Application of ZJPH2105 in biocatalytic preparation of chiral aromatic alcohol

Abstract

The application provides an application of a strain of Tolypocladium inflatum ZJPH2105 in preparing a chiral aromatic alcohol through asymmetric reduction of an aromatic ketone. The product obtained through catalysis of the strain of Tolypocladium inflatum ZJPH2105 has an e.e. value of greater than 99.9%, the strain is green and safe, easy to cultivate, and rich in source, and the conversion process does not need to add expensive coenzyme, and has the characteristics of low cost, green and environment-friendly conversion process and the like. The application uses the strain of Tolypocladium inflatum ZJPH2105 as a biological catalyst to reduce 4'-bromo-2,2,2-trifluoroacetophenone, when the substrate concentration is 10 mM, the yield of the target product (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol can reach 98.2%, and the e.e. value is greater than 99.9%.

Description

(I) Technical Field

[0001] This invention relates to the application of Tolypocladium inflatum strain ZJPH2105 in the preparation of chiral aromatic alcohols from asymmetric reduction of aromatic ketones. (II) Background Technology

[0002] Chiral aromatic alcohols are key intermediates in the formation of many drugs, bioactive molecules, fine chemicals, and pesticides. With the increasing variety and market demand for chiral drugs, the efficient preparation of highly optically active chiral aromatic alcohols has become an important research direction. Biocatalytic preparation of chiral aromatic alcohols has attracted widespread attention due to its environmental friendliness and mild reaction conditions. Biocatalysis can utilize free enzymes or whole cells as catalysts. However, enzymatic catalysis requires the addition of expensive coenzymes to ensure the reaction's success, and intracellular ketone reductases require separation and purification steps, which to some extent limits the industrial application of this method. Whole-cell catalysis, on the other hand, offers advantages such as low cost and readily available catalysts.

[0003] *Tolypocladium inflatum*, belonging to the phylum Ascomycota and family Nematodeaceae, is a fungus that parasitizes nematodes, rotifers, mites, mosquito larvae, fireflies, cicadas, and *Hepialus chinensis* moths, making it an important entomopathogenic fungus that can be used as an insecticide to reduce the use of chemical pesticides. *Tolypocladium inflatum* strains produce various bioactive secondary metabolites, the most important of which is cyclosporin A. Cyclosporin A is used in medicine as an immunosuppressant for organ transplantation or autoimmune diseases. Therefore, research on this strain has largely focused on its application in the fermentation production of cyclosporin, while research on its use as a catalyst for biocatalytic reactions is scarce. (III) Summary of the Invention

[0004] The purpose of this invention is to provide a method for preparing chiral aromatic alcohols using the *Tolypocladium inflatum* strain ZJPH2105. Using the mycelium of *Tolypocladium inflatum* strain ZJPH2105 as a biocatalyst for asymmetric reduction to prepare chiral alcohols has advantages such as the strain being safe and non-toxic, easy to culture, and low cost of preparing enzyme source cells. Furthermore, it can highly selectively catalyze the asymmetric reduction of the substrate 4-bromo-2,2,2-trifluoroacetophenone to prepare chiral aromatic alcohols, and the product has high optical purity.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] This invention provides the application of *Tolypocladium inflatum* in the biocatalytic preparation of chiral aromatic alcohols from the asymmetric reduction of prochiral ketone compounds. In the embodiments of this invention, the *Tolypocladium inflatum* is *Tolypocladium inflatum* ZJPH2105, deposited at the China Center for Type Culture Collection (CCTCC) on August 29, 2022, accession number: CCTCC M 20221346, address: Wuhan University, Wuhan, China, 430072, China.

[0007] Furthermore, the application is as follows: using wet cells obtained from fermentation culture of *Cereus macrocephala* as the enzyme source cells, using ketone compounds as substrates and auxiliary substrates, and constructing a transformation system with phosphate buffer at pH 6.0-8.0 (preferably pH 7.0) as the reaction medium, the reaction is carried out at 16-37℃ and 100-200 rpm (preferably 25℃-30℃ and 150-200 rpm, especially preferably 25℃). After the reaction, the reaction solution is separated and purified to obtain chiral aromatic alcohol compounds as shown in Formula II; the auxiliary substrates are glucose, maltose, fructose, methanol, isopropanol, or glycerol; the mass of the wet cells is 50-400 g / L (preferably 200-350 g / L, especially preferably 25℃) based on the buffer volume. The concentration of the substrate, in terms of buffer volume, is 5-30 mmol / L (preferably 10-20 mmol / L, most preferably 10 mmol / L); when the auxiliary substrate is glucose, maltose, fructose, or glycerol, the mass of the auxiliary substrate, in terms of buffer volume, is 20-200 g / L (preferably 50-150 g / L, most preferably 50 g / L); when the auxiliary substrate is methanol or isopropanol, the volume of the auxiliary substrate is 5-20% (preferably 10%) of the volume of the buffer solution.

[0008]

[0009] Wherein, R1 is H, halogen, NO2, OCH3 or CF3, and R2 is C1-C4 alkyl or CF3.

[0010] Preferably, R1 is Cl, Br or CF3, and R2 is CH3 or CF3.

[0011] Preferably, the compound of Formula I is one of the following: 4'-bromo-2,2,2-trifluoroacetophenone, 4'-bromoacetophenone, 4'-chloroacetophenone, or 4'-trifluoromethylacetophenone.

[0012] This invention provides a method for separating and purifying the above reaction solution. The separation and purification process is as follows: the reaction solution is extracted with an equal volume of ethyl acetate, centrifuged, the upper ethyl acetate extract phase is collected, and rotary evaporated. The crude extract is separated by silica gel column chromatography using a mixture of petroleum ether and ethyl acetate at a volume ratio of 4:1 as the eluent. The eluent containing the target product is collected and rotary evaporated to obtain the chiral aromatic alcohol compound shown in Formula II.

[0013] Furthermore, when the auxiliary substrate is glucose, maltose, fructose, or glycerol, the amount added is 25-200 g / L based on the buffer volume; when the auxiliary substrate is methanol or isopropanol, the amount added is 5%-10% (v / v) based on the buffer volume; preferably, the auxiliary substrate is glycerol, and the amount added is 50 g / L based on the buffer volume.

[0014] Taking 4'-bromo-2,2,2-trifluoroacetophenone as an example, this invention provides an application of Tolypocladium inflatum strain ZJPH2105 in the biocatalytic asymmetric reduction of aromatic ketones. The method is as follows: using wet cells obtained by fermentation culture of Tolypocladium inflatum strain ZJPH2105 as enzyme source cells, using 4'-bromo-2,2,2-trifluoroacetophenone as substrate, adding auxiliary substrates, and using phosphate buffer solution with pH 6.0-8.0 as reaction medium to form a transformation system, the reaction is carried out at 16-37℃ and 100-200 rpm (preferably 25℃-30℃ and 150-200 rpm). After the reaction, the reaction solution is separated and purified to obtain (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol product.

[0015] Furthermore, the wet bacterial cells of the present invention are obtained by the following method:

[0016] 1) Slant culture: The Tolypocladium inflatum ZJPH2105 strain was inoculated into slant culture medium and cultured at 25℃ for 6 days. The resulting slant culture was stored in a refrigerator at 4℃.

[0017] 2) Liquid culture: Take a 1cm sample from the slant culture obtained in step 1). 2 The bacterial blocks of various sizes are inoculated into liquid culture medium and fermented at 16-37℃ and 120-250rpm for 2-5 days (preferably 25℃ and 150rpm for 3 days). The resulting fermentation broth is centrifuged, and the precipitate is washed with 0.1M K2HPO4-KH2PO4 buffer at pH 7.0 and centrifuged again to obtain the wet bacterial cells, which are the enzyme source cells for catalytic substrates.

[0018] Furthermore, the slant culture medium mentioned in step 1) is PDA culture medium, composed of the following components at final concentrations: potato 200 g / L, glucose 20 g / L, agar 20 g / L, water as solvent, and natural pH. The fermentation culture medium mentioned in step 2) is composed of the following components at final concentrations: maltose 10 g / L, glucose 5 g / L, yeast extract 5 g / L, water as solvent, and natural pH.

[0019] The technical approach of this invention is as follows:

[0020]

[0021] The *Tolypocladium inflatum* strain described in this invention was provided by the Edible Fungi Laboratory of the Institute of Horticulture, Zhejiang Academy of Agricultural Sciences, and is now deposited at the China Center for Type Culture Collection (CCTCC) on August 29, 2022, with accession number CCTCC M 20221346.

[0022] The analytical method for the conversion solution described in this invention is as follows: After the reaction is completed, an equal volume of ethyl acetate (containing the internal standard tetradecane) is added to the conversion solution to terminate the reaction and the mixture is shaken and extracted for 30 min. After standing, the upper extract is taken and analyzed by gas chromatography. Finally, the yield and ee value of the target product are calculated.

[0023] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following: This invention provides a novel method for preparing chiral aromatic alcohols using the asymmetric reduction of 4'-bromo-2,2,2-trifluoroacetophenone catalyzed by *Tolypocladium inflatum* strain ZJPH2105. Compared with existing reports, this method achieves a product ee value >99.9% using *Tolypocladium inflatum* strain ZJPH2105 as a biocatalyst for the asymmetric reduction of 4'-bromo-2,2,2-trifluoroacetophenone. The product yield is 98.2% with an ee value >99.9%, and the strain is green, safe, easy to cultivate, and abundant. Furthermore, the transformation process does not require the addition of expensive coenzymes, resulting in low cost, a green transformation process, and environmental friendliness. This invention utilizes *Tolypocladium inflatum* strain ZJPH2105 as a biocatalyst for the asymmetric reduction of 4'-bromo-2,2,2-trifluoroacetophenone. When the substrate concentration is 10 mM, the yield of the target product (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol can reach 98.2%, with an ee value >99.9%. (iv) Description of the attached drawings

[0024] Figure 1 The gas chromatograms (containing internal standard tetradecane) of the substrate 4'-bromo-2,2,2-trifluoroacetophenone, the products (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol and (R)-1-(4-bromophenyl)-2,2,2-trifluoroethanol are shown.

[0025] Figure 2 The gas chromatogram (containing internal standard tetradecane) of the extract of *Zygophyllum septum* ZJPH2105 after asymmetric reduction of 4'-bromo-2,2,2-trifluoroacetophenone.

[0026] Figure 3 The gas chromatogram (containing internal standard dodecane) of the extract of *Zygophyllum septum* ZJPH2105 after asymmetric reduction of 4'-bromoacetophenone.

[0027] Figure 4 The gas chromatogram (containing internal standard dodecane) of the extract of *Zygophyllum septum* ZJPH2105 after asymmetric reduction of 4'-chloroacetophenone.

[0028] Figure 5 The gas chromatogram (containing internal standard dodecane) of the extract of *Zygophyllum septum* ZJPH2105 after asymmetric reduction of 4'-trifluoromethylacetophenone. (V) Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0030] Example 1: Strain Identification

[0031] Morphological characteristics of strain ZJPH2105: After cultivation on PDA plates, the basic characteristics of strain ZJPH2105, including colony morphology, color, and growth rate, were observed. On PDA plates, colonies were pure white, flocculent, round, and dense; the reverse side of the medium was pale yellowish-brown, with no exudate.

[0032] Molecular biological identification: The ITS sequence of strain ZJPH2105 was determined by Beijing Qingke Biotechnology Co., Ltd. Using extracted total cellular DNA as a template, the ITS sequence of the strain was amplified using universal fungal primers ITS1 and ITS4. The PCR products were then subjected to 1% agarose gel electrophoresis. Sequencing confirmed the ITS gene sequence of strain ZJPH2105 as shown in SEQ ID NO.1. SEQ ID NO.1: AACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATCAACTCCCAAACCCCTGTGAACATACCCAACGTTGCTTCGGCGGGACCGCCCCGGCGCCTCGGCGTCCCGGAACCAGGCGCCCGCCGGAGGACCCAAACTCTTGTTTAACCATAGTGGCATATTCTGAGTCTCACAAGAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCAGCGGCTTGGTGTTGGGGACCGGCCCCGGCCGCCCCCCAAATGCAGTGGCGAC CTCGCCGCAGCCTCCCCTGCGTAGTAGCACAACTCGCACCGGAGCGCGGAGACGGTCACGCCGTAAAACGCCCAACTTCTCAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGTCGGAGG

[0033] The ITS sequence (SEQ ID NO.1) of strain ZJPH2105 was subjected to homology alignment (BLAST) on the NCBI website (http: / / www.ncbi.nlm.nih.gov). The results showed that strain ZJPH2105 had 93% sequence homology with Tolypocladium inflatum strain (GenBank accession number: No. AB103381.1).

[0034] Based on the morphological characteristics and molecular biological identification of strain ZJPH2105, the strain was identified and named *Tolypocladium inflatum* ZJPH2105. It is deposited at the China Center for Type Culture Collection (CCTCC) on August 29, 2022, with accession number CCTCC NO: M 20221346 and address: Wuhan University, Wuhan, China 430072, China.

[0035] Example 2: Obtaining wet mycelium

[0036] The slant culture medium consists of: 200 g / L potato, 20 g / L glucose, 20 g / L agar, water as solvent, and natural pH.

[0037] Liquid culture medium composition: 10 g / L maltose, 5 g / L glucose, 5 g / L yeast extract, water as solvent, natural pH.

[0038] The ZJPH2105 strain of *Cercospora sulphureus* was inoculated onto an agar slant culture medium and cultured at 25°C for 6 days to obtain the agar slant culture.

[0039] A 1cm piece was cut from a mature slant culture. 2 Microbial blocks of approximately 100-250 mL inoculated into a 250 mL shake flask containing 100 mL of liquid culture medium and cultured at 25 °C and 150 rpm for 3 days. After the culture was completed, the fermentation broth was centrifuged at 9000 rpm for 10 min and washed with 0.1 M, pH 7.0 potassium phosphate buffer to collect the wet microbial cells.

[0040] Example 3: Gas Chromatographic Detection Method for the Product

[0041] After the reaction was complete, an equal volume of ethyl acetate was added to the conversion solution for extraction for 30 min, followed by centrifugation. The supernatant extract was then subjected to gas chromatography analysis. The gas chromatography method was as follows: an Agilent 7820A gas chromatograph was used, and a Varian CP-Chirasil-Dex chiral capillary gas chromatograph (25 m × 0.25 mm × 0.25 μm, df = 0.25) was used. Tetradecane (3.78 mM) was used as the internal standard for quantitative analysis of the substrate and product. High-purity nitrogen was used as the carrier gas, and a flame ionization detector (FID) was employed.

[0042] Gas chromatography detection conditions: carrier gas flow rate 2 mL / min, injection volume 1 μL, split ratio 15:1, injection port temperature 250℃, detector temperature 250℃, column temperature 142℃, increased to 152℃ at a rate of 1℃ / min. Retention times for each substance were: 4'-bromo-2,2,2-trifluoroacetophenone 1.6 min, tetradecane 3.0 min, (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol 8.4 min, and (R)-1-(4-bromophenyl)-2,2,2-trifluoroethanol 8.7 min. The gas chromatogram is shown below. Figure 1 .

[0043] The yield calculation method is as follows:

[0044] Standard curve construction: Substrate and product standard solutions with a final concentration of 40 mM were prepared and diluted to obtain standard solutions with concentrations of 5, 10, 15, 20, 30, and 40 mM, respectively. These solutions were then detected by gas chromatography. The peak areas were obtained by integrating the chromatograms. A standard curve was plotted with the ratio of the substrate or product peak area to the tetradecane peak area on the x-axis and the ratio of the substrate or product concentration to the tetradecane concentration on the y-axis. Linear regression was then performed to obtain the product standard curve equation: y = 2.0037x + 0.2472, R0 2 =0.9997.

[0045] The formula for calculating product yield is as follows:

[0046] Yield (%) = C p / C0×100% Formula 1

[0047] In the formula C p The concentration of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol after the reaction is complete, and C0 is the initial concentration of 4'-bromo-2,2,2-trifluoroacetophenone.

[0048] The optical purity of the product is characterized by the ee value. The calculation formula is:

[0049] ee = (C S -C R ) / (C S +C R )×100% Formula 2

[0050] In the formula C R and C S The molar concentrations of 1-(4-bromophenyl)-2,2,2-trifluoroethanol are for the R-configuration and S-configuration, respectively.

[0051] Examples 4-10: Effect of the type of auxiliary substrate on biocatalytic reduction reaction

[0052] The wet bacterial cells obtained according to the method in Example 2 were resuspended in 10 mL of potassium phosphate buffer (0.1 M, pH 7.0), with the wet bacterial cell addition amounting to 200 g / L buffer by wet weight. 15 mM of 4'-bromo-2,2,2-trifluoroacetophenone (by buffer volume) was added as a substrate, along with 100 g / L of different sugars and glycerol (by buffer volume), or 10% (v / v) methanol and isopropanol (by buffer volume) as auxiliary substrates. The mixture was placed in a shaker at 25°C and 150 rpm for 72 h for biotransformation. The yield and ee value of the product (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol were analyzed using the detection method in Example 3 (Table 1).

[0053] Table 1. Effects of adding different auxiliary substrates on reaction yield and ee value.

[0054]

[0055] As shown in Table 1, when the auxiliary substrate is glycerol, the yield of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol is the highest at 70.1%, with an ee value >99.9%.

[0056] Examples 11-17: Effect of glycerol concentration on bioreduction reaction

[0057] The wet bacterial cells obtained according to the method in Example 2 were resuspended in 10 mL of potassium phosphate buffer (0.1 M, pH 7.0), with the wet bacterial cell addition amounting to 200 g / L buffer by wet weight. 15 mM of 4'-bromo-2,2,2-trifluoroacetophenone was added as a substrate, and 0 g / L, 25 g / L, 50 g / L, 75 g / L, 100 g / L, 150 g / L, and 200 g / L of glycerol were added as auxiliary substrates by buffer volumes. The mixture was placed in a shaker at 25°C and 150 rpm for 72 h for biotransformation. The yield and ee value of the product (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol were analyzed using the detection method in Example 3 (Table 2).

[0058] Table 2 Effect of glycerol concentration on reaction yield and ee value

[0059]

[0060] As shown in Table 2, when the concentration of the auxiliary substrate glycerol is 50 g / L, the yield of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol is the highest at 72.7%, with an ee value > 99.9%.

[0061] Examples 18-22: Effect of conversion temperature on bioreduction reaction

[0062] The wet bacterial cells obtained according to the method in Example 2 were resuspended in 10 mL of potassium phosphate buffer (0.1 M, pH 7.0), with the wet bacterial cell addition amounting to 200 g / L buffer by wet weight. 15 mM of 4'-bromo-2,2,2-trifluoroacetophenone (by buffer volume) was added as a substrate, and 50 g / L of glycerol (by buffer volume) was added as an auxiliary substrate. The mixture was then placed in shakers at 16°C, 20°C, 25°C, 30°C, and 37°C at 150 rpm for 72 h for biotransformation. The yield and ee value of the product (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol were analyzed using the detection method in Example 3 (Table 3).

[0063] Table 3 Effect of conversion temperature on reaction yield and ee value

[0064]

[0065] As shown in Table 3, when the biotransformation reaction is carried out at 25°C, the yield of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol is the highest at 72.7%, with an ee value >99.9%.

[0066] Examples 23-27: Effect of initial pH of buffer solution on bioreduction reaction

[0067] The wet bacterial cells obtained according to the method in Example 2 were suspended in 10 mL of potassium phosphate buffer (0.1 M) with a pH range of 6.0-8.0, and the wet bacterial cell volume was 200 g / L of buffer. 15 mM of 4'-bromo-2,2,2-trifluoroacetophenone was added as a substrate, and 50 g / L of glycerol was added as an auxiliary substrate. The mixture was placed in a shaker at 25°C and 150 rpm for 72 h for biotransformation. The yield and ee value of the product (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol were analyzed using the detection method in Example 3 (Table 4).

[0068] Table 4. Effect of initial pH of buffer solution on reaction yield and ee value.

[0069]

[0070] As shown in Table 4, when the initial pH of the buffer solution is 7.0, the yield of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol is the highest at 71.3%, with an ee value >99.9%.

[0071] Examples 28-35: Effects of wet bacterial cell dosage on bioreduction reaction

[0072] The wet bacterial cells obtained according to the method in Example 2 were suspended in 10 mL of potassium phosphate buffer (0.1 M, pH 7.0). The wet bacterial cell additions were 50 g / L, 100 g / L, 150 g / L, 200 g / L, 250 g / L, 250 g / L, and 300 g / L buffer, respectively, based on wet weight. 15 mM of 4'-bromo-2,2,2-trifluoroacetophenone was added as a substrate, and 50 g / L of glycerol was added as an auxiliary substrate. The mixture was placed in a shaker at 25 °C and 150 rpm for 72 h for biotransformation. The yield and ee value of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol were analyzed using the detection method in Example 3 (Table 5).

[0073] Table 5. Effect of wet bacterial cell dosage on reaction yield and ee value.

[0074]

[0075] The preferred wet cell dosage is 350 g / L. Under these conditions, the yield of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol is 87.5%, with an ee value >99.9%.

[0076] Examples 36-40: Effects of substrate concentration on bioreduction reactions

[0077] The wet bacterial cells obtained according to the method in Example 2 were suspended in 10 mL of potassium phosphate buffer (0.1 M, pH 7.0), with the wet bacterial cell addition amounting to 350 g / L buffer by wet weight. 10 mM, 15 mM, 20 mM, 30 mM, and 40 mM of 4'-bromo-2,2,2-trifluoroacetophenone were added as substrates, and 50 g / L of glycerol was added as an auxiliary substrate. The mixture was placed in a shaker at 25°C and 150 rpm for 72 h for biotransformation. The yield and ee value of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol were analyzed using the detection method in Example 3 (Table 6).

[0078] Table 6. Effect of substrate concentration on reaction yield and ee value.

[0079]

[0080] The preferred substrate concentration is 10 mM. Under these conditions, the yield of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol is 98.2%, with an ee value >99.9%.

[0081] Examples 41-49: Transformation results of different aryl ketone substrates by bioreduction of ZJPH2105 strain of *Cercospora sulphureus*

[0082] The wet bacterial cells obtained according to the method in Example 2 were suspended in 10 mL of potassium phosphate buffer (0.1 M, pH 7.0), with the wet bacterial cell volume being 200 g / L of buffer by wet weight. Different substrates, including 4'-bromo-2,2,2-trifluoroacetophenone, 4'-bromoacetophenone, 4'-chloroacetophenone, and 4'-trifluoromethylacetophenone, were added at 10 mM (buffer volume) to prepare (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol, (R)-1-(4-bromophenyl)ethanol, (R)-1-(4-chlorophenyl)ethanol, and (R)-1-(4-trifluoromethylphenyl)ethanol. 100 g / L glucose was added as an auxiliary substrate. The mixture was placed in a shaker at 25°C and 150 rpm for 72 h for biotransformation. The results were analyzed using the detection method described in Example 3 (Table 7).

[0083] Table 7. Yields and ee values ​​of different aromatic ketone reductions catalyzed by *Cyclophorus spp.* ZJPH2105 strain.

[0084]

[0085] NR: No response

[0086] Example 50: Asymmetric reduction of 4'-bromo-2,2,2-trifluoroacetophenone by Lentinus edodes strain 808 to prepare (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol

[0087] The slant culture medium consists of: 200 g / L potato, 20 g / L glucose, 20 g / L agar, water as solvent, and natural pH.

[0088] Seed culture medium composition: 200 g / L potato, 20 g / L glucose, water as solvent, natural pH;

[0089] Fermentation medium composition: maltose 10g / L, glucose 5g / L, yeast extract 5g / L, solvent is water, pH is natural.

[0090] The 808 strain of shiitake mushroom was inoculated onto an agar slant culture medium and cultured at 25°C for 8 days to obtain the slant culture.

[0091] A 1cm piece was cut from a mature slant culture. 2 Microbial blocks of approximately 100 μL inoculated into 250 mL shake flasks containing 100 mL of liquid culture medium and incubated at 25 °C and 150 rpm for 7 days. Then, 10 mL of seed culture (10% v / v) was inoculated into 100 mL of fermentation medium and incubated at 25 °C and 150 rpm for 3 days. After incubation, the fermentation broth was filtered and washed with 0.1 M, pH 7.0 potassium phosphate buffer to collect the wet microbial cells.

[0092] 2 g of wet mycelium of Lentinus edodes strain 808 was added to 10 mL of potassium phosphate buffer (0.1 M, pH 7.0). The substrate 4'-bromo-2,2,2-trifluoroacetophenone was added at a concentration of 5 mM based on the buffer volume. Glucose at a concentration of 100 g / L based on the buffer volume was added as an auxiliary substrate. Biotransformation was carried out at 25 °C and 200 rpm for 72 h. After the reaction was completed, the detection method in Example 3 was used for analysis and detection.

[0093] Conclusion: The ee value of 12.0% and the yield of (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol were achieved by strain 808 of Lentinus edodes in the transformation of 4'-bromo-2,2,2-trifluoroacetophenone to (S)-1-(4-bromophenyl)-2,2,2-trifluoroethanol.

Claims

1. The application of *Tolypocladium inflatum* in the biocatalytic preparation of chiral aromatic alcohols from asymmetricly reduced prochiral ketone compounds, wherein *Tolypocladium inflatum* ZJPH2105 is deposited at the China Center for Type Culture Collection (CCTCC) on August 29, 2022, accession number: CCTCCNO: M 20221346, address: Wuhan University, Wuhan, China, 430072; the asymmetricly reduced prochiral ketone compound is a ketone compound of Formula I, and the chiral aromatic alcohol compound of Formula II is as shown in Formula II. AND II In formulas I and II, R1 is H, halogen, NO2, OCH3 or CF3, and R2 is C1-C4 alkyl or CF3.

2. The application as described in claim 1, characterized in that... The application is as follows: using wet cells obtained from fermentation culture of *Cereus macrocephala* as the enzyme source cells, using ketone compounds as substrates and auxiliary substrates, and constructing a transformation system with phosphate buffer solution at pH 6.0-8.0 as the reaction medium, the reaction is carried out at 16-37℃ and 100-200 rpm. After the reaction, the reaction solution is separated and purified to obtain chiral aromatic alcohol compounds as shown in Formula II. The auxiliary substrates are glucose, maltose, fructose, methanol, isopropanol, or glycerol. The mass of the wet cells is 50-400 g / L based on the buffer volume. The concentration of the substrate is 5-30 mmol / L based on the buffer volume. When the auxiliary substrate is glucose, maltose, fructose, or glycerol, the mass of the auxiliary substrate is 20-200 g / L based on the buffer volume. When the auxiliary substrate is methanol or isopropanol, the volume of the auxiliary substrate is 5-20% of the volume of the buffer solution. AND II Wherein, R1 is H, halogen, NO2, OCH3 or CF3, and R2 is C1-C4 alkyl or CF3.

3. The application as described in claim 2, characterized in that: R1 is Cl, Br, or CF3, and R2 is CH3 or CF3.

4. The application as described in claim 3, characterized in that... The compound of Formula I is one of the following: 4'-bromo-2,2,2-trifluoroacetophenone, 4'-bromoacetophenone, 4'-chloroacetophenone, or 4'-trifluoromethylacetophenone.

5. The application as described in claim 2, characterized in that: The reaction temperature is 25℃-30℃.

6. The application as described in claim 2, characterized in that: The auxiliary substrate is glycerol, and the mass of the auxiliary substrate is 50 g / L based on the buffer volume.

7. The application as described in claim 2, characterized in that: The pH value of the phosphate buffer solution is 7.

0.

8. The application as described in claim 2, characterized in that: The concentration of the substrate was 10 mmol / L, based on the volume of the buffer solution.

9. The application as described in claim 2, characterized in that: The mass of the wet bacterial cells is 200-350 g / L based on the volume of the buffer solution.

10. The application as described in claim 2, characterized in that... The wet bacterial cells were obtained as follows: 1) Slant culture: Tolypocladium inflatum ZJPH2105 was inoculated into slant culture medium and cultured at 25°C for 6 days; 2) Liquid culture: Take 1 cm of the slant culture obtained in step 1). 2 The bacterial blocks of various sizes were inoculated into liquid culture medium and fermented at 16-37°C and 120-250 rpm for 2-5 days. The fermentation broth was centrifuged, and the resulting precipitate was washed with 0.1 M K2HPO4-KH2PO4 buffer at pH 7.0 and centrifuged again to obtain the wet bacterial cells.

Images