meyen)), the Asian migratory locust (Locusta migratoria migratoria (Linnaeus)), and the Tibetan migratory locust (Locusta migratoria tibitensis Chen). Examples of ground locusts include the short-horned grasshopper or the rice grasshopper.
[0043] The "grass plants" mentioned in this invention include, but are not limited to, grasses such as ice grass, sheep grass, needlegrass kirch, bromegrass, orchardgrass, crested wheatgrass, foxtail grass, ryegrass, paspalum, timothy grass, Kentucky bluegrass, foxtail grass, needlegrass, and Sudan grass. Attached Figure Description
[0044] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:
[0045] Figure 1 Morphological characteristics of inclusion bodies under an optical microscope, where A is an inclusion body and B is an inclusion body that ruptured after treatment with an alkaline solution. The arrows show the morphological characteristics of the same inclusion body before and after alkaline solution treatment.
[0046] Figure 2 Morphological characteristics of particles under an optical microscope.
[0047] Figure 3 Phylogenetic tree of Dasyhippus barbipes entomopoxvirus constructed based on the spheroidin gene.
[0048] Figure 4 Changes in host cell survival rate after inoculation with Dasyhippus barbipes entomopoxvirus. CK is the uninoculated control, A is the survival rate curve of Dasyhippus barbipes, and B is the survival rate curve of Dasyhippus esculenta.
[0049] Figure 5 : Midgut epithelial cells of Dasyhippus barbipes entomopoxvirus after infection, where N: cell nucleus; V: virus particles aggregated in the growth matrix; Cy: cytoplasm; A: Dasyhippus barbipes entomopoxvirus growth matrix and deformed and ruptured midgut epithelial cells under transmission electron microscopy; B: midgut epithelial cells of the control group that have not been infected by the virus.
[0050] Figure 6 Histopathological sections of *Dasyhippus barbipes* entomopoxvirus-infected midgut and fat body, among which...
[0051] A: Control group: A1: Columnar cells of midgut epithelium; A2: Fat body cells; A3: Microvilli of midgut epithelium (arrow points to location); A4: Mitochondria in fat body cells (arrow points to location);
[0052] B: Treatment group: B1: Columnar cells of midgut epithelium; B2: Adiposome cells; B3: Microvilli of midgut epithelium (arrow pointing to location); B4: Mitochondria in adiposome cells (arrow pointing to location); B5: Midgut epithelium; L: Lipid vesicles; N: Nucleus. Detailed Implementation
[0053] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0054] The insects, reagents, and instruments used in the examples are as follows:
[0055] Test insects: Nymphs and adults of the hairy-footed grasshopper, collected in June 2019 and June 2021 from Taipusi Banner, Xilingol League, Inner Mongolia Autonomous Region (114.97°~115.53°E, 41.71°~41.83°N, altitude 1359~1411m).
[0056] Reagents: Blood / cell / tissue genomic DNA extraction kit, Tiangen Biotech (Beijing) Co., Ltd.; Premix Taq, Baori Biotechnology (Beijing) Co., Ltd.; Ringer's solution, Fuzhou Feijing Biotechnology Co., Ltd.; Sucrose, Sinopharm Chemical Reagent Co., Ltd.; Glutaraldehyde, Aladdin Reagent (Shanghai) Co., Ltd.
[0057] Instruments: JXFSTPRP-64 grinder (Shanghai Jingxin Industrial Development Co., Ltd.); T100 PCR instrument (Bio-Rad); 5424R centrifuge (Eppendorf); Optima XPN100 ultracentrifuge (Beckman). Example 1: Isolation, purification, morphological observation, and molecular identification of Dasyhippus barbipes entomopoxvirus.
[0058] I. Methods and Steps
[0059] 1. Separation and purification
[0060] Morphological classification and identification of collected locusts were performed with reference to Volumes 10, 32, and 43 of the Fauna Sinica and *Locust Taxonomy*. Simultaneously, genomic DNA was extracted from the locusts according to the instructions of the blood / cell / tissue genomic DNA extraction kit. Then, conserved fragments of the locust mitochondrial COI gene were amplified by PCR according to the Premix Taq reagent instructions for molecular identification. Primers were universal primers for the insect mitochondrial COI gene: forward primer 5'-TTTCTACAAATCATAAAGATATTGG-3' (SEQ ID NO: 2), and reverse primer 5'-TAAACTTCAGGGTGACCAAAAAATCA-3' (SEQ ID NO: 3).
[0061] After identification, the identified *Cladosporium triticum* was cut into small pieces with sterile scissors and placed into 1.5 mL sterile centrifuge tubes (1-3 insects / tube). An appropriate amount of zirconium oxide and 600 μL of Ringer's solution were added, and the mixture was ground at 60 Hz for 90 seconds. The mixture was then filtered through four layers of gauze to remove most of the insect tissue fragments from the grinding solution. 10-15 mL of 40% (w / w) sucrose solution was added to the bottom of a 50 mL centrifuge tube, and the tissue-free grinding solution was placed on top of the sucrose solution. The tube was centrifuged at 4 °C and 17,000 rpm for 2 hours. After centrifugation, the supernatant was discarded, and the bottom precipitate was dissolved and mixed with 35 mL of Ringer's solution. The mixture was then centrifuged at 4 °C and 17,000 rpm for 1 hour. The precipitate was dissolved in an appropriate amount of Ringer's solution to obtain a crude virus extract. 2 mL of 58% and 2 mL of 55% (w / w) sucrose solution were slowly added sequentially to an ultracentrifuge tube. Finally, crude virus extract was added to the top layer of the sucrose solution. The tubes were then ultracentrifuged at 22000 rpm for 2 hours using a horizontal rotor. The circular virus band in the center of the sucrose solution was transferred to a new ultracentrifuge tube. An appropriate amount of Ringer's solution was added and mixed well. The tubes were then ultracentrifuged at 17000 rpm for 1 hour using a horizontal rotor. The supernatant was removed, and the precipitate was dissolved in an appropriate amount of sterile Ringer's solution. The resulting suspension was relatively pure *Dasyhippus barbipes* entomopoxvirus. After flash freezing in liquid nitrogen, the suspension was stored at -80°C for long-term preservation.
[0062] 2. Observation of inclusion bodies and viral particle morphology
[0063] The morphology of Dasyhippus barbipes entomopoxvirus inclusion bodies (OBs) was observed under an Optec optical microscope with a 10x eyepiece and a 100x objective. The longest and shortest diameters were measured using OPTPro software. SPSS25 was used to perform statistical analysis on the measurement data to obtain the mean and range of the diameters of Dasyhippus barbipes entomopoxvirus inclusion bodies.
[0064] To obtain Dasyhippus barbipes entomopoxvirus particles, the Dasyhippus barbipes entomopoxvirus suspension obtained in the previous step was centrifuged at 12000 rpm for 30 min at 4 °C. After discarding the supernatant, 1 mL of alkaline lysis buffer was added, and the mixture was incubated in a water bath at 37 °C for 30 min. The alkaline lysis buffer was prepared as follows: 0.3 mol / L Na₂CO₃, 0.03 mol / L EDTA, 0.1 mol / L mercaptoethanol, pH 11.5. Most inclusion bodies were confirmed to be lysed under an Optec optical microscope. The mixture was then centrifuged at 500 rpm for 15 min at 4 °C, and the supernatant was collected. 43% and 40% (w / w) sucrose solutions were added sequentially to ultracentrifuge tubes, with the supernatant obtained in the previous step added to the top layer. The tubes were then ultracentrifuged at 22000 rpm for 2 h using a horizontal rotor. The circular virus band in the center of the sucrose solution was removed and placed in a new ultracentrifuge tube. An appropriate amount of Ringer's solution was added and mixed well. The tube was then ultracentrifuged at 22000 rpm for 1 hour at 4°C using a horizontal rotor. The supernatant was removed, and the precipitate was dissolved in an appropriate amount of sterile Ringer's solution to obtain a suspension of *Dasyhippus barbipesentomopoxvirus* particles. 20 μL of the virus particle suspension was negatively stained with phosphotungstic acid for transmission electron microscopy. The remainder was flash-frozen in liquid nitrogen and stored at -80°C for long-term preservation.
[0065] 3. Molecular identification
[0066] DNA of Dasyhippus barbipes entomopoxvirus was extracted using the DNeasy Blood & Tissue Kit. Nested PCR amplification and sequencing were performed using primers designed based on the spheroidin sequence of Dasyhippus barbipes entomopoxvirus inclusion body gene. The spheroidin sequence of Dasyhippus barbipes entomopoxvirus inclusion body gene was obtained by high-throughput sequencing, as shown in SEQ ID NO: 1. The primers used for nested PCR were forward primer 1 (5'-TCCACAAATAACTCCAGC-3' (SEQ ID NO: 4)) / reverse primer 1 (5'-GCACCAAATGTTCCTCTA-3' (SEQ ID NO: 5)) and forward primer 2 (5'GAAGGGCATTACAACCA-3' (SEQ ID NO: 6)) / reverse primer 2 (5'CCAGCCATTTTACCAAC-3' (SEQ ID NO: 7)). The first PCR amplification system and program settings were as follows: 2 μL DNA template, 10 μL Premix Taq enzyme reaction solution, 0.5 μL each of forward and reverse primers, 7 μL ddH2O, 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 60 s, 35 cycles. For the first 10 cycles, the annealing temperature was decreased by 1℃ each cycle until it reached 45℃; a final extension at 72℃ for 5 min was performed, and the product was stored at 4℃. The second PCR amplification system and program settings were as follows: 10 μL of the first amplification product, 20 μL Premix Taq enzyme reaction solution, 1 μL each of forward and reverse primers, 8 μL ddH2O. The extension time for the second PCR reaction was adjusted to 30 s, and the rest of the program was the same as the first. The PCR products were sent to Sanger sequencing by Sangon Biotech (Shanghai) Co., Ltd.
[0067] 4. Phylogenetic analysis of Dasyhippus barbipes entomopoxvirus based on the spheroidin gene
[0068] To clarify the phylogenetic relationship between *Dasyhippus barbipes* entomopoxvirus and known entomopathogenic viruses, inclusion body gene sequences of 13 entomopathogenic viruses were downloaded from the NCBI database, and phylogenetic trees were constructed using conserved functional fragments of these genes. The inclusion body gene sequences were aligned using MEGA7 software, and then the phylogenetic trees were constructed using the maximum likelihood method with IQTREE software. The downloaded gene sequence numbers are as follows: AB831176, AF019224, AF242294, AF403769, AY464569, AY464570, HF679133, NC001993, NC002520, NC021247, NC021248, NC023426, NC043366.
[0069] II. Experimental Results
[0070] 1. Morphological characteristics of inclusion bodies and viral particles
[0071] Dasyhippus barbipes entomopoxvirus consists of inclusion bodies and the viral particles enclosed within them. The inclusion bodies are mostly elliptical or circular with regular edges, and their diameter ranges from 5.40±1.70 (μm) to 6.26±2.13 (μm). Figure 1 A). The inclusion bodies of *Dasyhippus barbipes* entomopoxvirus are mainly composed of protein, which can lyse and release viral particles under alkaline conditions. After treatment with an alkaline solution at pH 11.5 for 30 minutes, the inclusion bodies show obvious swelling and rupture under an optical microscope. Figure 1 B). The Dasyhippus barbipes entomopoxvirus viral particle has a structure similar to other poxvirus particles, consisting of a viral nucleus, lateral bodies, and a particle membrane, with a diameter of approximately 200-250 nm. Figure 2 The amplification of inclusion body gene sequences from DNA extracted from crude viral extract using nested PCR and Sanger sequencing also confirmed the existence of *Dasyhippus barbipes* entomopoxvirus.
[0072] 2. Phylogenetic analysis of Dasyhippus barbipes entomopoxvirus
[0073] The nucleic acid sequence of the *Dasyhippus barbipes* entomopoxvirus inclusion body gene *spheroidin*, obtained by high-throughput sequencing, is 2318 bp in length, encoding 970 amino acids. Its amino acid similarity to homologous genes of other known locusts ranges from 81.94% to 96.22%, while its homology with insectpoxviruses from non-orthoptera hosts is less than 40%. Phylogenetic tree construction using conserved fragments of the inclusion body gene revealed that *Dasyhippus barbipes* poxvirus and *Dasyhippus barbipes* entomopoxvirus clustered together, indicating a close phylogenetic relationship between these two insectpoxviruses. Figure 3 ).
[0074] Example 2: Pathogenicity Study - Virulence Investigation and Pathological Observation of Infected Tissues
[0075] 1. Methods and Steps
[0076] To investigate the pathogenicity of *Dasyhippus barbipes* entomopoxvirus to its hosts, fourth-instar nymphs of *Dasyhippus barbipes* were fed with the virus. Simultaneously, the intestines and fat bodies of infected locusts were embedded and sectioned, and their histopathological features were observed using transmission electron microscopy. Referring to the locust poxvirus inoculation concentrations of Li Yongdan (2005) and Jaeger & Langridge (1984), two concentrations of 10... 5 OBs / head and 10 6 OBs / heads were inoculated separately. In June 2021, 360 healthy third-instar nymphs of the grasshopper *Clerodendrum trichotomum* were collected from the grassland area of Taipusi Banner, Xilingol League, Inner Mongolia. They were reared on wheat until the first day of the fourth instar and starved for 24 hours before inoculation. Wheat leaves were cut into similarly sized pieces, and 10 μL of solution containing 10... 5 OBs or 10 6 The OB virus suspension and Ringer's solution were air-dried and then fed to individual locusts. Locusts that had consumed intact leaves were used as effective test insects and placed in rearing cages, with 40 locusts per group and 3 replicates per group. The number of locusts that died each day was recorded, and the daily survival rate was calculated.
[0077] Take another 40 fourth-instar nymphs of the hairy-footed club-horned locust and feed them to 10 μL of a solution containing 10 5 Leaves of OBs (obtopril spp.) and control groups were fed leaves coated with an equal volume of Ringer's solution. Two days after inoculation, locusts were starved for 24 hours. Their intestines and fat bodies were dissected, and other tissues were cleaned. The tissues were then fixed in 1.5 mL centrifuge tubes with 1 mL of 2.5% glutaraldehyde at room temperature in the dark for 24 hours. After embedding the locusts in resin, the fixed intestinal tissue samples were added, and the tissue sections were prepared using an ultramicrotome (40-50 nm thickness). Histopathological features were observed using a transmission electron microscope. The tissue embedding and sectioning process was performed by the Institute of Agricultural Product Processing, Chinese Academy of Agricultural Sciences.
[0078] To investigate whether Dasyhippus barbipes entomopoxvirus can replicate in the non-host locust, the East Asian migratory locust, a 10 5 Fourth-instar Oriental migratory locusts were fed at an OBs / head concentration, with 20 locusts per group and three replicates. The feeding and inoculation method was the same as that for the inoculation of the hairy-footed cricket. The number of dead locusts was recorded daily, and the daily survival rate was calculated.
[0079] 2. Experimental Results
[0080] The fourth instar nymphs of the grasshopper began to die 4-5 days after inoculation with poxvirus. After 10 days, the mortality rate in the treatment group exceeded 90%, which was significantly different from the control group (10). 5 OBs / :*p<0.05; 10 6 OBs / head: **p<0.01). The time of mass host mortality was similar between the two treatment groups inoculated with different concentrations, and there was no significant difference in mortality rate (p>0.05). Figure 4 A). Observation of intestinal and fat body tissue sections of infected locusts revealed that poxvirus particles aggregated in the cytoplasm of intestinal epithelial cells, forming a membrane-bound matrix for development (A). Figure 5 On day 3 of locust infection with Dasyhippus barbipes entomopoxvirus, obvious lesions were already observed in the tissues. Numerous vacuoles appeared in both midgut epithelial cells and fat body cells; the nuclei of some midgut epithelial cells were deformed; and the microvilli of midgut epithelial cells were broken. Figure 6 A1-3, B1-3, B5); Lipid vesicles are reduced in fat body cells, and mitochondrial morphology changes and aggregation are observed. Figure 6 A4, B4, B5).
[0081] To explore laboratory propagation methods for *Dasyhippus barbipes* entomopoxvirus, *Dasyhippus barbipes* was fed to infected *Dasyhippus oryzae*. No infection was observed, and the mortality rate showed no significant difference (p>0.05). Figure 4 B).
[0082] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0083] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.
Claims
1. An Entomopoxvirus, characterized in that: The Entomopoxvirus is Dasyhippus barbipes entomopoxvirus, which was deposited in the General Microbiology Center of the China Culture Collection Administration on August 9, 2022, with a deposit number of CGMCC No.45254.
2. The Entomopoxvirus according to claim 1, wherein The Entomopoxvirus is isolated from Dasyhippus barbipes.
3. A microbial preparation, characterized in that The microbial preparation contains the Entomopoxvirus or its inclusion body according to claim 1 or 2.
4. The microbial preparation according to claim 3, characterized in that The microbial preparation also includes a culture medium or auxiliary material for culturing Entomopoxvirus.
5. The microbial preparation according to claim 3 or 4, characterized in that The microbial preparation is liquid or powder.
6. A locust biological control agent, characterized in that: The locust biological control agent comprises the Entomopoxvirus or its inclusion body according to claim 1 or 2 or the microbial preparation according to any one of claims 3-5.
7. Use of the Entomopoxvirus or its inclusion bodies according to claim 1 or 2, or the microbial preparation according to any one of claims 3 to 5, in killing Dasyhippus barbipes.
8. A method for controlling Dasyhippus barbipes, characterized in that: The method comprises contacting the Entomopoxvirus or its inclusion body according to claim 1 or 2, the microbial preparation according to any one of claims 3 to 5, or the locust biological control agent according to claim 6 with Dasyhippus barbipes.
9. A method for killing or reducing the number of Dasyhippus barbipes that harms grass plants, characterized in that: The method comprises applying the Entomopoxvirus or its inclusion body according to claim 1 or 2, the microbial preparation according to any one of claims 3 to 5, or the locust biological control agent according to claim 6 to the grass plants.
Citation Information
Patent Citations
Insect control with multiple toxins
CN1185718A
Recombinant entomopoxvirus
WO1993025666A1