An InDel molecular marker tightly linked to a major QTL for boll number per plant in upland cotton and its application

Abstract

The present invention provides an InDel molecular marker tightly linked to the main effect QTL of boll number per plant of upland cotton and its application, belonging to the technical field of upland cotton breeding. The InDel molecular marker SCRCIndel161 provided by the present invention is obtained by amplification of the forward primer sequence as shown in SEQ ID NO.1 and the reverse primer sequence as shown in SEQ ID NO.2, and is tightly linked to the main effect QTL of boll number per plant of upland cotton chromosome 17. When the electrophoresis band type of the amplified product is a band type consisting of two bands of 188bp and 126bp, the boll number of the cotton per plant to be tested is high. The present invention can be applied to molecular marker-assisted selection breeding and molecular polymerization breeding of cotton boll number per plant (one of the cotton yield components), improves breeding selection efficiency and polymerization efficiency, and quickly and efficiently cultivates new high-yield cotton varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of upland cotton breeding, and in particular relates to an InDel molecular marker tightly linked to a major QTL for the number of bolls per plant in upland cotton and an application thereof. Background Art

[0002] Cotton is the world's most important natural fiber crop. Increasing cotton fiber yield is crucial for the stable development of the cotton textile industry. Cotton fiber yield is determined by the number of bolls per plant, boll weight, and lint percentage. The number of bolls per plant is most strongly correlated with cotton fiber yield. Identifying superior alleles controlling boll number per plant and developing functional molecular markers can significantly accelerate the selection and breeding of high-quality cotton varieties, providing superior genetic resources and selection tools for molecular breeding of cotton fiber yield traits.

[0003] The number of bolls per plant is a quantitative trait controlled by multiple genes, with a complex genetic basis and significant environmental influences, making genetic research difficult. Quantitative trait locus mapping, based on molecular marker genetic maps and various statistical models, provides an effective means for studying the inheritance of quantitative traits. Marker-assisted selection (MAS) involves analyzing the genotypes of molecular markers closely linked to target genes and selecting for genotypes that are closely linked to target genes. This approach can significantly accelerate breeding efforts and improve breeding efficiency. In recent years, with the rapid development of molecular marker technology, marker-assisted selection (MAS) and polyploid breeding have provided new breeding approaches for improving cotton fiber quality and yield. Significant progress has been made in mapping QTLs for the number of bolls per plant trait in cotton. However, there are currently few reports on the mapping of QTLs for the number of bolls per plant on chromosome 17 of cotton, and the reported QTL locations are often unstable, making them unsuitable for modern rapid marker-assisted selection (MAS) and polyploid breeding. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide an InDel molecular marker tightly linked to the major QTL for boll number per plant on chromosome 17 of upland cotton and its application.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an InDel molecular marker SCRCIndel161 tightly linked to a major QTL for the number of bolls per plant in upland cotton. The InDel molecular marker SCRCIndel161 is obtained by amplifying a forward primer sequence as shown in SEQ ID NO.1 and a reverse primer sequence as shown in SEQ ID NO.2.

[0007] The present invention also provides a primer pair for detecting the above-mentioned InDel molecular marker SCRCIndel161, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The present invention also provides a kit for detecting the boll number per plant of upland cotton, and the kit comprises the above primer pair.

[0009] The present invention also provides the use of the above-mentioned InDel molecular marker SCRCIndel161 or the above-mentioned primer pair or the above-mentioned kit in detecting the boll number per plant trait of upland cotton.

[0010] The present invention also provides the use of the InDel molecular marker SCRCIndel161 or the primer pair or the kit in the breeding of high-yield cotton varieties.

[0011] The present invention also provides the use of the above-mentioned InDel molecular marker SCRCIndel161 or the above-mentioned primer pair or the above-mentioned kit in the positioning of the major effect QTL of the number of bolls per plant in upland cotton.

[0012] The present invention also provides the use of the above-mentioned InDel molecular marker SCRCIndel161 or the above-mentioned primer pair or the above-mentioned kit in upland cotton gene map-based cloning.

[0013] The present invention also provides a method for detecting the boll number trait of upland cotton per plant, which is characterized in that it comprises the following steps: using the DNA of the cotton to be tested as a template, performing PCR amplification with the above-mentioned primer pair to obtain an amplified product; judging the boll number of the cotton to be tested per plant according to the electrophoretic band pattern of the amplified product: when the electrophoretic band pattern is a band pattern consisting of two bands of 188 bp and 126 bp, the genotype of the cotton to be tested is recorded as a, and the boll number of the cotton to be tested is high; when the electrophoretic band pattern is a band pattern consisting of two bands of 133 bp and 111 bp, the genotype of the cotton to be tested is recorded as b, and the boll number of the cotton to be tested is low; when the electrophoretic band pattern is a heterozygous type, the genotype of the cotton to be tested is recorded as h, and the boll number of the cotton to be tested is between the two.

[0014] Preferably, the reaction system for PCR amplification is: 1 μl of 25 ng / μl DNA solution, 1.0 μl of 10×PCR Buffer, 0.2 μl of 10 mM dNTPs, 0.8 μl of 25 mM MgCl2, 0.5 μl of 10 mM forward primer, 0.5 μl of 10 mM reverse primer, 0.2 μl of 2 U / μl Taq DNA polymerase and 5.8 μl of ddH2O.

[0015] Preferably, the reaction procedure of the PCR amplification is pre-denaturation at 95°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 57°C for 45 seconds, extension at 72°C for 45 seconds, 30 cycles; extension at 72°C for 10 minutes, and storage at 4°C.

[0016] Beneficial effects of the present invention:

[0017] The InDel molecular marker SCRCIndel161 provided by the present invention is tightly linked to a major QTL for boll number per plant on chromosome 17 of upland cotton. The InDel molecular marker SCRCIndel161 provided by the present invention is obtained by amplification using the forward primer sequence shown in SEQ ID NO.1 and the reverse primer sequence shown in SEQ ID NO.2. When the electrophoretic band pattern of the amplified product is composed of two bands of 188 bp and 126 bp, the genotype of the tested cotton is recorded as a, indicating a high boll number per plant. When the electrophoretic band pattern of the amplified product is composed of two bands of 133 bp and 111 bp, the genotype of the tested cotton is recorded as b, indicating a low boll number per plant. The boll number per plant of genotype a cotton is significantly higher than that of genotype b cotton (17.33-19.58%). The present invention lays the foundation for the map-based cloning of the major QTL candidate gene for the boll number per plant in cotton, and can be applied to molecular marker-assisted selection breeding and molecular polymerized breeding of the boll number per plant in cotton, thereby improving the selection and polymerized efficiency.

[0018] Compared with the prior art, the present invention has the following technical effects:

[0019] 1) The molecular marker SCRCIndel161, which is tightly linked to the number of bolls per plant in cotton, disclosed in the present invention, fully represents the major QTL for the number of bolls per plant in cotton varieties or lines. PCR amplification of cotton varieties or lines using this molecular marker can quickly determine whether the cotton variety or line has a QTL that enhances the number of bolls per plant, thereby quickly screening cotton varieties or lines with QTLs that enhance the number of bolls per plant for breeding. This can greatly accelerate the breeding process of high-yield cotton varieties and provide excellent genetic resources and selection tools for molecular design breeding of cotton yield traits.

[0020] 2) The molecular marker method provided by the present invention, which is closely linked to the number of bolls per plant of cotton, is used in cotton breeding. By simply detecting the characteristics of the amplified bands of these markers, the presence or absence of synergistic mutations at the major gene loci of the number of bolls per plant can be determined to predict the phenotype of the number of bolls per plant of cotton, which is used to guide the genetic improvement of cotton yield traits. This method is not only fast and accurate in screening, unaffected by the environment, and has a clear selection target, but also saves production costs, greatly improves the selection efficiency of cotton varieties or lines, and directly realizes the identification of target genes in cotton germplasm resources and breeding offspring, laying the foundation for using molecular marker-assisted selection to increase the number of bolls per plant and thus increase cotton yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the linkage map and QTL mapping results of chromosome 17 of the recombinant inbred line (RIL) population. The left rectangle represents the 2019 Linqing (19LQ) environment, and the right rectangle represents the 2021 Linqing (21LQ) environment.

[0022] Figure 2 The electrophoresis test results of the PCR amplification products of the cotton samples were obtained by using the primers of the present invention, wherein P1 and P2 are the genotypes of the parents Lu 37 (a) and Lu 19 (b), RIL01-RIL46 are F 2：6 The genotypes of 46 randomly selected recombinant inbred lines from the population;

[0023] Figure 3 The statistical results of the number of bolls per plant of each recombinant inbred line are shown in Figure 2. DETAILED DESCRIPTION

[0024] The present invention provides an InDel molecular marker SCRCIndel161 that is tightly linked to a major QTL for the number of bolls per plant in upland cotton. The InDel molecular marker SCRCIndel161 is amplified by a forward primer sequence as shown in SEQ ID NO.1 and a reverse primer sequence as shown in SEQ ID NO.2. When the electrophoretic band pattern of the amplified product is a band pattern consisting of two bands of 188 bp and 126 bp, the number of bolls per plant is high. In the present invention, the major QTL related to the number of bolls per plant in upland cotton is located on chromosome 17 (D3) and can explain a phenotypic variation rate of 17.33%-19.58%. The QTL of the present invention has the advantage of good positioning stability and is suitable for modern rapid molecular marker-assisted selection breeding and molecular polymerization breeding. The InDel molecular marker SCRCIndel161 provided by the present invention can be tightly linked to a major QTL for the number of bolls per plant on chromosome 17 of upland cotton.

[0025] The method for obtaining the InDel molecular marker SCRCIndel161 described in the present invention preferably includes the following steps: 1) hybridizing a high-boll-setting upland cotton variety Lumianyan 37 as the female parent and a variety Lumianyan 19 as the male parent to obtain a hybrid F1 generation; 2) self-pollinating the hybrid F1 generation to obtain an F2 generation; 3) selecting individual plants of the F2 generation and continuously self-pollinating by the single-seed method to obtain an F8 recombinant inbred line population (RIL); 4) extracting genomic DNA from individual plants of the parents and each family of the recombinant inbred line; 5) using polymorphic primers and the genomic DNA of each family of the recombinant inbred line extracted in step 4) as a template to perform PCR amplification, construct a linkage map, locate the QTL for the boll number trait, and obtain an InDel molecular marker tightly linked to the major QTL for boll number per plant on chromosome 17.

[0026] In the present invention, the Lumianyan No. 37 is a transgenic insect-resistant cotton variety with excellent comprehensive traits and wide adaptability cultivated by the Shandong Cotton Research Center, and has strong boll-setting ability; the Lumianyan No. 19 has a short growth period and a small number of bolls per plant. In the present invention, the female parent Lumianyan No. 37 is hybridized with the male parent Lumianyan No. 19 to obtain the hybrid F1 generation. The present invention has no other special requirements for the hybridization method, and the conventional hybridization method in this field can be adopted. After obtaining the hybrid F1 generation, the present invention obtains the F2 generation by self-pollination of the F1 generation. The method for self-pollination of the F1 generation described in the present invention can adopt the conventional self-pollination method in this field. In the present invention, the single-seed transmission is the conventional single-seed transmission recombination method in this field. In the specific implementation process of the present invention, one seed is collected from each plant starting from the F2 generation, mixed planting, and self-pollination to the F8 generation to obtain the F8 recombinant inbred line population (RIL).

[0027] After obtaining the F8 recombinant inbred line population (RIL), the present invention uses polymorphic primers to perform PCR amplification using the genomic DNA of each recombinant inbred line family extracted in step 4) as a template. In the present invention, the polymorphic primers preferably include cotton microsatellite primer sequences published in online databases. In the present invention, the network database preferably includes Cotton Marker Database (http: / / www.cottonmarker.org) and Cotton database (http: / / www.cottondb.org). In the present invention, the polymorphic primers also include InDel site marker primers of the two parents, Lu Mian Yan No. 37 and Lu Mian Yan No. 19; the InDel site marker primers are preferably obtained by the following method: A) resequencing the genomic DNA of the two parents, Lu Mian Yan No. 37 and Lu Mian Yan No. 19, respectively, comparing the resequencing data obtained by the resequencing of the two, and analyzing to obtain the InDel site; B) designing primers based on the differences in the InDel site, and screening the designed primers for polymorphism in the two parents. The screened primers with polymorphic markers are InDel site marker primers. The polymorphism screening method in the present invention can adopt the conventional primer polymorphism screening method in the art.

[0028] The present invention utilizes the primers with polymorphic markers to perform PCR amplification, performs genotyping by electrophoresis of the amplified products, and constructs a linkage map. In the present invention, JoinMap 4.0 software is preferably used to construct a linkage map; for specific methods of constructing a linkage map, see the literature Constructing_a_high-density_linkage_map_for_Gossypium_hirsutum×Gossypium_barbadense_and_identifying QTLs for lint percentage [Journal of Integrative Plant Biology; (2015), 57-5: 450–467] or Construction of a high-density genetic map and lint percentage and cottonseed nutrient trait QTL identification in upland cotton (Gossypium hirsutum L.) [Mol Genet Genomics (2015) 290: 1683–1700; DOI 10.1007 / s00438-015-1027-5].

[0029] After obtaining a linkage map, the present invention combines the linkage map with survey results of boll number per plant for each recombinant inbred line to perform QTL mapping for boll number per plant. Based on the results of the QTL mapping for boll number per plant, an InDel molecular marker tightly linked to the major QTL for boll number per plant on chromosome 17 is identified. In the present invention, QTL mapping is preferably performed using Windows QTL Cartographer 2.5 (Voorrips et al. 2002) software.

[0030] The present invention also provides a primer pair for detecting the above-mentioned InDel molecular marker SCRCIndel161, the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.1: CGAGTGAAAAGTAAATTGGG and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.2: ATCAAATACAAACCTCACCG.

[0031] The present invention also provides a kit for detecting the boll number per plant of upland cotton, and the kit comprises the above primer pair.

[0032] The present invention has no particular limitation on other reagents contained in the kit, and any reagent commonly used in PCR amplification in the art may be used, such as dNTPs, Taq DNA polymerase, and 10×Taq buffer containing magnesium ions.

[0033] The present invention also provides the use of the above-mentioned InDel molecular marker SCRCIndel161 or the above-mentioned primer pair or the above-mentioned kit in detecting the number of bolls per plant in upland cotton, breeding high-yield cotton varieties, localizing the major effect QTL of the number of bolls per plant in upland cotton, or cloning the upland cotton gene map.

[0034] The present invention also provides a method for detecting the boll number trait of upland cotton per plant, which is characterized in that it comprises the following steps: using the DNA of the cotton to be tested as a template, performing PCR amplification with the above-mentioned primer pair to obtain an amplified product; judging the boll number of the cotton to be tested per plant according to the electrophoretic band pattern of the amplified product: when the electrophoretic band pattern is a band pattern consisting of two bands of 188 bp and 126 bp, the genotype of the cotton to be tested is recorded as a, and the boll number of the cotton to be tested is high; when the electrophoretic band pattern is a band pattern consisting of two bands of 130 bp and 111 bp, the genotype of the cotton to be tested is recorded as b, and the boll number of the cotton to be tested is low; when the electrophoretic band pattern is a heterozygous type, the genotype of the cotton to be tested is recorded as h, and the boll number of the cotton to be tested is between the two.

[0035] In the present invention, the electrophoresis of the amplified product is preferably performed using 8% non-denaturing polyacrylamide gel electrophoresis. The present invention does not particularly limit the specific operating steps of 8% non-denaturing polyacrylamide gel electrophoresis, and any conventional 8% non-denaturing polyacrylamide gel electrophoresis method in the art can be used. In the present invention, the heterozygous band pattern refers to the presence of at least one band of genotype a and at least one band of genotype b. When the electrophoretic band pattern is heterozygous, the number of bolls per plant is between the two, which means that the number of bolls per plant is between the number of bolls per plant of genotype a and genotype b.

[0036] The present invention does not specifically limit the specific method for obtaining the upland cotton DNA to be tested, and conventional DNA extraction methods in the art can be used. In the present invention, the reaction system for PCR amplification is preferably: 1 μl of 25 ng / μl DNA solution, 1.0 μl of 10×PCRBuffer, 0.2 μl of 10 mM dNTPs, 0.8 μl of 25 mM MgCl2, 0.5 μl of 10 mM forward primer, 0.5 μl of 10 mM reverse primer, 0.2 μl of 2 U / μl TaqDNA polymerase and 5.8 μl of ddH2O. The present invention does not specifically limit the specific sources of the above-mentioned reagents, and conventional commercially available products in the art can be used. In the present invention, the reaction procedure for PCR amplification is preferably pre-denaturation at 95°C for 2 min; denaturation at 94°C for 30 sec, annealing at 57°C for 45 sec, extension at 72°C for 45 sec, 30 cycles; extension at 72°C for 10 min, and storage at 4°C. The present invention has no particular limitation on the PCR amplification instrument, and any PCR instrument known in the art can be used.

[0037] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0038] In the following examples, unless otherwise specified, all methods are conventional.

[0039] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0040] Example 1

[0041] Using Lumianyan No. 37 (mother) with a large number of bolls and Lumianyan No. 19 (father) with a small number of bolls as parents, a recombinant inbred line F8 of 326 families was constructed, among which the recombinant inbred lines were planted in four different ecological environments (Linqing, Shandong in 2019, Luntai, Xinjiang in 2019, Linqing, Shandong in 2020, and Linqing, Shandong in 2021).

[0042] A preliminary analysis of DNA polymorphisms in the two parents, Lunmianyan 37 and Lunmianyan 19, was conducted using 729 pairs of InDel primers. The method for obtaining InDel markers includes the following steps: A) resequencing the genomic DNA of Lunmianyan 37 and Lunmianyan 19 and comparing and analyzing the InDel sites; B) designing primers based on the differences in the InDel sites. These designed primers are then used to screen for polymorphisms in the two parents. The selected primers with polymorphic markers are the InDel site marker primers. All of these primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0043] The PCR reaction system was 10 μl, including 5.8 μl of ultrapure water (ddH2O), 1.0 μl of template DNA, 1.0 μl of 10× Buffer, 0.8 μl of 2.5 mM MgCl2, 0.2 μl of 10 mM dNTPs, 0.5 μl of 10 μM forward primer, 0.5 μl of reverse primer, and 0.2 μl of Taq DNA polymerase. PCR amplification reaction procedure: preheating at 95°C for 5 min, denaturation at 94°C for 45 s, annealing at 52-57°C for 45 s, extension at 72°C for 1 min; cycle 30 times, extension at 72°C for 10 min; store at 4°C until removed, use 8% non-denaturing polyacrylamide (PAGE) gel electrophoresis, and silver staining for color development. The silver staining process is: 0.1% AgNO3 silver staining for 12-15 min, 2% NaOH + 1% formaldehyde color development for 5-10 min, rinse with distilled water 2-3 times, and record the results.

[0044] Preliminary molecular marker screening revealed 177 InDel primer pairs that differed between the parents. These 177 primer pairs were used to analyze the genotypes of 326 recombinant inbred lines (RILs). A linkage map of the RIL population (Lumianyan 37 × Lumianyan 19) was constructed using JoinMap 4.0 software. The map covered a genetic distance of 893.09 cM, representing 20.08% of the cotton genome. The average genetic distance between markers was 11.57 cM, encompassing 23 linkage groups, with an average coverage of 38.83 cM per chromosome.

[0045] QTL detection for boll number per plant in cotton was performed using Windows QTL Cartographer 2.5 (Voorrips et al. 2002). One major QTL associated with boll number per plant was identified. This QTL was located on chromosome 17 (D3) and was tightly linked to SCRC Indel161, explaining 17.33% to 19.58% of the phenotypic variation, as shown in Tables 1 and 2. Figure 1 shown.

[0046] From Table 1 and Figure 1It can be seen that the result of QTL positioning is qNOB-D03-3, which was detected in the 2019 Linqing (19LQ) and 2021 Linqing (21LQ) environments. It is located in the SCRCIndel154 and SCRCIndel162 marker intervals on chromosome 17 and is closely linked to the SCRCIndel161 marker. The synergistic gene comes from the parent Lumianyan No. 37, explaining 17.33%-19.58% of the phenotypic variation rate.

[0047] Table 1 QTLs linked to the boll number per plant detected using RIL populations

[0048]

[0049] Example 2

[0050] Correlation Detection between Molecular Marker Genotypes of Boll Number per Plant and Phenotypes of Boll Number per Plant in Cotton

[0051] 1. Material to be tested

[0052] The upland cotton variety Lumianyan 37 with strong boll-setting ability was crossed with Lumianyan 19 with average boll-setting ability as the male parent. 2：6 46 recombinant inbred lines were randomly selected from the population.

[0053] 2. Genotype detection

[0054] Extract genomic DNA from each material in step 1, determine the concentration, and then dilute to 25 ng / ul. Store at -20°C until needed. PCR amplification was performed using the genomic DNA from each material as a template using the primer pairs listed in Table 2. The 10 μl PCR amplification system used consisted of: 1 μl of genomic DNA solution of the test material, 1.0 μl of 10× PCR Buffer, 0.2 μl of 10 mM dNTPs, 0.8 μl of 25 mM MgCl₂, 0.5 μl of a 10 mM forward primer, 0.5 μl of a 10 mM reverse primer, 0.2 μl of 2 U / μl Taq DNA polymerase, and 5.8 μl of ddH₂O. The concentration of both primers for the molecular marker SCRC Indel161 in the reaction system was 0.5 mM.

[0055] The PCR amplification reaction was carried out under the following conditions: 95°C pre-denaturation for 2 minutes; 94°C denaturation for 30 seconds, 57°C annealing for 45 seconds, 72°C extension for 45 seconds, 30 cycles; 72°C extension for 10 minutes, and storage at 4°C. The obtained amplified products were subjected to electrophoresis on 8% non-denaturing polyacrylamide gel. The electrophoresis results were as follows: Figure 2According to the electrophoresis band pattern, the genotype of each strain was determined, and the results are shown in Table 3. In Table 3, P1 and P2 are the parents Lumianyan 37 and Lumianyan 19; the numbers RIL01-RIL46 correspond to Figure 2 RIL01-RIL46 in.

[0056] Table 2 Primer pair sequences for detecting the InDel molecular marker SCRCIndel161 tightly linked to the major QTL for boll number per plant

[0057]

[0058] Table 3 Statistics of cotton genotypes and boll number per plant

[0059]

[0060]

[0061] 3. Statistics of the number of bolls per plant

[0062] Statistics F 2：6 The number of bolls per plant of different genotypes in the population is as follows: Figure 3 As shown. 2：6 The average number of bolls per plant of genotype a (Lumianyan No. 37) in the population is significantly higher than the number of bolls per plant of genotypes b (Lumianyan No. 19) and h (heterozygous type), indicating that the molecular marker SCRCIndel161 of the present invention is a molecular marker related to the number of bolls per plant in cotton. In practical applications, the boll-setting ability of the test plant can be determined by detecting the genotype of the test plant: genotype a is a cotton variety with strong boll-setting ability, and genotype b is a cotton variety with average boll-setting ability.

[0063] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for detecting the boll number per plant of upland cotton, characterized in that: The method comprises the following steps: using the DNA of the cotton to be tested as a template and performing PCR amplification with a primer pair to obtain an amplified product; judging the boll number of the cotton to be tested according to the electrophoretic band pattern of the amplified product: when the electrophoretic band pattern is composed of two bands of 188 bp and 126 bp, the genotype of the cotton to be tested is recorded as a, and the boll number of the cotton to be tested is high; when the electrophoretic band pattern is composed of two bands of 130 bp and 111 bp, the genotype of the cotton to be tested is recorded as b, and the boll number of the cotton to be tested is low; the primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO. 1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

2.

2. The method according to claim 1, characterized in that The PCR amplification reaction system is as follows: 1 μl of 25 ng / μl DNA solution, 1.0 μl of 10× PCR Buffer, 0.2 μl of 10 mM dNTPs, 0.8 μl of 25 mM MgCl2, 0.5 μl of 10 mM forward primer, 0.5 μl of 10 mM reverse primer, 0.2 μl of 2 U / μl Taq DNA polymerase and 5.8 μl of ddH2O.

3. The method according to claim 1, characterized in that The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95° C. for 2 min; denaturation at 94° C. for 30 sec, annealing at 57° C. for 45 sec, extension at 72° C. for 45 sec, 30 cycles; extension at 72° C. for 10 min, and storage at 4° C.

Images