Application of AKR1C1 in the preparation of diagnostic and therapeutic products for extrahepatic bile duct cancer
By developing a diagnostic kit based on the detection of AKR1C1 expression levels and using shRNA to target and downregulate AKR1C1 expression, the challenges in the diagnosis and treatment of extrahepatic cholangiocarcinoma have been solved, enabling precise diagnosis and effective treatment of extrahepatic cholangiocarcinoma.
Patent Information
- Application Number
- CN202211100871.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-09
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2042-09-09
AI Technical Summary
The lack of specific diagnostic methods and effective treatments for extrahepatic cholangiocarcinoma in current technologies leads to misdiagnosis, high recurrence and metastasis rates, low 5-year survival rates, and the role of AKR1C1-C4 in extrahepatic cholangiocarcinoma remains unclear.
Using AKR1C1 as a diagnostic marker, a diagnostic kit for extrahepatic cholangiocarcinoma was prepared by detecting the expression level of AKR1C1. Therapeutic drugs were prepared by inhibiting AKR1C1 expression through shRNA or recombinant expression vectors, and AKR1C1 expression was downregulated to inhibit the proliferation and migration of extrahepatic cholangiocarcinoma cells.
AKR1C1 can serve as a marker for the diagnosis, staging, grading, and prognostic assessment of extrahepatic cholangiocarcinoma. By downregulating AKR1C1 expression, it can inhibit the proliferation and migration of extrahepatic cholangiocarcinoma cells and improve patient prognosis.
Smart Images

Figure CN116064799B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and specifically to the application of AKR1C1 as a biomarker for extrahepatic cholangiocarcinoma, particularly in the preparation of diagnostic reagents or kits for extrahepatic cholangiocarcinoma and in therapeutic drug compositions. Background Technology
[0002] Extrahepatic cholangiocarcinoma (ECC) refers to malignant tumors originating from the epithelial cells of the extrahepatic bile ducts, accounting for approximately 90% of all cholangiocarcinomas. ECC is frequently misdiagnosed and mistreated due to its complex and varied clinical course and lack of typical symptoms. Furthermore, its high recurrence and metastasis rates result in an extremely poor prognosis, with a 5-year survival rate of approximately 5%, seriously threatening human health. Moreover, because its pathogenesis remains unclear, there are currently no specific diagnostic methods or ideal treatments available domestically or internationally. Therefore, exploring the pathogenesis of extrahepatic cholangiocarcinoma and identifying precise and effective early diagnostic and therapeutic targets are of great significance for delaying disease progression, improving patient survival rates, and enhancing prognosis.
[0003] The aldehyde-ketone reductase family (AKRs) is a superfamily containing 16 families, with over 190 members currently identified. They participate in redox reactions using triphosphopyridine nucleotide (NADPH) as a coenzyme, and are one of the three major superfamilies of redox enzymes. They are widely distributed in prokaryotes and eukaryotes, such as plants, fungi, and vertebrates. These 16 families are designated AKR1-AKR16, but only three families—AKR1, AKR6, and AKR7—belong to mammals. AKR1 is the largest family. Related studies have shown that AKR1C plays an important role in the occurrence, development, and drug resistance of tumors (Penning TM et al., Aldo-Keto Reductases and Cancer Drug Resistance. Pharmacol Rev. 2021, 73(3): 1150-1171. Zeng CM et al., Aldo-Keto Reductase AKR1C1-AKR1C4: Functions, Regulation, and Intervention for Anti-cancer Therapy. Front Pharmacol. 2017, 14; 8: 119.).
[0004] AKR1C includes AKR1C1-C4 subtypes, among which AKR1C4 is mainly liver-specific. Although AKR1C is a reductase, increasing research has found that AKR1C1-C3 has non-catalytic functions in tumor cells, including: function as a co-activator (Park S et al., Inhibitory Interplay of SULT2B1b Sulfotransferase with AKR1C3 Aldo-keto Reductase in Prostate Cancer. Endocrinology. 2020, 1; 161(2): bqz042.), regulation of the E3-ligase-ubiquitin system (Fan L., The steroidogenic enzyme AKR1C3 regulates stability of the ubiquitin ligase Siah2 in prostate cancer cells. J. Biol. Chem. 2015, 21; 290(34): 20865–20879.), and regulation of tumor drug sensitivity (Phoo NLL et al., Transcriptomic Profiling Reveals AKR1C1 and AKR1C3 Mediate Cisplatin Resistance in Signet Ring Cell Gastric Carcinoma via Autophagic Cell Death. Int J Mol Sci. 2021, 19; 22(22): 12512.), tumor cell apoptosis (Li C et al., Panax ginseng polysaccharide induces apoptosis by targeting Twist / AKR1C2 / NF-1 pathway in human gastric cancer. Carbohydr Polym. 2014, 15; 102: 103-9.), and metastasis (Zhu H et al., AKR1C1 Activates STAT3 to Promote the Metastasis of Non-Small Cell Lung Cancer. Theranostics. 2018, 1; 8(3): 676-692.). However, there are no reports on the role of AKR1C1-C4 in extrahepatic bile duct carcinoma.Whether there are abnormalities in the expression level of AKR1C1-C4 in ECC, whether differentially expressed AKR1C molecules are related to ECC progression, and whether they can regulate the proliferation, death, and migration of ECC cells remain unclear. Summary of the Invention
[0005] This invention is based on the above research and aims to provide a biomarker for the diagnosis of extrahepatic cholangiocarcinoma, as well as a new use for AKR1C1, namely, its application in the preparation of diagnostic kits or therapeutic drug compositions for extrahepatic cholangiocarcinoma.
[0006] This invention first analyzes the expression of AKR1C1-C4 in intrahepatic and extrahepatic cholangiocarcinoma cell lines and tumor tissues. The results show that AKR1C1 and AKR1C2 are highly expressed in extrahepatic cholangiocarcinoma. Subsequently, the expression of AKR1C1 and AKR1C2 was detected in digestive system tumor cells, and the results showed that AKR1C1 is specifically highly expressed in ECC.
[0007] Next, immunohistochemistry was used to detect the expression of AKR1C1 in tumor tissues of ECC patients and adjacent normal control tissues, and its relationship with ECC disease progression and prognosis was analyzed. The expression of differentially expressed genes in ECC cells was inhibited, and the proliferation, death, and migration abilities of ECC cells were detected. The value of AKR1C1 in the accurate diagnosis and treatment of extrahepatic cholangiocarcinoma was analyzed, thereby providing an effective molecular basis for the diagnosis, treatment, and prognostic assessment of ECC.
[0008] Specifically, the present invention provides the following technical solution:
[0009] In a first aspect, the invention provides the application of AKR1C1 as a diagnostic biomarker. Specifically, it provides the application of reagents for detecting AKR1C1 in the preparation of kits for the diagnosis, staging, grading, and prognostic assessment of extrahepatic cholangiocarcinoma.
[0010] Preferably, the reagent for detecting AKR1C1 is a reagent for detecting the expression level of AKR1C1 in biological samples at the gene level and / or protein level; the kit contains the reagent for detecting the expression level of AKR1C1 in biological samples.
[0011] Further optimization involves selecting reagents from one or more of the following detection techniques or methods: immunohistochemistry, Western blot, and qRT-PCR. All three methods can be used to detect AKR1C1 expression levels in biological samples.
[0012] Further preferably, the reagent for detecting the expression level of AKR1C1 in biological samples includes PCR primers with detection specificity for the AKR1C1 gene, or antibodies that specifically bind to the AKR1C1 protein. The PCR primers with detection specificity for the AKR1C1 gene are shown in SEQ ID NO. 1–2, and the primer sequences for the control GAPDH are shown in SEQ ID NO. 9 and SEQ ID NO. 10.
[0013] In a second aspect, the present invention provides a kit for the diagnosis, staging, grading, or prognostic assessment of extrahepatic cholangiocarcinoma, the kit comprising reagents for detecting the content of AKR1C1 in biological samples.
[0014] The kit for detection at the gene level consists of a reverse transcription system, a primer system, and an amplification system. The primer system includes PCR primers as shown in SEQ ID NO.1-2 and SEQ ID NO.9-10. The kit for detection at the protein level consists of a tumor tissue paraffin section preparation reagent system, an antigen retrieval reagent system, and an antibody system. The antibody system is preferably a monoclonal antibody against AKR1C1 protein.
[0015] AKR1C1-F primer: AGATGGCTTTGCTGTGGTC (SEQ ID NO.1);
[0016] AKR1C1-R primers: ATCTTGCTCACGCTCAACCT (SEQ ID NO.2);
[0017] GAPDH-F primers: CAGGAGGCATTGCTGATGAT; (SEQ ID NO.9);
[0018] GAPDH-R primer: GAAGGCTGGGGCTCATTT (SEQ ID NO.10).
[0019] Furthermore, the biological sample is selected from any one of surgical tumor tissue, tumor tissue obtained by puncture, or circulating tumor cells collected from the patient's blood. For tumor patients diagnosed early or who have missed the opportunity for surgery, the expression level of AKR1C1 can be detected by obtaining cancer tissue by puncture, or the AKR1C1 level can be detected by collecting circulating tumor cells from the patient's blood, thereby achieving early diagnosis and prognostic assessment.
[0020] A third aspect of the invention provides the use of substances that inhibit or silence AKR1C1, namely, their use in the preparation of drugs for treating extrahepatic bile duct carcinoma.
[0021] Preferably, the substance that inhibits or silences AKR1C1 is an shRNA that inhibits AKR1C1 expression, or a recombinant expression vector or transgenic cell line containing the shRNA, and the sequence of the shRNA is shown below:
[0022] CACCAAATTGGCAATTGAA (SEQ ID NO. 11).
[0023] In a fourth aspect, the present invention provides a pharmaceutical composition for treating extrahepatic bile duct carcinoma, comprising an active component and a pharmaceutically acceptable carrier, said active component comprising shRNA that inhibits AKR1C1 expression or a recombinant expression vector or transgenic cell line containing said shRNA, said shRNA having the sequence shown in SEQ ID NO. 11.
[0024] A fifth aspect of the present invention provides a product comprising at least one of the second, third, and fourth aspects. The product has at least one function of (1)-(4):
[0025] (1) Diagnosis and / or prevention of extrahepatic bile duct cancer;
[0026] (2) Inhibits the proliferation of extrahepatic bile duct cancer cells;
[0027] (3) Promotes the death of extrahepatic bile duct cancer cells;
[0028] (4) Inhibits the migration of extrahepatic bile duct cancer cells.
[0029] The extrahepatic bile duct cancer cells were QBC939 cells.
[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0031] This invention discloses for the first time the application of AKR1C1 in the diagnosis or prognostic assessment of extrahepatic cholangiocarcinoma. Through the relationship between AKR1C1 and staging, overall survival, disease progression-free survival, and presence or absence of lymph node metastasis, it can be seen that AKR1C1 can be used as a biomarker for the diagnosis, staging, and prognostic assessment of extrahepatic cholangiocarcinoma.
[0032] This invention discloses for the first time the application of inhibiting AKR1C1 in the prevention and treatment of extrahepatic cholangiocarcinoma. By targeting and downregulating the expression of AKR1C1, the proliferation and migration ability of extrahepatic cholangiocarcinoma cells can be inhibited, and tumor cell death can be promoted, ultimately improving or treating extrahepatic cholangiocarcinoma.
[0033] The present invention also provides shRNA targeting AKR1C1 and recombinant expression vectors or transgenic cell lines containing it, which can inhibit the proliferation and migration of extrahepatic cholangiocarcinoma cells and promote tumor cell death by targeting and downregulating AKR1C1 expression, ultimately improving or treating extrahepatic cholangiocarcinoma.
[0034] In terms of detection technology, the detection of AKR1C1 is essentially a quantitative PCR detection based on the gene expression status of blood cells. It features simple operation, high sensitivity, good specificity, and high repeatability, and is increasingly being used in clinical testing. The basic detection method used in this invention is real-time quantitative PCR, which has high sensitivity and accuracy, is widely used in clinical practice, and is a very mature experimental technique.
[0035] In terms of efficacy, the AKR1C1 indicator involved in this invention is specifically highly expressed in tumor tissues of patients with extrahepatic cholangiocarcinoma, and the difference is statistically significant (P<0.05), which can serve as a diagnostic, metastatic, and / or prognostic marker for extrahepatic cholangiocarcinoma. Downregulation of AKR1C1 can inhibit the proliferation and migration of extrahepatic cholangiocarcinoma cells and promote their death. Therefore, its clinical reference value and reliability are high. Attached Figure Description
[0036] Figure 1 The results show that AKR1C1 is specifically highly expressed in extrahepatic cholangiocarcinoma: A represents the expression of AKR1C1-C4 in intrahepatic and extrahepatic cholangiocarcinoma cells; B represents the expression of AKR1C1-C4 in intrahepatic and extrahepatic cholangiocarcinoma tissues; C represents the expression of AKR1C1 and AKR1C2 in digestive system tumor cells; and D represents the expression of AKR1C1 in extrahepatic cholangiocarcinoma tissues and adjacent normal control tissues.
[0037] Figure 2 This study demonstrates AKR1C1 as a diagnostic, metastatic, and / or prognostic marker for extrahepatic cholangiocarcinoma: A represents AKR1C1 expression at different differentiation levels in tumor tissues from 55 patients with extrahepatic cholangiocarcinoma; B represents overall survival in 55 patients with extrahepatic cholangiocarcinoma. Figure 2 C represents the recurrence-free survival of 55 patients with extrahepatic cholangiocarcinoma.
[0038] Figure 3 The results show that downregulating AKR1C1 can inhibit the proliferation and migration of extrahepatic cholangiocarcinoma cells and promote their death: A shows the efficiency of downregulating AKR1C1 after stable transfection of the doxcycline (DOX) regulatory system shRNA AKR1C1 into the extrahepatic cholangiocarcinoma cell line QBC939 with DOX; B and C show the proliferation of QBC939 cells after downregulating AKR1C1; D and E show the death of QBC939 cells after downregulating AKR1C1; and F shows the migration of QBC939 cells after downregulating AKR1C1. Detailed Implementation
[0039] The present invention will now be described in detail with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.
[0040] All reagents and raw materials used in this invention are commercially available or can be prepared according to literature methods. Experimental methods in the following examples, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., *Molecular Cloning: A Laboratory Guide* (New York: Cold Spring Harbor Laboratory Press, 1989), or under conventional conditions, or as recommended by the manufacturer.
[0041] Example 1: AKR1C1 is specifically highly expressed in extrahepatic cholangiocarcinoma.
[0042] To clarify the expression and specificity of AKR1C1-C4 in intrahepatic cholangiocarcinoma (ICC) and extrahepatic cholangiocarcinoma, the expression of AKR1C1-C4 was detected by real-time quantitative reverse transcription PCR (qRT-PCR) in human intrahepatic cholangiocarcinoma cell line HCCC9810, human extrahepatic cholangiocarcinoma cell line QBC939, and tumor tissues from patients with intrahepatic and extrahepatic cholangiocarcinoma. HCCC9810, QBC939, and the hepatocellular carcinoma cell line were kindly provided by Shanghai Eastern Hepatobiliary Surgery Hospital. Human esophageal carcinoma cell line TE-1, pancreatic carcinoma cell line PANC1, gastric carcinoma cell line MGC823, and colon carcinoma cell line HCT8 were purchased from the Cell Bank of Shanghai Institute of Biological Sciences, Chinese Academy of Sciences. Tumor specimens from patients with intrahepatic and extrahepatic cholangiocarcinoma were confirmed by pathologists to be the corresponding cancers. The reverse transcription system and conditions are shown in Table 1 below (Takara reverse transcription kit):
[0043] Table 1 Reverse Transcription System
[0044]
[0045] *The reverse transcription volume can be increased as needed, but the amount of RNA in each 10 μl system should not exceed 500 ng, and should be increased proportionally.
[0046] The reverse transcription reaction conditions were: 37℃, 15 min; 85℃, 5 s; 4℃, ∞.
[0047] The RT-PCR system and conditions are shown in Table 2 below (Takara RT-PCR kit):
[0048] Table 2 RT-PCR system
[0049]
[0050] The amplification conditions were: 94℃ for 30 seconds; 55–60℃ for 30 seconds; and 72℃ for 1 minute. These three steps were repeated for a total of 40 cycles.
[0051] The primer sequences used in the PCR reaction are shown in Table 3:
[0052] Table 3 qRT-PCR primer sequences
[0053]
[0054] The results showed that AKR1C1 and AKR1C2 were highly expressed in ECC cells compared to ICC cells, while AKR1C3 and AKR1C4 showed no difference in expression between intrahepatic and extrahepatic cholangiocarcinoma cells. Figure 1 A); Tumor tissue analysis results from patients with intrahepatic and extrahepatic cholangiocarcinoma were consistent with those from cellular studies. We also found that AKR1C1 expression was higher in most ECC patients than in ICC patients, but AKR1C2 expression levels were consistent in most ICC and ECC patients, with only a few ECC patients showing significantly higher AKR1C2 expression than ICC patients. Figure 1 B) This indicates that AKR1C1 is very likely to be specifically highly expressed in ECC.
[0055] Subsequently, to further clarify the specificity of AKR1C1, we used qRT-PCR to detect the expression of AKR1C1 and AKR1C2 in digestive system tumor cells. The results showed that AKR1C1 was most highly expressed in ECC, while AKR1C2 was highly expressed in most tumors, with no significant difference. Figure 1 C). Therefore, we speculate that AKR1C1 is specifically highly expressed in ECC.
[0056] Finally, we used immunohistochemistry to detect the expression of AKR1C1 in ECC tissues and adjacent normal control tissues. The results showed that AKR1C1 was highly expressed in ECC tissues, but almost not expressed in adjacent normal control tissues (see Figure D). The immunohistochemical methods and conditions are as follows (immunohistochemistry and DAB chromogenic kit from Fuzhou Maixin Biotechnology Development Co., Ltd.):
[0057] Dewaxing and hydration of paraffin-coated tissue slides: Slides were baked at 56°C for 2 hours, then dewaxed three times in xylene for 10 minutes each time; subsequently, they were placed in a tissue chemistry cassette containing anhydrous ethanol, 95% ethanol, and 75% ethanol, each concentration of ethanol added twice for 10 minutes each time; finally, they were rinsed with running water for 5 minutes. Microwave-based tissue antigen retrieval: 1×citric acid tissue antigen retrieval solution was heated to boiling, and tissue slides were added while boiling. Microwave heating continued for 4 minutes, followed by cooling to room temperature.
[0058] Remove the tissue slides, remove the surface repair solution, add 2 drops of peroxidase blocking solution to each slide, and incubate at room temperature for 10 minutes to block the activity of endogenous peroxidase. Remove the surface blocking solution and rinse 3 times with PBS. Add 2 drops of normal non-immunized animal serum to each slide and incubate at room temperature for 10 minutes. Remove the serum from the surface of the tissue slides, add 2 drops of AKR1C1 antibody diluted 1:50 to each slide, and incubate overnight at 4°C. The next day, remove the tissue slides and rinse 3 times with PBS. Add 2 drops of biotin-labeled secondary antibody to each slide, incubate at room temperature for 10 minutes, rinse 3 times with PBS, add 2 drops of streptomycin-peroxidase solution to each slide, incubate at room temperature for 10 minutes, rinse 3 times with PBS, add 3 drops of freshly prepared DAB solution to each slide (take 300 μl of PBS, add one drop of each reagent from the DAB chromogenic kit to the PBS), stain for 5-10 minutes, and observe the staining under a microscope. Rinse several times with tap water, add 2 drops of hematoxylin to each tissue slide, counterstain for 3 minutes, rinse with PBS to regain blue color. Then dehydrate and dry with a gradient of ethanol (anhydrous ethanol, 95% ethanol, 75% ethanol), 5 minutes for each concentration, clear with xylene, and mount with neutral resin.
[0059] The above results indicate that AKR1C1 is specifically highly expressed in extrahepatic cholangiocarcinoma, while the expression of AKR1C2-C4 in ECC is not specific, suggesting that AKR1C1 is very likely to become a diagnostic and therapeutic target for extrahepatic cholangiocarcinoma.
[0060] Example 2: AKR1C1 as a diagnostic, metastatic, and / or prognostic biomarker for extrahepatic cholangiocarcinoma
[0061] To clarify the role of AKR1C1 in the progression of extrahepatic cholangiocarcinoma (ECC), we collected tumor tissue and adjacent normal control tissues from 55 newly diagnosed ECC patients who had not received radiotherapy, chemotherapy, or immunotherapy prior to surgery. All tumor specimens from these patients were confirmed as ECC by pathologists. Tumors were staged (stages I-IV) according to the 2010 Joint Committee on Cancer (JCC) tumor-lymph node-metastasis (TNM) staging system. Tumor differentiation was defined according to the World Health Organization criteria (well-differentiated, moderately differentiated, and poorly differentiated). All patients were followed up.
[0062] Immunohistochemistry was used to detect the expression of AKR1C1 in patient tumors and adjacent normal control tissues, and the correlation between its expression and the patient's clinicopathological parameters was analyzed. Results showed that AKR1C1 was almost not expressed in normal bile duct epithelium, but its expression gradually increased with decreasing ECC differentiation. Figure 2A) suggests that AKR1C1 is closely related to the malignancy of ECC. Further correlation analysis of pathological parameters between AKR1C1 and ECC (see Table 4) showed that AKR1C1 expression was closely related to the size of the primary tumor and lymph node metastasis; patients with high AKR1C1 expression had larger primary tumors and were more prone to lymph node metastasis. Furthermore, Kaplan-Meier survival analysis showed that patients with high AKR1C1 expression had shorter recurrence-free survival and overall survival compared to patients with low AKR1C1 expression (see Table 4). Figure 2 B). The above results indicate that AKR1C1 can serve as a diagnostic, metastatic, and / or prognostic biomarker for extrahepatic cholangiocarcinoma.
[0063] Table 4. Relevant clinical data of 55 patients with extrahepatic bile duct carcinoma
[0064]
[0065]
[0066] *P<0.05, **P<0.01
[0067] Example 3: Downregulation of AKR1C1 can inhibit the proliferation and migration of extrahepatic cholangiocarcinoma cells and promote their death.
[0068] To further clarify the function and mechanism of AKR1C1 in the progression of extrahepatic cholangiocarcinoma, we first constructed a DOX-induced shRNA-AKR1C1 plasmid and coated it with lentivirus. The target sequence of shRNA-AKR1C1 is: CACCAAAUUGGCAAUUGAA (SEQ ID NO.11).
[0069] ECC cells QBC939 were infected with lentivirus at an MOI of 50. 72 hours post-infection, 4 μg / ml puromycin was added to both the uninfected and virus-infected groups to kill all uninfected cells. Then, 5 μg / ml DOX was added to the virus-infected cells to induce shRNA-AKR1C1 expression. Cells were collected 48 hours later, and the efficiency of AKR1C1 downregulation was detected by RT-PCR and Western blot. Figure 3 A) The results showed that the downregulation efficiency of AKR1C1 was approximately 55%-70%, indicating that a stable DOX-induced shRNA-AKR1C1 transgenic strain was successfully constructed.
[0070] Subsequently, we used the CCK8 and colony formation methods to detect the effect of AKR1C1 on the proliferation of ECC cells QBC939.
[0071] The CCK8 testing method is as follows:
[0072] Logarithmically growing QBC939 cells were digested, centrifuged, and resuspended. 5000 cells were added to each well of a 96-well plate, along with 100 μL of complete culture medium. The cells were incubated overnight at 37°C with 5% CO2. 5 μg / ml of DOX was added to induce shRNA-AKR1C1 expression. After 24 hours, 10 μL of CCK-8 solution was added to the detection wells every 12 hours, and cell proliferation was detected at 450 nm.
[0073] CCK8 assay results showed that the proliferation rate of QBC939 cells was significantly slowed down after downregulation of AKR1C1. Figure 3 B) indicates that high expression of AKR1C1 can promote the proliferation of QBC939 cells.
[0074] The methods for cloning are as follows:
[0075] Logarithmically growing QBC939 stable transgenic cells were digested, centrifuged, and resuspended. The cell suspension was serially diluted, and each group of cells was seeded into 6-well plates at gradient densities of 50, 100, and 200 cells per well. Cells were cultured overnight at 37°C with 5% CO2. shRNA-AKR1C1 expression was induced by adding 5 μg / ml DOX, and the cells were cultured for 2–3 weeks. Culture was stopped when visible clones appeared in the wells. The supernatant was discarded, and the cells were carefully washed twice with PBS. Cells were fixed in each well with 1 ml of 4% paraformaldehyde for 10 minutes. The fixative was then removed, and the cells were carefully washed twice with PBS. Crystal violet staining was added for 10 minutes, and finally, the cells were gently rinsed with running water to remove the staining solution. The cells were air-dried and photographed.
[0076] The results of the clonogenic assay showed that, compared with the control group, downregulation of AKR1C1 significantly inhibited the proliferation of QBC939 cells. Figure 3 C) also shows that high expression of AKR1C1 can promote the proliferation of QBC939 cells.
[0077] We continued to use PI staining and flow cytometry to investigate the effect of AKR1C1 on the death of QBC939 ECC cells. The steps for PI staining to detect QBC939 cell death are as follows:
[0078] QBC939 cells were digested, centrifuged, and resuspended, then seeded into 6-well plates. 5 μg / ml of DOX was added to induce shRNA-AKR1C1 expression. After 48 hours, the culture medium in each experimental group was discarded, and the cells were washed once with PBS. An appropriate amount of PBS was added, and 1 μl of PI dye was added to each experimental group. The plates were incubated in the dark for 5-10 minutes. After incubation, the cells were photographed using a fluorescence microscope to observe the number of red spots.
[0079] PI staining results showed that QBC939 cells in the AKR1C1 downregulated group had more red spots, indicating that downregulation of AKR1C1 can promote the death of QBC939 cells. Figure 3 D).
[0080] The flow cytometry detection method is as follows:
[0081] Log-phase QBC939 cells were digested, centrifuged, resuspended, and seeded into 12-well plates. 5 μg / ml DOX was added to induce shRNA-AKR1C1 expression. After 48 hours, cells were collected by trypsin digestion without EDTA. Cells were resuspended once in pre-chilled 1×PBS (4℃), centrifuged at 1200 rpm for 5 minutes, and washed. Cells were resuspended in 100 μl PBS, and 1 μl SYTOX GREEN DEAD CELL STAIN was added to each cell tube. Cells were incubated at room temperature for 20 minutes. Afterward, 1 ml PBS was added for washing, centrifuged at 1000 rpm for 5 minutes, and resuspended in an appropriate amount of PBS for analysis.
[0082] Flow cytometry results showed that, compared with the control group, the group with downregulated AKR1C1 experienced greater cell death, further indicating that downregulating AKR1C1 can promote the death of QBC939 cells. Figure 3 E).
[0083] To clarify the effect of AKR1C1 on ECC cell migration, we used Transwell assay for migration detection, as follows:
[0084] AKR1C1 levels in QBC939 cells were downregulated using the aforementioned method. Control and downregulated cells were then resuspended in serum-free medium and seeded into Transwell chambers, 5000 cells per well. In the lower chamber of a 24-well plate, 600 μl of medium containing 5% serum was added, and the cells were cultured for 24 hours. The chambers were removed, the medium was discarded, and the cells were washed twice with PBS. Cells were then fixed with 4% formaldehyde for 10 minutes, the formaldehyde was removed, and the cells were washed twice with PBS. The cells were then placed in new 24-well plates, and crystal violet staining solution was added to both the upper and lower chambers. The plates were incubated at room temperature for 15 minutes. The crystal violet was then removed, the cells were washed twice with PBS, and the cells on the upper chamber surface were gently wiped away with a cotton swab. After air-drying at room temperature, the cells were placed on a slide, and the cell count was observed and photographed under a microscope.
[0085] Transwell results showed that the number of cells that crossed the membrane in the AKR1C1 downregulated group was significantly less than that in the control group. Figure 3 F) This suggests that downregulating AKR1C1 can inhibit the migration of extrahepatic bile duct cancer cells.
[0086] The above results indicate that AKR1C1 is specifically highly expressed in extrahepatic cholangiocarcinoma (ECC), and its high expression is closely associated with the high malignancy of ECC patients. Patients with high AKR1C1 expression have larger primary tumors and are more prone to lymph node metastasis. Furthermore, compared with patients with low AKR1C1 expression, patients with high AKR1C1 expression have shorter recurrence-free survival and overall survival. Downregulation of AKR1C1 can inhibit the proliferation and migration of extrahepatic cholangiocarcinoma cells and promote their death. These results suggest a close correlation between AKR1C1 and the occurrence and development of ECC tumors, thus it can serve as a biomarker for tumor diagnosis, treatment selection, and prognostic assessment.
[0087] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.
Claims
1. Application of reagents for detecting AKR1C1 expression levels in the preparation of kits for the diagnosis, staging, grading, and prognostic assessment of extrahepatic cholangiocarcinoma.
2. The application according to claim 1, characterized in that, The reagent for detecting AKR1C1 expression is a reagent for detecting AKR1C1 expression in biological samples at the gene level and / or protein level; the kit contains reagents for detecting AKR1C1 expression in biological samples.
3. The application according to claim 2, characterized in that, The reagents used to detect the expression level of AKR1C1 in biological samples are selected from one or more of the following detection techniques or methods: immunohistochemistry, Western blot, and qRT-PCR.
4. The application according to claim 3, characterized in that, The reagent for detecting AKR1C1 expression in biological samples contains PCR primers that are specific to the AKR1C1 gene, or antibodies that specifically bind to the AKR1C1 protein.
5. The application according to claim 4, characterized in that, The PCR primers with detection specificity for the AKR1C1 gene are shown in SEQ ID NO.1-2.
6. A reagent kit for the diagnosis, staging, grading, or prognostic assessment of extrahepatic cholangiocarcinoma, characterized in that, This kit contains reagents for detecting the AKR1C1 content in biological samples.
7. The reagent kit according to claim 6, characterized in that, The kit consists of a reverse transcription system, a primer system, and an amplification system, or a tumor tissue paraffin section preparation reagent system, an antigen retrieval reagent system, and an antibody system. The primer system includes PCR primers as shown in SEQ ID NO.1-2 and SEQ ID NO.9-10.
8. The application of a substance that inhibits AKR1C1 in the preparation of a drug for treating extrahepatic bile duct carcinoma, characterized in that, The substance that inhibits AKR1C1 is an shRNA that inhibits AKR1C1 expression or a recombinant expression vector or transgenic cell line containing the shRNA, and the target sequence of the shRNA is shown in SEQ ID NO.
11.
9. A pharmaceutical composition for treating extrahepatic bile duct carcinoma, characterized in that, The invention includes an active ingredient and a pharmaceutically acceptable vector, wherein the active ingredient comprises an shRNA that inhibits AKR1C1 expression or a recombinant expression vector or transgenic cell line containing the shRNA, and the target sequence of the shRNA is shown in SEQ ID NO.11.