A MALDI-TOF mass spectrometry sample preparation method

By using hydrophilic organic solvents and vacuum drying technology in MALDI-TOF mass spectrometry sample preparation, the problem of uneven crystal distribution in samples was solved, the repeatability and reliability of detection were improved, and the development of automated detection was promoted.

CN116086911BActive Publication Date: 2026-04-03XIAMEN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-09
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

In existing MALDI-TOF mass spectrometry sample preparation methods, the crystal distribution of the sample on the target plate is uneven, resulting in poor repeatability and reliability of the detection results, which has a significant impact, especially in the detection of biomacromolecules.

Method used

A hydrophilic organic solvent is mixed with the matrix solution and the test solution, and the target plate is surface activated and dried in a vacuum environment. The solvent evaporation rate and vacuum level are controlled to form a uniform grain layer.

Benefits of technology

It improves the crystallization uniformity of the sample on the target plate, enhances the repeatability and reliability of mass spectrometry detection, reduces the time spent finding suitable detection sites, and promotes the development of automated detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116086911B_ABST
    Figure CN116086911B_ABST
Patent Text Reader

Abstract

This invention discloses a MALDI-TOF mass spectrometry sample preparation method, comprising: preparing a matrix / sample mixture solution using a hydrophilic organic solute; treating the surface of the target plate to facilitate adhesion of the matrix / sample mixture solution to its surface; and using a vacuum drying method to control the crystallization process of the sample, thereby achieving uniform coverage of the matrix / sample crystals within the spotting area and improving the repeatability of sample detection during MALDI-TOF detection. The method provided by this invention can improve the uniformity of the detected substances on the substrate during spectroscopic detection, thereby improving the repeatability and reliability of the spectra, and has broad potential applications in biological detection, chemical characterization, and other fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of spectroscopic detection. More specifically, it relates to a sample preparation method and a surface treatment method that can improve the reliability and repeatability of mass spectrometry in biological detection. Background Technology

[0002] In spectroscopic testing, the surface condition of the sample often has a significant impact on the test results. Taking mass spectrometry as an example, the uniformity of the distribution of the analyte components on the sample surface, the coverage, and the smoothness of the surface can all affect the test results to varying degrees, especially in the testing of organic compounds.

[0003] In the field of biological detection, the crystallization distribution of biomolecules has a significant impact on test results. Taking nucleic acid detection by MALDI-TOF mass spectrometry as an example, the current conventional sample preparation method is the dry-drop method, which involves mixing the matrix and nucleic acid sample, spotting the sample onto the MALDI target plate using a pipette, and allowing it to air dry. Samples prepared using this method exhibit a significant coffee ring effect, where crystals concentrate at the edge of the spotting area, resulting in coarse crystals at the edge and no crystals inside the spotting area. This leads to low sample coverage within the detection area, and inconsistent analyte concentrations in different areas, resulting in inconsistent intensity. This necessitates spending considerable time and effort to find suitable spots for spectral acquisition, which contradicts the original intention of rapid detection through mass spectrometry and hinders the development of automated detection.

[0004] Building upon this foundation, many researchers have employed hydrophilic-hydrophobic polymer combinations as carriers, allowing samples to selectively adsorb onto hydrophilic regions or aggregate in hydrophobic regions, thereby enhancing sample enrichment. Alternatively, they have used inorganic nanoparticles to replace conventional matrices, eliminating the need for matrix precipitation and crystallization. These methods are effective in improving the uniformity of matrix / sample crystallization, but they are costly. Summary of the Invention

[0005] The main objective of this invention is to provide a MALDI-TOF mass spectrometry sample preparation method, the steps of which include:

[0006] (1) Mix the hydrophilic organic solvent with the matrix solution and the analyte solution;

[0007] (2) Perform surface activation treatment on the target plate;

[0008] (3) Apply the mixture solution obtained in step (1) to a target;

[0009] (4) Vacuum drying of the target plate to evaporate the solvent in the mixture solution and thus crystallize.

[0010] In this invention, the addition of the hydrophilic organic solvent reduces the water contact angle between the matrix solution and the analyte solution by more than 10 degrees, for example, by 10-20 degrees. More preferably, it reduces the angle by more than 12 degrees. More preferably, the hydrophilic organic solvent in step (1) includes DMSO (dimethyl sulfoxide), ethanol, acetone, N-methylpyrrolidone, organic solvents containing sulfonate groups, or mixtures thereof.

[0011] Preferably, the ratio of the solvent to the matrix solution and the analyte solution in step (1) is v:v:v = (1-3):(1-3):(1-3). For example, 1:3:3, 1:2:2, 1:1:1, 2:1:1 or 3:1:1.

[0012] In this embodiment of the invention, the target plate used can be a stainless steel target plate or a gold nanoparticle-silicon-based micro / nano array structure target plate. The diameter of the target plate spotting area is 100 nm-10 μm, and the drop volume is 0.1 μL-10 μL.

[0013] In this embodiment of the invention, the target plate surface activation treatment method in step (2) is one or more of oxygen plasma treatment, nitrogen plasma treatment, and coating with a hydrophilic coating.

[0014] In this embodiment of the invention, the vacuum environment has a vacuum level of -0.01MPa to -0.1MPa, and the vacuum drying time is 1min to 30min.

[0015] In embodiments of the present invention, the matrix includes, but is not limited to, commonly used matrices for MALDI-TOF mass spectrometry, such as 3-hydroxy-2-pyridinecarboxylic acid (3-HPA), α-cyano-4-hydroxycinnamic acid (CHCA), 2,5-dihydroxybenzoic acid (DHB), pyridinecarboxylic acid, 3-aminopyridinecarboxylic acid, 3-pyridinecarboxylic acid, anthranilic acid, nicotinic acid, etc.

[0016] The mass spectrometry detection of this invention is applicable to samples including, but not limited to, at least one of various organic and inorganic small molecules, polymers, viruses, microorganisms, nucleotides, nucleosides, oligonucleotides, nucleic acids, amino acids, peptides, proteins, lipids, sugars, carbohydrates, antigens, antibodies, cells, and cell metabolites, but not limited to these. Oligonucleotides, nucleic acids, polypeptides, or bacterial colonies are preferred.

[0017] Step (4) specifically includes:

[0018] S1 Place the target plate in a vacuum environment until a grain layer is formed at the interface between the target plate and the mixture;

[0019] S2 removes the target plate into the atmospheric environment, allowing the remaining solution to air dry naturally until the solvent has completely evaporated.

[0020] Another object of the present invention is to provide a mixture solution, wherein the mixture solution is a hydrophilic organic solvent, a matrix solution and a test solution are mixed in a ratio of v:v:v = (1-3): (1-3): (1-3), for example 1:3:3, 1:2:2, 1:1:1, 2:1:1 or 3:1:1.

[0021] The present invention also provides the application of the mixture solution in mass spectrometry detection, wherein the mixture solution is a mixture of a hydrophilic organic solvent, a matrix solution and an analyte solution in a ratio of v:v:v = (1-3): (1-3): (1-3).

[0022] This invention reduces the contact angle between the mixed solution and the target plate surface by adding a hydrophilic solvent, thereby reducing the formation energy during crystallization. Furthermore, the use of a vacuum environment allows the mixed solution to rapidly form crystal nuclei at the contact surface. By controlling the vacuum level and vacuum drying time, rapid crystallization is prevented, resulting in fine, stacked crystals and improved crystallization uniformity, thus enhancing the reproducibility of the mass spectrum. Therefore, this invention effectively improves the crystallization uniformity of the matrix / analyte sample within the target plate spotting area, thereby improving the reproducibility of the mass spectrum within that area. Attached Figure Description

[0023] The accompanying drawings provide a further understanding of the invention and form part of the specification. They are used together with the embodiments and comparative examples to explain the invention, but do not constitute a limitation thereof. Furthermore, the figures are descriptive outlines and are not drawn to scale.

[0024] Figure 1(A) is a photograph of the apparent contact angle of the mixed solution of Comparative Example 1 of the present invention, and Figure 1(B) is a photograph of the apparent contact angle of the mixed solution of Example 1 of the present invention.

[0025] Figure 2(A) is a photograph of the apparent contact angle of the mixed solution of Comparative Example 2 of the present invention, and Figure 2(B) is a photograph of the apparent contact angle of the mixed solution of Example 2 of the present invention.

[0026] Figure 3(A) is a SEM electron microscope image of the overall crystallization of the matrix / nucleic acid sample in Example 1 of the present invention, and Figure 3(B) is an enlarged view of Figure 3(A).

[0027] Figure 4(A) is a SEM image of the overall crystallization of the matrix / nucleic acid sample in Example 2 of the present invention, and Figure 4(B) is an enlarged view of Figure 4(A).

[0028] Figure 5 This is an SEM image of the crystallization of the matrix / nucleic acid sample in Comparative Example 1 of this invention.

[0029] Figure 6This is an SEM image of the crystallization of the matrix / nucleic acid sample in Comparative Example 2 of this invention.

[0030] Figure 7 This is a schematic diagram of the sampling position during MALDI-TOF MS detection in the embodiments and comparative examples of the present invention.

[0031] Figure 8 This is the mass spectrum measured in Example 1 of the present invention.

[0032] Figure 9 This is the mass spectrum measured in Example 2 of the present invention.

[0033] Figure 10 This is the mass spectrum measured in Comparative Example 1 of this invention.

[0034] Figure 11 This is the mass spectrum measured in Comparative Example 2 of this invention.

[0035] Component labeling explanation:

[0036] S1~S5: Steps. Detailed Implementation

[0037] The technical solutions of the present invention will now be described with reference to the accompanying drawings of the embodiments. Obviously, the described embodiments are only some, not all, of the embodiments described in this application. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0038] Example 1:

[0039] S1 target plate processing

[0040] A standard stainless steel MALDI-TOF target plate with a spotting area diameter of 2.6 mm was used. The target plate was placed in acetone solution and ultrasonically cleaned for 5 min; then placed in ethanol solution and ultrasonically cleaned for 5 min; finally, the target plate was placed in deionized water and ultrasonically cleaned for 5 min, and then dried with N2. The cleaned stainless steel target plate was then activated with O2 Plasma for 3 min.

[0041] S2 mixture preparation

[0042] The oligonucleotide sample P1 used had the sequence: GATCATCAGTACTAGTCT, a relative molecular weight of 5473.6, and a concentration of 100 μM.

[0043] The oligonucleotide sample P2 used had the following sequence: GATCATCAGCTCGACTAGTAGC, with a relative molecular weight of 6719.4 and a concentration of 100 μM.

[0044] The oligonucleotide sample P3 sequence used was: TCAGACGTCAGATCGA, with a relative molecular weight of 4890.3 and a concentration of 100 μM;

[0045] The matrix used was a saturated solution of 3-HPA.

[0046] Take 10 μl each of P1, P2, and P3 oligonucleotide solutions, 30 μl of matrix solution, and 30 μl of N-methylpyrrolidone (NMP) into the same centrifuge tube, and mix thoroughly on a vortex mixer to obtain a matrix / nucleic acid / N-methylpyrrolidone (NMP) mixture;

[0047] S3 dot pattern

[0048] Use a pipette to take 0.5 μl of the mixture and drop it into the sample spotting area of ​​the stainless steel target plate.

[0049] S4 Vacuum Drying

[0050] Place the target plate with the mixed liquid in a vacuum oven, use a mechanical pump to evacuate to a relative vacuum of -0.1 MPa, and start timing at this point. After vacuum drying for 2.5 minutes, remove the target plate.

[0051] S5 air dry

[0052] Place the target plate under atmospheric pressure and allow it to air dry naturally until the remaining solvent has completely evaporated.

[0053] In this embodiment, a uniformly covered area was formed within the sample spotting region of the stainless steel MALDI-TOF target plate, and the crystallization situation is shown in Figure 3.

[0054] Example 2:

[0055] S1 target plate processing

[0056] A silicon-based micro / nano array target plate with a spotting area diameter of 2.6 mm was used. The target plate was placed in acetone solution and ultrasonically cleaned for 5 min; then placed in ethanol solution and ultrasonically cleaned for 5 min; finally, the target plate was placed in deionized water and ultrasonically cleaned for 5 min, then removed and dried with N2. The cleaned silicon-based micro / nano array target plate was then activated using O2 Plasma for 3 min.

[0057] Steps S2, S3, S4, and S5 are the same as in Example 1.

[0058] In this embodiment, a matrix / nucleic acid crystal with a uniform coverage and a grain diameter of 1 μm to 2 μm was formed inside the sample spotting area of ​​the silicon-based micro / nano array structure target plate, as shown in Figure 4.

[0059] Comparative Example 1:

[0060] Step S1 is the same as in Example 1.

[0061] S2 mixture preparation

[0062] The oligonucleotide sample P1 used had the sequence: GATCATCAGTACTAGTCT, a relative molecular weight of 5473.6, and a concentration of 100 μM.

[0063] The oligonucleotide sample P2 used had the following sequence: GATCATCAGCTCGACTAGTAGC, with a relative molecular weight of 6719.4 and a concentration of 100 μM.

[0064] The oligonucleotide sample P3 sequence used was: TCAGACGTCAGATCGA, with a relative molecular weight of 4890.3 and a concentration of 100 μM;

[0065] The matrix used was a saturated solution of 3-HPA.

[0066] Take 10 μl each of P1, P2 and P3 oligonucleotide solutions, 30 μl of matrix solution and 30 μl of acetonitrile / water solution and place them in the same centrifuge tube. Mix them thoroughly on a vortex mixer to obtain matrix / nucleic acid mixture.

[0067] Step S3 is the same as in Example 1.

[0068] S4 Vacuum Drying

[0069] Place the target plate with the droplets of the mixture in a vacuum oven, use a mechanical pump to evacuate to a relative vacuum of -0.1 MPa, and vacuum dry for 10 minutes until complete crystallization.

[0070] The matrix / nucleic acid crystallization in this comparative example is as follows: Figure 5 As shown.

[0071] Comparative Example 2:

[0072] Step S1 is the same as in Example 2.

[0073] Steps S2, S3, and S4 are the same as in Comparative Example 1.

[0074] The matrix / nucleic acid crystallization in this comparative example is as follows: Figure 6 As shown.

[0075] Test and analysis samples

[0076] Examples 1, 2, Comparative Example 1, and Comparative Example 2 were analyzed using MALDI-TOF MS. Nine points were taken from the same location in each sampling area for analysis. The sampling locations are as follows: Figure 7 As shown. The mass spectrum obtained in Example 1 of the present invention is as follows. Figure 8 As shown, the mass spectrum obtained in Example 2 is as follows. Figure 9 As shown, the mass spectrum obtained in Comparative Example 1 is as follows: Figure 10 As shown, the mass spectrum obtained in Comparative Example 2 is as follows: Figure 11 As shown.

[0077] From Figure 3 and Figure 5 and Figure 4 Figure 6 The comparison shows that the matrix / nucleic acid crystals prepared by the method described in this invention are uniformly distributed within the spotting area, and the crystal thickness in each area is similar, with no coffee ring effect.

[0078] from Figure 8 and Figure 10 and Figure 9 and Figure 11 The comparison shows that the samples prepared using the method described in this invention exhibit smaller peak intensity deviations in mass spectra at various locations. This demonstrates that the sample preparation method of this invention achieves better mass spectrum repeatability, saves time required to find suitable detection sites, and significantly improves the detection efficiency of mass spectrometry in nucleic acid detection, which is of great significance for the automation of mass spectrometry-based nucleic acid detection. Furthermore, this invention also has potential applications in fields such as organic acid crystallization and biomacromolecule crystallization.

[0079] The above embodiments are used to illustrate the principles and effects of the present invention, and are not intended to limit the present invention. Any person skilled in the art can make modifications to the above embodiments without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be as set forth in the claims.

Claims

1. A method for preparing samples for MALDI-TOF mass spectrometry, characterized in that, Includes the following steps: (1) Mix the hydrophilic organic solvent with the matrix solution and the test solution; the hydrophilic organic solvent is an organic solvent that, after being added, reduces the water contact angle of the mixed matrix solution and the test solution by more than 10 degrees. The analyte includes at least one of the following: small organic molecules, inorganic or macromolecular compounds, viruses, microorganisms, nucleotides, nucleosides, oligonucleotides, nucleic acids, amino acids, peptides, proteins, lipids, sugars, carbohydrates, antigens, antibodies, cells, and cell metabolites. The hydrophilic organic solvents include DMSO, ethanol, acetone, N-methylpyrrolidone, organic solvents containing sulfonate groups, or mixtures thereof; (2) Perform surface activation treatment on the target plate; (3) Apply the mixture solution obtained in step (1) to a target; (4) The target plate is vacuum dried to allow the solvent in the mixture solution to evaporate and crystallize. The relative vacuum degree of vacuum drying is -0.01 MPa to -0.1 MPa, and the vacuum drying time is 1 min to 30 min.

2. The method according to claim 1, characterized in that, The matrix in step (1) is at least one of 3-hydroxy-2-pyridinecarboxylic acid, 2,5-dihydroxybenzoic acid, α-cyano-4-hydroxycinnamic acid, pyridinecarboxylic acid, 3-aminopyridinecarboxylic acid, 3-pyridinecarboxylic acid, anthranilic acid, or nicotinic acid.

3. The method according to claim 1, characterized in that, In step (1), the ratio of solvent: matrix solution: analyte solution is v:v:v = (1-3): (1-3): (1-3).

4. The method according to claim 1, characterized in that, The target plate surface activation treatment method in step (2) includes one or more of oxygen plasma treatment, nitrogen plasma treatment, and coating with a hydrophilic coating.

5. A MALDI-TOF mass spectrometry detection method, comprising the following steps: (1) Mix the hydrophilic organic solvent with the matrix solution and the test solution; the hydrophilic organic solvent is an organic solvent that, after being added, reduces the water contact angle of the mixed matrix solution and the test solution by more than 10 degrees. The analyte includes at least one of the following: small organic molecules, inorganic or macromolecular compounds, viruses, microorganisms, nucleotides, nucleosides, oligonucleotides, nucleic acids, amino acids, peptides, proteins, lipids, sugars, carbohydrates, antigens, antibodies, cells, and cell metabolites. The hydrophilic organic solvents include DMSO, ethanol, acetone, N-methylpyrrolidone, organic solvents containing sulfonate groups, or mixtures thereof; (2) Perform surface activation treatment on the target plate; (3) Apply the mixture solution obtained in step (1) to a target; (4) The target plate is vacuum dried to evaporate the solvent in the mixture solution and crystallize. The relative vacuum degree of the vacuum drying is in the range of -0.01 MPa to -0.1 MPa, and the vacuum drying time is in the range of 1 min to 30 min. (5) Perform MALDI-TOF mass spectrometry analysis on the uniformly dried target plate.

6. A mixture solution, wherein, The mixture solution is prepared by mixing a hydrophilic organic solvent with a matrix solution and a analyte solution in a ratio of v:v:v = (1-3): (1-3): (1-3); the hydrophilic organic solvent is an organic solvent that, upon addition, reduces the water contact angle of the matrix solution and the analyte mixture solution by more than 10 degrees; the analyte includes at least one of the following: small organic molecules, inorganic and macromolecular compounds, viruses, microorganisms, nucleotides, nucleosides, oligonucleotides, nucleic acids, amino acids, peptides, proteins, lipids, sugars, carbohydrates, antigens, antibodies, cells, and cell metabolites. The hydrophilic organic solvents include DMSO, ethanol, acetone, N-methylpyrrolidone, organic solvents containing sulfonate groups, or mixtures thereof.

7. Applications of mixed solutions in mass spectrometry detection, among which, The mixture solution is prepared by mixing a hydrophilic organic solvent with a matrix solution and a analyte solution in a ratio of v:v:v = (1-3): (1-3): (1-3); the hydrophilic organic solvent is an organic solvent that, upon addition, reduces the water contact angle of the matrix solution and the analyte mixture solution by more than 10 degrees; the analyte includes at least one of the following: small organic molecules, inorganic and macromolecular compounds, viruses, microorganisms, nucleotides, nucleosides, oligonucleotides, nucleic acids, amino acids, peptides, proteins, lipids, sugars, carbohydrates, antigens, antibodies, cells, and cell metabolites. The hydrophilic organic solvents include DMSO, ethanol, acetone, N-methylpyrrolidone, organic solvents containing sulfonate groups, or mixtures thereof.

Citation Information

Patent Citations

  • Magnetic bead system for detecting SNP and method of use thereof

    CN101245390A

  • Perfluoro acid substance high-sensitivity detecting method assisted by organic proton alkali matrix

    CN102175752A

  • Sample preparation methods for maldi mass spectrometry

    US20030138823A1