A multi-target kinase inhibitor based on aminopyrimidine skeleton and its preparation method and use

Abstract

The present invention belongs to the field of biomedicine technology, and discloses a multi-target kinase inhibitor based on an aminopyrimidine skeleton, a preparation method and a use thereof, wherein the multi-target kinase inhibitor based on an aminopyrimidine skeleton has a molecular structure shown in FIG1. ​​The preparation method comprises the following steps: (1) in an isopropanol solvent, using N,N-diisopropylethylamine as an acid-binding agent, compound 1 and compound 2 are subjected to a reflux reaction to obtain compound 3; (2) under the conditions of a palladium catalyst and a base, using anhydrous ethylene oxide as a solvent, compound 3 and compound 4 are reacted to obtain compound PYR26, that is, a multi-target kinase inhibitor based on an aminopyrimidine skeleton is obtained. The multi-target kinase inhibitor can inhibit the proliferation of liver cancer cells and promote the apoptosis of liver cancer cells, thereby achieving the purpose of effectively treating liver cancer, and its therapeutic effect is significant, and it is not easy to produce drug resistance and adverse reactions.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a multi-target kinase inhibitor based on an aminopyrimidine skeleton, and a preparation method and use thereof. Background Art

[0002] Tumors are new organisms formed when cells in local tissues of the body lose normal regulation of their growth at the genetic level, resulting in clonal abnormal proliferation, often manifested as local masses. Liver cancer is a malignant tumor that occurs in the liver. Among them, primary liver cancer originates from hepatocytes or bile duct cells, and hepatocellular carcinoma (HCC) accounts for 75% to 85%. The main symptoms of primary liver cancer are enlarged and painful liver, weight loss, pain in the right upper abdomen, loss of appetite, ascites, etc. Liver cancer ranks third among cancer killers in the world. In 2020, the incidence of liver cancer in China ranked fifth among malignant tumors in China, and the mortality rate ranked second, seriously threatening the lives and health of the Chinese people. In the body of liver cancer patients, cancer cells continue to increase, and the liver gradually loses its normal function. In traditional treatment options, chemotherapy, radiotherapy and surgical resection are the main ways to treat tumor diseases. Most chemotherapy drugs mainly achieve the purpose of anti-cancer by inducing programmed cell death (apoptosis). However, chemotherapy drugs often have shortcomings such as poor water solubility, low tumor targeting ability and serious adverse reactions, which greatly limit their clinical application. This makes the search for highly effective and low-toxic targeted drugs a current research hotspot.

[0003] Researchers have used some key enzymes in the cell signal transduction pathways related to tumor cell differentiation and proliferation as drug screening targets, and found that new drugs that selectively act on specific targets with high efficiency, low toxicity and strong specificity have become an important direction for the research and development of anti-tumor drugs today. From 1997 to 2015, the FDA approved a total of 128 anti-tumor drugs, and the global anti-tumor drug market size exceeded US$100 billion, with targeted drugs accounting for 62%, and have become the mainstream of new anti-tumor drugs.

[0004] As a complex disease, tumors are characterized by multiple genetic and molecular changes that affect cell proliferation, survival and differentiation. The growth and survival of tumors do not rely solely on one receptor or one signaling pathway, which makes it impossible to completely kill tumor cells by acting on only one target. Gefitinib is the first oral EGFR TK inhibitor to enter clinical trials. It was approved for clinical use by the FDA in August 2003 and officially launched in China in February 2005. In 2007, another small molecule EGFR TK inhibitor, erlotinib, was also launched in China. Studies have shown that the clinical efficacy of these two drugs is comparable, and the efficacy is very poor for patients with EGFR TK resistance mutations; and the long-term single use of drugs such as gefitinib has led to many clinical drug resistance phenomena and related adverse reactions, among which the T790M point mutation leads to 60% of acquired resistance to EGFR inhibitors. Studies have shown that inhibiting the kinase activity of c-Met can restore the sensitivity of EGFR T790M mutant cancer cells to EGFR TK inhibitors, thereby overcoming the problem of drug resistance. Although targeted drugs have significant clinical effects, some patients still experience adverse reactions, which can even endanger their lives. For example, EGFR TK inhibitors have shown serious drug resistance caused by EGFR T790M mutations. Recent studies have shown that the combined use of EGFR TK inhibitors and c-Met inhibitors can effectively inhibit the growth of a variety of tumor cells, and the effect is significantly better than using either one alone. Therefore, it is necessary to design and synthesize inhibitors that can target multiple targets. Multi-target inhibitors can jointly block signal transduction and simplify the treatment process, which is a new development direction for tumor treatment and drug development. Summary of the invention

[0005] In view of the above problems, the present invention provides a multi-target kinase inhibitor based on an aminopyrimidine skeleton, and a preparation method and use thereof.

[0006] The purpose of the present invention is achieved by the following technical solutions:

[0007] A multi-target kinase inhibitor based on an aminopyrimidine skeleton, having the following molecular structure:

[0008]

[0009] Another object of the present invention is to provide a method for preparing the multi-target kinase inhibitor based on the aminopyrimidine skeleton, comprising the following steps:

[0010] (1) Compound 1 and Compound 2 are subjected to a reflux reaction in an isopropanol solvent with N,N-diisopropylethylamine as an acid-binding agent to obtain Compound 3;

[0011] (2) Under the conditions of palladium catalyst and base, with anhydrous ethylene oxide as solvent, compound 3 reacts with compound 4 to obtain compound PYR26, which is the multi-target kinase inhibitor;

[0012] The molecular structures of the compounds 1-4 and compound PYR26 are shown below:

[0013]

[0014] The third object of the present invention is to provide an application of the multi-target kinase inhibitor based on the aminopyrimidine skeleton, specifically for preparing a drug or preparation for treating liver cancer.

[0015] Furthermore, the drug or preparation is used to inhibit the proliferation of liver cancer cells.

[0016] Furthermore, the multi-target kinase inhibitor inhibits the proliferation of liver cancer cells by inhibiting CDK4 and ERK pathways.

[0017] Furthermore, the multi-target kinase inhibitor inhibits the proliferation of liver cancer cells by downregulating the expression levels of ERK and pERK;

[0018] Furthermore, the drug or preparation is used to promote apoptosis of liver cancer cells.

[0019] Furthermore, the multi-target kinase inhibitor promotes apoptosis of liver cancer cells by inhibiting the ERK / P-ERK pathway, the CDK4 pathway and the PI3K pathway.

[0020] Furthermore, the multi-target kinase inhibitor induces apoptosis of liver cancer cells by downregulating the expression levels of ERK and pERK, increasing the permeability of mitochondrial membranes and causing excessive endoplasmic reticulum stress.

[0021] Furthermore, the drug or preparation is used to regulate the expression of the tumor suppressor gene ERK gene in the abnormal proliferation pathway of new blood vessels to prevent the migration of liver cancer cells and inhibit the invasion and metastasis of liver cancer.

[0022] Furthermore, the drug or preparation is used to increase the sensitivity of liver cancer to drugs and reduce the drug resistance of liver cancer.

[0023] The beneficial effects of the present invention are:

[0024] The present invention provides an aminopyrimidine skeleton-based multi-target kinase inhibitor, a preparation method and an application thereof. The multi-target kinase inhibitor can inhibit the proliferation of liver cancer cells by inhibiting CDK4 and ERK pathways and down-regulating the expression levels of ERK and pERK; it can inhibit the ERK / P-ERK pathway, the CDK4 pathway and the PI3K pathway, down-regulate the expression levels of ERK and pERK, increase the permeability of mitochondrial membranes and cause excessive endoplasmic reticulum stress to induce apoptosis of liver cancer cells, thereby achieving the purpose of effectively treating liver cancer. The multi-target kinase inhibitor has a significant therapeutic effect and can be used as an anti-liver cancer drug to prevent and treat diseases such as primary liver cancer, and is not prone to drug resistance and adverse reactions. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The present invention is further described using the accompanying drawings, but the embodiments in the accompanying drawings do not constitute any limitation to the present invention. A person skilled in the art can obtain other drawings based on the following drawings without creative work.

[0026] Figure 1 It is the molecular structure formula of the multi-target kinase inhibitor based on the aminopyrimidine skeleton of the present invention;

[0027] Figure 2 is a schematic diagram of the preparation process of the multi-target kinase inhibitor described in Example 1 of the present invention;

[0028] Figure 3 This is a graph showing the effects of different concentrations of PYR26 on HepG2 cells;

[0029] Figure 4 This is a graph showing the effects of different concentrations of PYR26 on mouse lymphocytes;

[0030] Figure 5 This is the result diagram of the effect of different concentrations of PYR26 on the co-culture of HepG2 cells and lymphocytes;

[0031] Figure 6 This is the result of CCK8 assay to detect the survival rate of HepG2 cells treated with different concentrations of PYR26 for 24 hours;

[0032] Figure 7 This is the result diagram of the effect of different concentrations of PYR26 on the karyotype of HepG2 cells;

[0033] Figure 8 This is the result graph of the effect of different concentrations of PYR26 on the expression of CDK4 mRNA in HepG2 cells;

[0034] Fig. 9 This is the result diagram of the effect of different concentrations of PYR26 on the expression of C-Met mRNA in HepG2 cells;

[0035] Fig.10 This is the result diagram of the effect of different concentrations of PYR26 on the expression of Bak mRNA in HepG2 cells;

[0036] Fig.11 This is the result diagram of the effect of different concentrations of PYR26 on the expression of Caspase 3 mRNA in HepG2 cells;

[0037] Fig.12 This is the result diagram of the effect of different concentrations of PYR26 on the expression of Cyt c mRNA in HepG2 cells;

[0038] Fig.13 This is the result of Western blot detection of the effect of different concentrations of PYR26 on the expression of Caspase-3 protein;

[0039] Fig.14 This is a graph showing the effect of different concentrations of PYR26 on PI3K protein expression as detected by Western blot;

[0040] Fig.15 This is a graph showing the effect of different concentrations of PYR26 on CDK4 protein expression as detected by Western blot;

[0041] Fig.16 This is a graph showing the effect of different concentrations of PYR26 on ERK protein expression as detected by Western blot;

[0042] Fig.17 This is the tumor in vivo imaging of Hepa1-6 tumor-bearing nude mice in the model group, positive control group, and experimental group 14 days after administration;

[0043] Fig.18 This is the tumor size of Hepa1-6 tumor-bearing nude mice in the model group, positive control group, and experimental group after 14 days of drug administration;

[0044] Fig.19 This is a graph showing the changes in tumor size at different times in Hepa1-6 tumor-bearing nude mice in the model group, positive control group, and experimental group;

[0045] Fig. 20 This is a bar graph of the tumor inhibition rate of Hepa1-6 tumor-bearing nude mice in the model group, positive control group, and experimental group after 14 days of drug administration;

[0046] Fig.21 This is the spleen-body ratio bar graph of Hepa1-6 tumor-bearing nude mice in the model group, positive control group, and experimental group after 14 days of drug administration;

[0047] Fig. 22This is a bar graph of the liver-to-body ratio of Hepa1-6 tumor-bearing nude mice in the model group, positive control group, and experimental group 14 days after administration. DETAILED DESCRIPTION

[0048] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0049] Example 1

[0050] In view of the above problems, the present invention provides a multi-target kinase inhibitor based on an aminopyrimidine skeleton and a preparation method and use thereof, wherein the multi-target kinase inhibitor based on an aminopyrimidine skeleton has the following characteristics (attached Figure 1 The molecular structure is shown in:

[0051]

[0052] The method for preparing the multi-target kinase inhibitor based on the aminopyrimidine skeleton comprises the following steps:

[0053] (1) Compound 1 and Compound 2 are subjected to a reflux reaction in an isopropanol solvent with N,N-diisopropylethylamine as an acid-binding agent to obtain Compound 3;

[0054] (2) Under the conditions of palladium catalyst and base, with anhydrous ethylene oxide as solvent, compound 3 reacts with compound 4 to obtain compound PYR26, which is the multi-target kinase inhibitor;

[0055] The molecular structures of the compounds 1-4 and compound PYR26 are shown below:

[0056]

[0057] Specifically, the method for preparing a multi-target kinase inhibitor based on an aminopyrimidine skeleton provided in this embodiment comprises the following steps:

[0058] (1) Compound 1 (20 mmol) was dissolved in 100 mL of anhydrous isopropanol, and then compound 2 (20 mmol) and N,N-diisopropylethylamine (40 mmol) were slowly added. The mixture was reacted under reflux for 12 hours. The reaction was followed by TLC. After the reaction was completed, the reaction solution was cooled to room temperature, poured into water (100 mL), and then washed three times with ethyl acetate (200 mL). The organic phase was taken, and then dehydrated with anhydrous magnesium sulfate. After concentration, the mixture was separated by column chromatography to obtain compound 3;

[0059] (2) The compound 3 (10 mmol) was dissolved in anhydrous ethylene oxide, and then compound 4 (15 mmol), tetrakis(triphenylphosphine)palladium (1 mmol) and potassium carbonate aqueous solution (30 mmol) were added in sequence. The reaction system was evacuated three times and then filled with argon. The reaction solution was heated to 100°C and reacted for 15 hours. The reaction was tracked by TLC. After the reaction was completed, the reaction solution was cooled to room temperature and poured into water (100 mL). It was then washed three times with ethyl acetate (200 mL). The organic phase was taken and then dehydrated with anhydrous magnesium sulfate. After concentration, the template compound PYR26 was separated by column chromatography to obtain a yield of 85%.

[0060] The H NMR spectrum data are as follows: 1H NMR (500 MHz, DMSO-d6) δ10.12 (s, 1H), 8.75 (t, J = 2.0 Hz, 1H), 8.53–8.43 (m, 3H), 8.11 (s, 1H), 8.00 (d, J = 8.3 Hz, 2H), 7.78 (dt, J = 8.0, 1.6 Hz, 1H), 7.58 (t, J = 7.8 Hz, 1H), 7.54–7.42 (m, 2H), 7.39 (s, 2H), 6.81 (d, J = 5.9 Hz, 1H).

[0061] The aforementioned application of the multi-target kinase inhibitor based on the aminopyrimidine skeleton is specifically used for preparing drugs or preparations for treating liver cancer.

[0062] Experimental application example 1

[0063] Investigate the inhibitory effect of the target compound PYR26 on HepG2 cells.

[0064] (1) Resuscitation of HepG2 cells

[0065] Prepare 10 mL of preheated culture medium and cell culture bottles, take out the frozen HepG2 cells from the liquid nitrogen tank, thaw quickly in a 37°C constant temperature water bath, shake quickly for about 1 minute, wait until it melts to a small piece of ice, then take it out, transfer the cell suspension to a centrifuge tube in an ultra-clean workbench, slowly add preheated culture medium, gradually increase the addition speed to prevent osmotic shock, centrifuge at 1000 rpm, 25°C for 6 minutes to remove the freezing medium containing DMSO, discard the supernatant, collect the cell pellet, add appropriate Add culture medium (DMEM culture medium containing 100mL / L fetal bovine serum, 100u / mL penicillin, and 100u / mL streptomycin) and mix well by pipetting, then transfer to culture flasks. Place the culture flasks in an incubator with 5% CO2 and saturated humidity at 37°C for 12h. Use an inverted phase contrast microscope to observe the effect of resuscitated HepG2 cells after 12h of culture. Those that are not attached to the wall and floating are dead cells or cell fragments, those that are attached to the wall or differentiated are living cells. Change the medium every 2-3d for passaging.

[0066] (2) PYR26 treatment of HepG2 cells

[0067] When the HepG2 cells adhered to the wall to 70% to 80%, they were washed twice with PBS buffer, and then enzymatically digested with 0.25% Trypsin for 2 min. Finally, approximately 1.0 × 10 5 The cells were divided into six-well plates at a density of 1 μM, 3 μM, 10 μM, 30 μM and 60 μM, respectively, and the experimental group was added with different doses of PYR26 (so that the final concentrations were 1 μM, 3 μM, 10 μM, 30 μM and 60 μM, respectively), while the control group was replaced with an equal amount of DMEM culture medium. The cells were cultured in an incubator for 24 h, and the growth of HepG2 cells was observed under an inverted microscope and photographed. The experiment was repeated three times under the same treatment conditions.

[0068] See the attached for the processing results. Figure 3 As shown in the figure, with the increase of PYR26 concentration, compared with the control group, the number and density of cells gradually decreased, the edges of cells gradually became less obvious, or accumulated into a mass, or shrunk into a circle, or broke into fragments; the HepG2 cell density in the wells with PYR26 concentrations of 1μΜ, 3μΜ, 10μΜ, and 30μΜ was calculated by cell counting method to be 89%, 81%, 62%, and 40% respectively compared with the control group, and the IC50 calculated by graphpadprism software was 17.25μM; When the concentration of PYR26 was 1 μM, the decrease in cell number and density was not obvious; when the concentration of PYR26 was 3 μM, the number and density of HepG2 cells were significantly reduced compared with the control group, and cell fragments and cells shrunk into a round shape began to appear; and when the concentration of PYR26 reached 30 μM, most of the HepG2 cells died, leaving only cells shrunk into a round shape and about to die from apoptosis and cell fragments due to cell lysis; therefore, the experiment preliminarily showed that PYR26 can inhibit the proliferation and growth of HepG2 cells.

[0069] (3) PYR26 treatment of primary splenic lymphocytes

[0070] 6-7 week old healthy Balb / c mice were killed by cervical dislocation and soaked in 75% alcohol for 10 seconds. Under sterile conditions, the spleen was extracted, washed several times to remove excess tissue, added with PBS for grinding and separation, filtered with a filter to remove excess tissue and precipitation, added with red blood cell lysis buffer, centrifuged at 4°C and 1000 rpm for 5 minutes, discarded the supernatant, resuspended with PBS and washed twice, and finally resuspended in culture medium to make a cell suspension, and cultured in bottles for 24 hours;

[0071] The lymphocytes were centrifuged at 4°C and 1000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended. The lymphocytes were inoculated into a six-well plate, and 2 mL of 1.0×10 7 / mL of lymphocytes were divided into six groups, namely control group and experimental group (final drug concentration was 1 μM, 3 μM, 10 μM, 30 μM, 60 μM), and treated with drugs for 24 h. The proliferation state of lymphocytes was observed under an inverted optical microscope and photographed and recorded.

[0072] See the attached for the processing results. Figure 4 As shown in the figure, compared with the blank control group, PYR26 promoted the proliferation of primary spleen lymphocytes with the increase of drug concentration, and the number of cells increased significantly. The above results suggest that PYR26 may indirectly inhibit the proliferation of HepG2 cells by proliferating and activating lymphocytes and improving the immune activity of lymphocytes.

[0073] (4) PYR26-treated HepG2 cells and lymphocyte co-culture system

[0074] The cell density was 1.0 × 10 6 HepG2 cells at a density of 1.0×10 / mL were inoculated into six-well plates. After the cells adhered to the wall, the original culture medium was discarded and cells were added at a density of 1.0×10 7 / mL of lymphocytes (HepG2 cells: lymphocytes = 1:10) were co-cultured and divided into a control group and an experimental group (final drug concentrations of 1μM, 3μM, 10μM, 30μM, 60μM), a total of six groups, and treated with drugs for 24h; the proliferation status of the cells was observed under an inverted microscope and photographed and recorded.

[0075] See the attached for the processing results. Figure 5 As shown in the figure, as the drug concentration increases, the binding effect of lymphocytes and HepG2 cells is obvious, and the apoptosis rate of HepG2 cells gradually increases. The results show that compared with the control group, PYR26 can promote lymphocyte activation, synergistically increase the inhibitory effect of drugs, and accelerate HepG2 cell apoptosis.

[0076] (5) CCK8 assay to detect HepG2 cell activity

[0077] In order to further explore the inhibitory effect of PYR26 on HepG2 cells, the CCK8 method was used to detect cell viability, and the specific data can better demonstrate the inhibitory effect of PYR26 on HepG2 cells.

[0078] The specific method is as follows: HepG2 cells were cultured in vitro until the logarithmic growth phase. When the number reached 80%, they were enzymatically hydrolyzed into a single cell suspension using 0.25% Trypsin and then distributed into a 96-well plate at a density of 1.0×10 5 / mL, 200μL per well, placed in the incubator for 24h. After the cells adhered to the wall, PYR26 was added according to the designed dose concentration (same as above), 5 replicates were set for each concentration, the control group added an equal amount of cell suspension, the blank group added an equal amount of DMEM, and continued to culture for 24h; after culture, 20μL CCK8 was added to each well and incubated in the incubator in the dark for 1h; the blank control group was used for withering on the microplate reader, and the OD value of each well was measured at a wavelength of 450nm, and the experiment was repeated three times; the cell survival rate and growth inhibition rate were calculated based on the OD value, and the cell survival rate and cell growth inhibition rate were calculated by the following formula:

[0079] Cell survival rate = [(As-Ab) / (Ac-Ab)] × 100%;

[0080] Cell growth inhibition rate = [(Ac-As) / (Ac-Ab)] × 100%;

[0081] Among them, As is the experimental well, Ac is the control well, and Ab is the blank well.

[0082] The calculation results are shown in the attached Figure 6 As can be seen from the figure, after treating HepG2 cells with different doses of PYR26 for 24 hours, the activity of HepG2 cells was significantly reduced and the growth inhibition rate was significantly increased, indicating that PYR26 has a certain cytotoxicity, and with the increase of PYR26 dose, the growth inhibition rate of HepG2 cells gradually increased, showing a dose effect, and the difference was significant (P < 0.05).

[0083] Experimental application example 2

[0084] To investigate the effect of PYR26 on cell nuclear karyotype.

[0085] The experimental results of Experimental Application Example 1 show that PYR26 affects the activity of HepG2 cells within a certain concentration range, inhibits the growth of HepG2 cells, and induces apoptosis of HepG2 cells. To further observe its apoptosis characteristics, Hochest33258 fluorescence staining was used to observe the changes in the karyotype of HepG2 cells after drug addition.

[0086] The specific method is as follows: HepG2 cells were cultured in vitro until the logarithmic growth phase. When the number reached 80%, they were enzymatically hydrolyzed into a single cell suspension using 0.25% Trypsin and inoculated into a 6-well plate at a density of 1.0×10 5 / mL, 2mL per well, culture in a 37℃, 5% CO2 incubator for 24h. After the cells adhere, add different concentrations of PYR26 (final concentrations of 0μΜ, 1μΜ, 3μΜ, 10μΜ, 30μΜ) and continue to culture. After 24h, discard the culture medium, wash with PBS three times, give each well 4% paraformaldehyde (methanol: acetic acid = 3:1) 2mL to fix for 20min, remove the fixative, rinse with PBS 2-3 times, add 0.5mL of Hoechst 33258 (10mg / mL) staining solution to each well after drying at room temperature for 15min, rinse again with PBS three times, protect from light and air-dry, and then observe the color under a Nikon immunofluorescence microscope, and take pictures and record.

[0087] The results are shown in the attached Figure 7 As can be seen from the figure, the cell nuclei of the blank control group without PYR26 treatment showed diffuse and uniform fluorescence, which indicated that most of them were living cells. After treatment with 30 μΜ PYR26, the HepG2 cell nuclei showed high staining density, nuclear condensation, cell membrane blebbing, nucleolus lysis, chromosome condensation around the nuclear membrane, and apoptotic bodies were formed, all of which showed the characteristics of programmed cell apoptosis; with the increase of PYR26 concentration, the characteristics of HepG2 cell apoptosis became more obvious, with a certain dose effect.

[0088] Experimental application example 3

[0089] RT-qPCR was used to detect the mRNA expression of genes in liver cancer cells.

[0090] HepG2 cells were treated with drugs according to the method of Experimental Application Example 2 for 24 h, the original culture medium was discarded, the cells were washed with PBS, 1 mL of TransZol Up / well was added, the cells were placed horizontally for 3-5 min, the cells were blown off, and the cells were transferred to a centrifuge tube and allowed to stand for 5 min. 0.2 mL of chloroform was added, the cells were shaken vigorously, and the cells were incubated at room temperature for 3 min. The cells were centrifuged at 4°C and 10,000 g for 15 min, the upper layer was aspirated into a new EP tube, 0.5 mL of isopropanol was added, the cells were mixed by inversion, the cells were incubated at room temperature for 10 min, the cells were centrifuged at 4°C and 10,000 g for 10 min, the supernatant was discarded, 1 mL of 75% ethanol prepared with DEPC water was added, the cells were vortexed vigorously, the cells were centrifuged at 4°C and 7,500 g for 5 min, the supernatant was discarded, the cells were dried at room temperature, 50-100 uL of RNA dissolution solution was added, the cells were incubated at 55-60°C for 10 min, and the cells were set aside at -70°C.

[0091] RNA concentration and purity were determined using an ultra-micro fluorescence spectrophotometer. PrimeScriptTMRT reagentKit with gDNA Eraser (Perfect Real Time) was used for reverse transcription to obtain cDNA uniformly. Sequence primers corresponding to each gene (as shown in the table below) and the internal reference gene β-actin were designed, and qPCR amplification was performed using cDNA as a template. The reaction system was: 12.5uL 2×TB Green Prime Ex TaqII (Tli RNaseH Plus), 2uL cDNA solution, 8.5uL sterile water, 1uL Forward Primer (10uM) and Reverse Primer (10uM); 3 replicates were made; the reaction conditions were: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing for 30s, 72℃ extension for 10s, and 40 cycles.

[0092] name Primer sequence (5'-3') β-actin F ATTGGCAATGAGCGGTTC β-actin R CAGCACTGTGTTGGCATA Bak F TTTGCTTCAGGGTTTCATCC Bak R GCCACTCGGAAAAAGACCTC Cyt c F AGTGTTCCCAGTGCCACACCG Cyt c R TCCTCTCCCCAGAATGATGCCTTTG Caspase-3 F AATGGACCTGTTGACCTGAA Caspase-3 R CACAAAGCGACTGGATGAAC C-Met F TGGACAATGATGGCAAGAA C-Met R CAGGAGCGAGAGGACAT CDK4 F TTGGTGTCGGTGCCTAT CDK4 R ACGAACTGTGCTGATGG

[0093] The mRNA expression results of each gene are shown in the attached Figure 8-12As shown in the figure, after HepG2 cells were treated with different concentrations of PYR26 for 24 hours, the mRNA expression of CDK4 gene was lower than that of the control group, and the expression in the 3uM group was significantly lower than that in the blank group (P<0.05), and the expression in the 10uM group was extremely significantly lower than that in the blank group (P<0.01), which had a dose effect; c-Met is a hepatocyte growth factor (HGF) receptor, belongs to the tyrosine receptor superfamily, and is the expression product of the c-Met proto-oncogene; the mRNA expression of C-Met gene was significantly decreased, and the mRNA expression in the 30uM experimental group was significantly lower than that in the control group (P<0.01); this indicates that PYR26 inhibits cell migration and adhesion ability by down-regulating the expression of hepatocyte growth factor receptor (C-Met) gene on the surface of HepG2 cells; compared with the control group, the Bak The expression of mRNA was upregulated, among which the 3uM experimental group had the highest upregulation compared with the control group (P<0.05). The results showed that PYR26 could promote the apoptosis of HepG2 cells by upregulating the mRNA expression of the pro-apoptotic gene Bak; compared with the control group, the expression of Caspase-3 mRNA in the drug-treated groups (1uM, 3uM, 10uM, 30uM) was higher than that in the control group, indicating that PYR26 can upregulate and activate the expression of Caspase-3 mRNA, among which the 30uM group had a significant change, and the difference was statistically significant (P<0.01); compared with the control group, the expression of Cytc mRNA in the experimental groups (1uM, 3uM, 10uM, 30uM) increased, among which the expression in the 30uM experimental group was significantly higher than that in the control group, and the difference was statistically significant (P<0.01). The results showed that PYR26 can promote the release of cytochrome c (Cytc), a key signaling molecule of apoptosis, by upregulating the upstream pro-apoptotic Bak gene, activating the downstream Caspase-3 gene, promoting the apoptosis of HepG2 cells, and activating the apoptosis pathway.

[0094] Experimental application example 4

[0095] Western blot was used to detect the effect of PYR26 on the expression of PI3K, Caspase-3, CDK4, and ERK proteins.

[0096] The above experimental results show that PYR26 has a significant inhibitory effect on the growth of HepG2 cells. In order to explore its apoptosis mechanism, the inventors detected the expression of PI3K, Caspase-3, and CDK4 proteins in HepG2 cells after administration.

[0097] Protein tyrosine kinase (PTK) is a class of proteins with tyrosine kinase activity, and epidermal growth factor receptor tyrosine kinase (EGFR TK) is a very important type of receptor tyrosine kinase. EGFR is often expressed at high levels in different cancers, and its expression level is positively correlated with cancer progression and poor prognosis. ERK refers to extracellular regulated protein kinase, including ERK1 and ERK2, which is key to transmitting signals from surface receptors to the cell nucleus. The Ras / Raf / MEK / ERK pathway, which has been studied relatively clearly, is one of the important signal transduction pathways, not only because it is involved in regulating multiple physiological functions of cells, but also because it plays an important role in the pathogenesis and pathophysiological processes of various cancers. P-ERK, or Phospho-ERK, refers to phosphorylation-activated ERK, which translocates from the cytoplasm to the nucleus after activation, and then mediates the transcriptional activation of Ek-1, ATF, Ap-1, c-fos and c-un, and participates in multiple biological reactions such as cell proliferation and differentiation, maintenance of cell morphology, construction of the cytoskeleton, cell apoptosis and cell carcinogenesis.

[0098] Cyclin-dependent kinases (CDKs) are a group of serine / threonine protein kinases. The chemical action of CDKs on serine / threonine proteins is the key to driving the cell cycle, and the typical biological feature of cancer is cell cycle disorder. As the engine of the cell cycle, CDKs and their regulatory factors are crucial in the occurrence and development of tumors. CDK4, a member of the CDK family, has been confirmed to be an oncogene. During the cell cycle, CDK4 plays an important role in the transcription process of oncogenes. Its abnormal expression can promote the development of tumors. Some scholars believe that it has the value of early diagnosis and prognosis. There are more and more drugs targeting cell receptors and key genes. The new generation of CDK4 / 6 inhibitors treats malignant tumors in the cell cycle, preventing cells from progressing from the G1 phase to the S phase. It has good clinical efficacy in patients with ER+ breast cancer. It is also used in malignant tumors such as lung cancer and melanoma. In clinical trials of treatment, it provides a new way for the treatment of malignant tumors. Studies have shown that CDK4 / 6 cyclin-dependent kinase 4 / 6 (CDK4 / 6) not only plays a huge role in cell mitosis, but also participates in many biological processes such as aging, apoptosis and histone regulation, and is abnormally activated in the occurrence and development of various cancers. It can also induce enhanced expression of MHC-Ⅰ complex in tumor cells and promote activation of cytotoxic T cells. The activation of CDK4 / 6 provides tumor cells with the ability to effectively inhibit cell aging and apoptosis.

[0099] PI3K, as a bridge molecule connecting extracellular signals with cell response effects, is not completely independent. Instead, it plays a very important regulatory role in cell apoptosis by acting on downstream signal molecules under the influence of a series of upstream or bypass signal molecules. The P13K / Akt pathway is widely present in cells and is a signal transduction pathway involved in the regulation of cell growth, proliferation, and differentiation. Klippel et al. found that overactivation of PI3K is a necessary factor for cell carcinogenesis. PI3K can activate CDK4 and cell cycle-dependent protein kinase-2 (CDK2), causing cells to enter the s phase and induce DNA synthesis. Further studies have shown that PI3K can regulate the expression of the cell cycle-dependent protein inhibitor p27. Collado et al. used the P13K inhibitor LY294002 to act on human glioma U87MG cells, and found that the expression of p27 in U87MG cells was increased and the cells were blocked in the G0 phase.

[0100] The cysteine ​​protease (Caspase) family is a protease system that directly causes the disintegration of apoptotic cells and occupies a central position in the mechanism of cell apoptosis. Caspase-3 is present in large quantities in various normal tissue cells in the human body, such as epithelium, peripheral blood, lymph nodes, and some malignant tumors. Under normal circumstances, Caspase-3 mainly exists in the cytoplasm in the form of ProCaspase 3 but is inactive. It is only activated and induces the cell to undergo apoptosis when apoptotic stimuli appear in the cell, so it can be regarded as the initiator of cell apoptosis. The signal transduction pathway mediated by Caspase-3 protein is the final pathway for most factors that trigger cell apoptosis to lead to the occurrence of cell apoptosis, and it is the most critical execution protease in the process of cell apoptosis. There are two classic cell apoptosis pathways: intracellular apoptosis pathway (pathway triggered by mitochondria) and extracellular apoptosis pathway (pathway of cell surface death receptors). Most stimuli cause cell apoptosis through the above two pathways after the cascade activation reaction of Caspase protein. In the intracellular apoptosis pathway, some stimulation signals can directly induce mitochondria to release cytochrome C, start the intracellular pathway, cleave and activate BID in the cytoplasm, and cytochrome C can form an apoptosis complex and trigger a cascade reaction to activate downstream Caspase-3, etc., prompting cells to enter apoptosis.

[0101] The specific detection method is as follows: HepG2 cells were treated accordingly according to the above-mentioned drug addition method, and cultured continuously for 24 hours; the operation was carried out on ice, the original culture medium in the six-well plate was discarded, and the plate was washed with pre-cooled PBS, an appropriate amount of lysis solution was taken, and PMSF was added within a few minutes before use to make the final concentration of PMSF 1mM, 90μL lysis solution (RIPA) was added to each well to lyse the cells, and the lysis solution and cells were blown several times with a gun to make the lysis solution and cells fully contacted, and the adherent cells were scraped off in the same direction with a cell scraper, and the cells were collected into EP tubes respectively. After sufficient lysis, centrifugation was performed at 12000g and 4℃ for 5min, and the supernatant was collected. The concentration of each group of proteins was determined by a BCA kit, and the absorbance was determined at a wavelength of 562nm with an enzyme marker, and a protein standard curve was drawn to calculate the concentration of each group of proteins. According to the protein concentration and the amount of sample protein, the volume of sample protein was calculated. At the same time, each protein sample was added with 3×Loading buffer according to the volume ratio of V sample: V (loading buffer) = 2:1. buffer, then placed in a 99°C water bath for 5 min and stored at -20°C for a long term;

[0102] Prepare separation gel and compression gel, load equal amounts of protein, and perform polyacrylamide gel electrophoresis (SDS-PAGE) under compression conditions of 70V, 40min and separation conditions of 100V, 80min; after completion, place the separation gel on a nitrocellulose membrane (PVDF), transfer the protein to the PVDF, and achieve protein transfer under the conditions of 22V, 15min, use 1× washing solution on a shaker, wash 3 times, 5min / time, and block with 5% skim milk powder on a shaker for 2h; incubate with primary antibodies such as PI3K, CDK4, and Caspase 3 (1:1000) on an ice shaker for 1h, place in a 4℃ refrigerator overnight, wash the membrane 3 times with TBST, 5min each time, incubate with anti-rabbit (1:1000) secondary antibody on a shaker at room temperature for 1h, wash the membrane 5 times with TBST, 5min each time, then develop, and scan for observation.

[0103] The experimental results are shown in the attached Figure 13-16 , by the attached Fig.13 It can be seen that the expression of apoptosis factor Caspase-3 in HepG2 cells increases, causing the cells to enter programmed cell death. Figure 14-15 It can be seen that PYR26 has an inhibitory effect on the expression of PI3K protein and CDK4 protein, and has a concentration effect, reducing PI3K expression and inhibiting the proliferation of HepG2 cells. Fig.16It can be seen that PYR26 has an inhibitory effect on ERK protein expression and has a concentration effect. The ERK signal transduction pathway plays a vital role in the physiological processes of cells such as proliferation, survival, differentiation, apoptosis, movement and metabolism. The reduction of ERK expression leads to the reduction of expression of downstream related proteins, and the growth and proliferation of HepG2 cells are inhibited.

[0104] Experimental application example 5

[0105] To investigate the inhibitory effect of PYR26 on Hepa1-6 liver cancer transplanted tumors in nude mice.

[0106] The genes of nude mice are highly similar to those of humans, and they are gentle and easy to operate. In addition, because nude mice do not have a thymus and cannot produce T cells, they have low resistance and a high tumor formation rate. The period of constructing a nude mouse model is relatively short, so nude mice are a good model animal for human liver cancer research. Constructing a nude mouse model that can accurately simulate the symptoms of human liver cancer and is easy to obtain will not only help to further explore the molecular mechanisms of liver cancer occurrence and pathogenesis, but can also be used to detect and evaluate new liver cancer treatment methods and means, thereby promoting the goal of transforming laboratory liver cancer research results into clinical applications.

[0107] (1) Hepa1-6 cell recovery

[0108] Take out the cryopreservation tube containing luciferase (Luc)-labeled Hepa1-6 transfected cells from liquid nitrogen, shake it quickly in a 37°C water bath, and when the ice in the cryopreservation tube is almost completely melted, immediately transfer the melted cryopreservation solution to a centrifuge tube in a sterile environment, centrifuge at 1000rpm, 25°C for 5 minutes, discard the supernatant, gently blow and disperse the cells with newly prepared culture medium, transfer them to a culture bottle and add culture medium to 3mL, and culture them in an incubator at 37°C and 5% CO2 saturated humidity.

[0109] (2) Establishment of Hepa1-6 subcutaneous transplant tumor model

[0110] Prepare 18 4-week-old male SPF BALB / C nude mice and raise them in an SPF environment with a temperature of 26-28°C, a relative humidity of 30%-40%, a 12h / 12h light-dark cycle, and free access to food and water. After the nude mice have adapted for one week, the model is established when the body weight is 18-20g. When the luciferase (Luc)-labeled Hepa1-6 transfected cells grow to the logarithmic phase, the fresh culture medium is replaced, and the cells are collected the next day. The original cell culture medium is discarded on the second day, and the residual serum in the culture flask is removed by washing with PBS twice. The cells are enzymatically hydrolyzed with EDTA. After 1 min, the reaction is terminated with an equal volume of fetal bovine serum culture medium, and the cells are collected. After centrifugation at 4°C and 1000rpm, the supernatant is discarded, and the cells are resuspended in PBS. 6μL is taken for cell counting, centrifuged again, the supernatant is discarded, and the cells are resuspended in 0.9% saline injection solution. An equal volume of matrix gel is added, and the mixture is mixed by pipetting to make a concentration of 1×10 7 The cell suspension of 100 cells / mL was placed on ice to reduce cell metabolism to maintain cell activity and avoid solidification of the matrix gel.

[0111] The concentration was 1×10 7 0.2 mL of cell suspension was injected into the subcutaneous part of the right forelimb of nude mice. The tumor formation was observed once every 2 days after modeling. When the tumor grew to 50-200 mm 3 The mice were then divided into 6 groups according to the principle of roughly equal tumor volume: 3 mice in the high-concentration group (PYR26 40 mg / (kg·time)), 3 mice in the medium-concentration group (PYR26 20 mg / (kg·time)), 3 mice in the low-concentration group (PYR26 10 mg / (kg·time)), and 3 mice in the positive control group (apatinib 20 mg / kg). The mice were intragastrically gavaged with 0.2 mL of apatinib once a day for 14 consecutive days. The control group and the blank group were gavaged with an equal volume of normal saline. The mice were imaged once every 7 days, their body weights were measured every two days, the long and short diameters of the tumor tissues were measured with a vernier caliper, and the tumor volumes were calculated. The measurement status was recorded by photographing, and the behavior of the mice was observed.

[0112] The tumor volume was calculated as follows:

[0113] V = ab2 / 2;

[0114] Where V is the volume, a is the long diameter of the tumor, and b is the short diameter of the tumor.

[0115] (3) Sampling and testing

[0116] On the second day after the last medication, nude mice were anesthetized with 300 mg / kg chloral hydrate. After anesthesia, the nude mice were immediately fixed on the foam board with a needle (with the needle inserted into the limbs), the chest skin was pulled up with tweezers, and the skin and ribs of the chest were cut with scissors in the other hand to expose the heart and liver. Blood was collected from the heart (left ventricle) with a 1 mL syringe, and about 0.5 mL was collected from each mouse to ensure the survival of the nude mouse. The blood was allowed to stand at room temperature for 2 h, centrifuged at 2000 r / min for 20 min, and the supernatant was collected and stored at -80°C. After blood collection, perfusion was performed. 0.9% saline was filled into the perfusion tube in advance. The infusion set was inserted into the left ventricle. The needle was slowly inserted upward into the aorta. Attention was paid to controlling the flow rate. The saline was allowed to seep out drop by drop. A slit was made in the liver to increase the flow rate and flush the blood in the systemic circulation. After the blood was discharged, the limbs, liver and tongue would turn white. 50 mL of saline was perfused for flushing, and then 50 mL of 4% paraformaldehyde solution was perfused (a slower flow rate is conducive to fixation). The mouse tail was observed to be lifted or the trunk was raised in an opisthotonus state, indicating that paraformaldehyde entered the systemic circulation. After perfusion, the tumor tissue was completely removed, except for the necrotic area and the area with rich blood vessels, the liver and spleen were removed, washed with PBS, blotted dry, weighed, photographed, placed in a culture dish, numbered and marked, and some tissues were quickly stored at -80℃; the remaining tissues were fixed in 4% paraformaldehyde at 4℃ overnight, PBS was precooled at 4℃, taken out the next day, soaked in precooled PBS for 1h*3, 30% EtOH, 50% EtOH, 70% EtOH for 1h each for gradient dehydration, and stored in 70% EtOH at 4℃.

[0117] The experimental results are shown in the attached Figure 17-22 , by the attached Figure 17-18 It can be seen that at the end of the experiment, the tumor volumes of the low, medium and high concentration groups of PYR26 were smaller than those of the model group and the positive control group. This preliminarily showed that PYR26 also had an inhibitory effect on tumors in Hepa1-6 tumor-bearing mice.

[0118] By the attached Figure 19-20 It can be seen that the tumor weight of the low-concentration, medium-concentration and high-concentration PYR26 groups was significantly lighter than that of the model group and the positive control group, and the tumor growth was slower. The tumor inhibition rates were 50.46%, 80.66% and 74.59%, respectively. Therefore, PYR26 can significantly inhibit the growth of tumors in Hepa1-6 tumor-bearing mice. Figure 21-22 It can be seen that the weight of spleen and liver in the model group was significantly higher than that in the blank group, and the organ volumes in the low, medium and high concentration groups of PYR26 were smaller than those in the model group and the positive control group.

[0119] The multi-target kinase inhibitors provided in the above embodiments of the present invention can inhibit the proliferation of liver cancer cells and promote the apoptosis of liver cancer cells, thereby achieving the purpose of effectively treating liver cancer. The treatment effect is significant and it is not easy to produce drug resistance and adverse reactions.

[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

[0121]

[0122]

[0123]

Claims

1. A multi-target kinase inhibitor based on an aminopyrimidine skeleton, characterized in that: It has the following molecular structure: 。 2. The method for preparing a multi-target kinase inhibitor based on an aminopyrimidine skeleton according to claim 1, characterized in that: The following steps are involved: (1) In isopropanol solvent, with N,N-diisopropylethylamine as an acid-binding agent, compound 1 and compound 2 were subjected to a reflux reaction to obtain compound 3; (2) Under the conditions of palladium catalyst and base, with anhydrous ethylene oxide as solvent, compound 3 reacts with compound 4 to obtain compound PYR26, that is, a multi-target kinase inhibitor based on an aminopyrimidine skeleton; The molecular structures of the compounds 1-4 and PYR26 are as follows: 。 3. Use of the aminopyrimidine skeleton-based multi-target kinase inhibitor according to claim 1 in the preparation of drugs or preparations for treating liver cancer.

Images