A kind of Paenibacillus strain with high saccharifying enzyme production and its application

Abstract

The present invention belongs to the field of microbial technology, and specifically discloses a high-yield saccharifying enzyme strain and its use. The saccharifying enzyme of the saccharifying enzyme strain provided by the present invention can be active at 70°C, and the enzyme activity at this time can reach 2225U / mL.

Description

A kind of Paenibacillus strain with high saccharifying enzyme production and its application Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically discloses a Paenibacillus strain with high saccharifying enzyme production and application thereof. Background Art

[0002] With the improvement of living standards, people's pursuit of the quality of liquor has become stronger, so the liquor industry is developing in the direction of health, elegance and nobility. There are many types of liquor, among which the brewing process of Luzhou-flavor liquor has been passed down and accumulated for hundreds of years. It is the crystallization of the wisdom and skills of generations of hard-working people. The brewing process of Luzhou-flavor liquor has very high requirements, and its process technology affects the output and quality of liquor. Therefore, in the production of Luzhou-flavor liquor, its brewing process is very important.

[0003] Luzhou-flavor liquor is made from high-quality grains and cereals as the initial raw materials through traditional brewing methods. It does not add any external aromatic substances, but relies on ethyl hexanoate as the main aroma. The main brewing process is: (1) processing of initial raw materials; (2) uncellaring; (3) batching and mixing; (4) steaming grains; (5) adding water and drying; (6) fermentation of mash; (7) cellaring and sealing. At present, various metabolites in the fermentation process of liquor are mainly derived from microorganisms. Therefore, if we can understand its microorganisms from many aspects, it will have important and far-reaching significance for improving the various flavor qualities of liquor. In the brewing process of Luzhou-flavor liquor, step (6) is the main process of saccharification by various microbial fermentation in liquor. The types, concentrations and mutual proportions of trace aroma components in liquor can make liquor present various characteristics. The research and application of adding enzyme preparations to the liquor brewing system to improve the quality of liquor, increase the yield and enhance the unique style of liquor in some aspects are becoming more and more extensive. Subsequently, researchers began to devote themselves to research in this area and discovered that one of the important enzymes, namely saccharifying enzyme, is also called glucoamylase, which is an important enzyme preparation for the saccharification of starch raw materials. Glucoamylase can hydrolyze the α-1,4 bonds of starch and release its α-1,6 glucoside bonds, releasing β-D-glucose from the non-reducing end of starch. It can completely degrade starch into glucose and increase the yield of wine.

[0004] Glycoamylase has been widely used in the fields of food and medicine, and can be used to produce monosodium glutamate, organic acids and amino acids. An important source of saccharifying enzymes is microorganisms. Foreign researchers screened out saccharifying enzyme-producing strains from white wine Xiaoqu in 1982, but there was news of related strain screening and cultivation in my country in the early 1930s. In addition to white wine samples, researchers also looked for more effective saccharifying enzyme-producing strains from other samples. Some researchers isolated and obtained saccharifying enzyme-producing strain L-3 from samples such as soil and moldy starchy materials, which was identified as a purple Monascus. Some researchers also used sea mud from the Bohai Bay as a sample and isolated a strain that produced low-temperature starch-producing saccharifying enzymes from it, which was identified as Aeromonas. Then, the enzymatic properties of the bacteria were studied, and the optimum temperature for enzyme activity was 30°C and the optimum pH was 5.4. In order to obtain a strain with high saccharifying enzyme production and use it to strengthen the production of Daqu, Liu Yanbo and others screened a strain with high saccharifying enzyme production and identified the strain as Bacillus. In addition, Huang Wenguang and others isolated and screened a strain of Aspergillus niger with strong saccharifying enzyme production ability from rotten sweet potatoes, and carried out ultraviolet mutagenesis. It was found that the enzyme activity before mutagenesis was 55.10U / mL, and its enzyme activity increased by 36.70% after mutagenesis. After nitrosoguanidine mutagenesis, the enzyme activity reached 116.84U / mL. Later, others isolated a strain of bacteria from rotten cassava, which was initially identified as Aspergillus niger, and its enzyme activity was detected to be 495.04U / mL. Some researchers also isolated a high-yielding saccharifying enzyme from the soil around the starch products factory, and identified it as a cellulose bacteria. Its optimal enzyme production condition is pH 7.0, and the enzyme activity reaches 176.7U / mL at 30°C. However, the enzyme activity of the saccharifying enzyme strains screened so far is not very high. It is necessary to obtain saccharifying enzyme strains with higher enzyme activity, which is of great significance to improve the utilization rate of raw materials and improve the flavor of liquor. Summary of the invention

[0005] In view of the above technical problems, the present invention provides the following technical solutions:

[0006] The invention provides a high-yield saccharifying enzyme Paenibacillus strain, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration with a deposit number of CGMCC No.25236.

[0007] Another object of the present invention is to provide use of the Paenibacillus strain in producing saccharifying enzymes.

[0008] Another object of the present invention is to provide use of the Paenibacillus strain in liquor fermentation.

[0009] Another object of the present invention is to provide a fermentation method of the Paenibacillus, comprising the following steps: inoculating the Paenibacillus into a fermentation liquid culture medium, culturing at 30° C. in a shaking incubator for 12 to 72 hours, and obtaining a fermentation liquid of the Paenibacillus.

[0010] Another object of the present invention is to provide a fermentation broth obtained according to the above method.

[0011] Another object of the present invention is to provide a microbial agent for producing saccharifying enzymes, which comprises the Paenibacillus sp. and / or the fermentation broth, and an acceptable auxiliary material or carrier.

[0012] Compared with the prior art, the beneficial effects of the present invention are:

[0013] 1. The present invention provides a Bacillus strain with high glucoamylase production, wherein the glucoamylase produced by the strain can be active at 70°C, and the enzyme activity at this time can reach 2225U / mL.

[0014] 2. The present invention performs whole genome sequencing on a high-yield saccharifying enzyme Bacillus strain and finds that the strain has significantly more genes related to transcription, translation, catalytic activity, etc., which can determine that the strain has good expression in terms of genetic characteristics; by comparing the nucleic acid sequence of the strain with various databases, it is found that it is relatively enriched in genes of various proteolytic enzymes, etc., further determining that the bacteria has a relatively strong ability in enzyme secretion, or can be used for industrial production of saccharifying enzymes.

[0015] Biological Deposit Information:

[0016] Biological material: TS-5, taxonomic name: Paenibacillus SP., Latin name: Paenibacillus SP., the strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on July 6, 2022, with the deposit number: CGMCC No.25236, and the deposit address: No. 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Fig. 1 is a transparent circle of a saccharifying enzyme producing strain;

[0018] FIG2 is the result of measuring the saccharifying enzyme activity of 9 strains;

[0019] FIG3 is the effect of pH on the saccharifying enzyme activity of TS-1 strain;

[0020] FIG4 is the effect of pH on the saccharifying enzyme activity of TS-5 strain;

[0021] FIG5 is the effect of pH on the saccharifying enzyme activity of TS-6 strain;

[0022] FIG6 is the effect of temperature on the saccharifying enzyme activity of TS-1 strain;

[0023] FIG7 is the effect of temperature on the saccharifying enzyme activity of the TS-5 strain;

[0024] FIG8 is the effect of temperature on the saccharifying enzyme activity of TS-6 strain;

[0025] FIG9 is the colony PCR result of strain 16S rDNA;

[0026] FIG10 is a 16S rDNA phylogenetic tree of nine saccharifying enzyme-producing strains;

[0027] FIG11 is the result of cellulose degradation by saccharifying enzyme-producing strain TS-5; the figure shows 6 parallels;

[0028] Figure 12 is the result of hemicellulose degradation by saccharifying enzyme producing strain TS-5;

[0029] Figure 13 shows the growth of TS-5 with different monosaccharides as substrates; A: Growth of TS-5 with xylose as carbon source; B: Growth of TS-5 with arabinose as carbon source; C: Growth of TS-5 with glucose as carbon source

[0030] Figure 14 is an example of a transparent circle of the strain after ARTP mutagenesis, and the box is a negative control;

[0031] Figure 15 is the difference in starch degradation activity of saccharifying enzyme before and after mutagenesis;

[0032] FIG16 is a comparison of saccharifying enzyme activities of the induced strain and the uninduced strain;

[0033] Figure 17 is the GO functional classification of TS-5 gene function annotation;

[0034] FIG18 is a functional classification of CAZy in TS-5 strain and statistics of the number of corresponding genes;

[0035] FIG. 19 shows the starch, cellulose and hemicellulose metabolic pathways of the TS-5 strain. DETAILED DESCRIPTION

[0036] The present invention is further explained in conjunction with embodiments and corresponding drawings. The following embodiments are only for illustrative purposes and are not intended to limit the scope of the present invention.

[0037] Example 1

[0038] Screening of saccharifying enzyme producing strains from Luzhou-flavor liquor pit mud

[0039] 1. Experimental methods

[0040] 1.1. Preparation of culture medium

[0041] 1) Solid / liquid culture medium for initial screening of saccharifying enzyme producing strains:

[0042] 20-30 g soluble starch, 2.0 g sodium nitrate, 1.0-1.5 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.5 g potassium chloride, 0.01 g ferrous sulfate, 20.0 g agar, dilute to 1000 mL with water (sterilize at 121°C for 20 min).

[0043] 2) Liquid fermentation medium for saccharifying enzyme producing strains:

[0044] 20 g soluble starch, 2.0 g sodium nitrate, 1.5 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.5 g potassium chloride, 0.01 g ferrous sulfate, 20.0 g agar, and dilute to 1 L with water (sterilize at 121°C for 20 min).

[0045] 1.2. Drawing of glucose standard curve

[0046] Glucose standard solution (1mg / mL): Weigh 0.05g of glucose and dissolve it in distilled water (50mL), mix well. Measure the absorbance of glucose standard solution: Take an appropriate amount of test tubes, add standard solution and reagents after accurate calculation, keep in boiling water bath for 5min, and then add 4mL of distilled water. Measure the OD value of each test tube at 540nm (the control group is tube 0), set up three parallels, and OD 540 With glucose concentration as the horizontal axis and glucose concentration as the vertical axis, draw the glucose standard curve and find the regression equation.

[0047] 1.3. Screening of saccharifying enzyme producing strains

[0048] Take out the Luzhou-flavor liquor pit mud sample from the -80℃ refrigerator, weigh 10g of pit mud into a 250mL conical flask, add 90mL of sterile water, shake and culture it in a constant temperature shaker at 30℃ and 180r / min for 1 hour, then perform gradient dilution (undiluted bacterial solution, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 ) Take 100uL respectively, spread it evenly on the plate, culture it at 30℃ for 2-3 days, and observe whether there is a transparent circle around the colony after the degradation of starch. The specific method of observing the transparent circle is: weigh 0.4g iodine particles and grind them into powder. On the sterile operating table, place the iodine particles evenly on the cover of the culture dish, then turn the culture dish upside down on the cover of the culture dish, wait for ten minutes for transparent circles of different sizes to appear, and the size of the transparent circles can be seen by the naked eye.

[0049] After observation, 9 strains with larger transparent zones were screened (respectively marked as TS-1, TS-2, TS-3, TS-4, TS-5, TS-6, TS-7, TS-8, and TS-9), and the transparent zone diameter ratios were (cm): 1.35 / 0.65, 1.27 / 0.65, 1.35 / 0.65, 1.27 / 0.65, 1.35 / 0.65, 1.37 / 0.65, 1.35 / 0.65, 1.27 / 0.65, and 1.36 / 0.65, as shown in Figure 1.

[0050] The 9 strains obtained were purified (in a 250 mL Erlenmeyer flask, with a liquid volume of 25 mL), cultured at 30°C for 48 h, and after obtaining a single colony plate with a transparent circle, 20-25% glycerol was added for bacterial preservation and stored for later use.

[0051] 1.4. Determination of enzyme activity of saccharifying enzyme producing strains

[0052] 1) Preparation of citric acid-sodium citrate buffer

[0053] Take 21.01 g of citric acid and 29.412 g of sodium citrate and prepare a citric acid-sodium citrate buffer solution with a pH of 5.4.

[0054] 2) Preparation of crude enzyme from saccharifying enzyme producing strain

[0055] The purified 9 saccharifying enzyme-producing strains were cultured on the primary screening isolation medium in 1.1 using the three-zone streak method in a 30°C constant temperature incubator for 2-3 days. After single colonies grew, the nine saccharifying enzyme-producing strains were picked and placed in corresponding and marked fermentation medium, and cultured in a 30°C constant temperature shaker for 7 days. They were then centrifuged in a high-speed refrigerated centrifuge at 4000g for 10 minutes, and the upper layer was the crude enzyme night.

[0056] 3) Spectrophotometer instrument adjustment

[0057] Adjust the photometry to 540 nm and preheat for 20 min.

[0058] A. Enzyme activity calculation formula

[0059] The 3,5-dinitrosalicylic acid method (DNS method) was selected for the determination of saccharifying enzyme activity. Its principle is: starch is decomposed into reducing sugars such as glucose under certain conditions, which combine with 3,5-dinitrosalicylic acid to produce a certain color reaction. The absorbance value at 540nm is measured to calculate the enzyme activity.

[0060] B. Definition of enzyme activity unit

[0061] Under the analytical conditions, the amount of enzyme required to release 1 μg of reducing sugar (calculated as glucose) in 1 min was defined as 1 unit of enzyme activity.

[0062] As shown in Figure 2, in terms of enzyme activity, TS-1, TS-5, and TS-6 are strains with greater enzyme activity, with enzyme activities of 1944.5 U / mL, 2208.9 U / mL, and 2815.6 U / mL, respectively.

[0063] 1.5 Effect of different pH on saccharifying enzyme activity

[0064] 2 mL of the same starch suspension was added to a stoppered colorimetric tube, and 2 mL of 0.1 mol / L citric acid buffer of nine tubes with different pH values ​​of 3.2, 3.8, 4.4, 5, 5.6, 6.2, 6.8, 7.4, and 8.0 was added. The tube was preheated in a 30°C water bath for 10 min, and 1 mL of enzyme solution was added. After incubation for 10 min, 2 mL of 3,5-dinitrosalicylic acid was added and boiled for 5 min. After being taken out, the tube was immediately cooled and made up to volume. A test tube without enzyme solution was used as a blank control, and its absorbance was measured at 540 nm.

[0065] The detection of enzyme activity at different pH values ​​revealed that the optimum pH for strain TS-1 was 3.8, the optimum pH for TS-6 was 5.6, and the optimum pH for TS-5 was 8.0. The results are shown in Figures 3-5.

[0066] 1.6 Effect of different temperatures on saccharifying enzyme activity

[0067] Keeping other conditions unchanged, the temperatures were set to five different temperatures: 30°C, 40°C, 50°C, 60°C, and 70°C. Preheat the mixture in water baths at these five temperatures for 10 min. Add 1 mL of enzyme solution and shake the reaction at the corresponding temperature (180 r / min) for 10 min. Then, add 2 mL of 3,5-dinitrosalicylic acid, boil the mixture in water for 5 min, cool it, make up to 20 mL, add a blank control, and record the absorbance.

[0068] The results showed that the enzyme activity of TS-5 was the highest at 70°C, and the optimum temperature for TS-1 and TS-6 was 40°C, as shown in Figures 6-8.

[0069] Example 2

[0070] Identification of nine strains: TS-1, TS-2, TS-3, TS-4, TS-5, TS-6, TS-7, TS-8, and TS-9

[0071] 1. Identification of saccharifying enzyme producing strains

[0072] 16S rDNA primers: forward primer P1 (5′-AGAGTTTGATCCTGGCTCAG-3′) and reverse primer P2 (5′-AAGTCGTAACAAGGTAACC-3′) for PCR amplification, PCR system (50μL): prepare 23uL of sterile water, 5uL of 10×easy-taqbuff, 0.5uL of easy-taq, 5uL of dNTP, 2uL of upstream primer 1492R (5-3TACGGYTACCTTGTTAYGACTT), 2uL of downstream primer 27F (5-3AGAGTTTGATCCTGGCTCAG), 2uL, and 12.5uL of bacterial solution, at 94℃5min-(94℃1min, 55℃1min, 72℃1.5min) 30cycles-72℃5min. Weigh 0.2g agarose and add 20mL 1×TAE, heat until the liquid is clear, cool slightly until it can be touched, add 1uL nucleic acid dye, slowly pour into the running gel tank, preferably without bubbles. After solidification, add 2.5uL 15000bp Marker to the first gel well slot, add 3uL sample and 1uL Loading buffer mixture to each gel well, turn on the running gel device, set the current to 120A, click run, and start running. The result is shown in Figure 9, about 1500bp long.

[0073] 16s rDNA sequence:

[0074]

[0075] 2. Construction of the evolutionary tree of saccharifying enzyme-producing strains

[0076] The PCR products were sent to Qingke Biotechnology Service Co., Ltd. for sequencing to obtain the 16SrDNA nucleotide sequences of these strains. The sequences were entered into GenBank for BLAST comparison to obtain strains with high similarity to the strain gene sequences. ClustalX was used for multiple sequence matching and alignment. The phylogenetic distance of the sequences was calculated using MEGAX software. Neighbor-joining was used to construct a phylogenetic tree. The results are shown in Figure 10.

[0077] After identification, strains TS-1, TS-3, TS-4, TS-5, TS-6, TS-7, and TS-8 all belong to Paenibacillus sp., and TS-2 and TS-9 all belong to Bacillus sp., and their Latin names are Bacillus sp.

[0078] Considering that one of the requirements for the application of saccharifying enzymes in the food industry is high temperature resistance, the above tests show that TS-5 can still maintain a high enzyme activity at 70°C. It is believed that this strain may have the potential of an industrial strain, so TS-5 will continue to be explored.

[0079] Example 3

[0080] 1. Utilization of different monosaccharides by test strain TS-5

[0081] Prepare fermentation liquid culture medium with xylose, arabinose and glucose as the sole carbon source, respectively, and divide them for use after sterilization; pick a single colony of strain TS-5, culture it in 5 mL of fermentation medium until OD600 is 0.6-0.8, and according to the principle of 1% (V / V) inoculation amount, pipette 1 mL into a conical flask with 100 mL of fermentation culture medium, and measure OD under a spectrophotometer. 600 Keep a record of the value.

[0082] 2. Testing the ability of strain TS-5 to degrade cellulose

[0083] Pick a single colony of the prepared TS-5 saccharifying enzyme-producing strain into a liquid culture medium, then dilute the bacterial suspension in a gradient manner and spread it on a CMC2 plate (select a bacterial suspension with an appropriate dilution multiple, in this experiment, dilute to 10 -4 ~10 -5), place the plate at 30℃ for 2-3 days. After a single colony appears, use a sterilized toothpick to pick up a single colony and spot it on the culture medium for staining observation, and place the plate in a 30℃ constant temperature incubator for 2-3 days. The specific method of Congo red staining is: wash off the colony with 70% alcohol, stain with 0.1% Congo red for 30 minutes, decolorize with 1M NaCl solution for 30 minutes, and observe whether there is a transparent circle left after the degradation of cellulose around the single colony.

[0084] 3. Test the ability of strain TS-5 to degrade hemicellulose

[0085] Pick a single colony of the TS-5 saccharifying enzyme-producing strain and place it in its liquid enrichment medium. Dilute the bacterial solution and spread it on a plate (it is best to have uniform single colonies on the plate. In this experiment, dilute to 10 -4 -10 -5 ), and the plate was placed at 30°C for 2-3 days. TS-5 saccharifying enzyme producing strain was spread on the plate and placed at 30°C for 2-3 days. After that, the transparent circle produced by the degradation of hemicellulose can be observed with naked eyes.

[0086] The results showed that the screened TS-5 strain can decompose cellulose and hemicellulose at the same time, indicating that the strain has a rich hydrolytic enzyme system, as shown in Figures 11-12.

[0087] The TS-5 strain was cultured in a medium containing xylose, glucose, and arabinose as carbon sources, and it was found that the strain was able to utilize the above carbon sources. The results are shown in Figure 13.

[0088] Example 4

[0089] Mutation of strain TS-5 using ARTP technology to improve the ability of producing saccharifying enzymes

[0090] 1. ARTP pre-mutation treatment

[0091] Streak the saccharifying enzyme-producing strain TS-5 on the selective medium for saccharifying enzyme-producing strains, culture at 30°C for 2-3 days, take a single colony and culture it in its liquid medium overnight until the OD600 is 0.8. Centrifuge at 6000rpm for 5 minutes at 4°C, and discard the supernatant. Add 1mL of sterile saline and vortex for 10s, centrifuge, and discard the supernatant, repeat twice, and finally add 1mL of saline and vortex for 10s to prepare a bacterial suspension.

[0092] 2. ARTP mutagenesis process

[0093] Take 10uL of bacterial solution and apply it evenly on a sterile metal gasket with a diameter of 6mm. Place it in the corresponding position of the ARTP mutagenizer. Set the mutagenizer conditions and start directly. The mutagenizer conditions are: ARTP instrument preheating for 30min, power of 120W, distance of 2mm, working gas flow of 10SLM, helium as working gas, and mutagenizer time of 30s. After the end, put the metal gasket into an EP tube containing 1mL of 5% glycerol saline, vortex for 60s to resuspend the bacterial solution on the metal gasket, dilute the resuspended solution and apply it on the saccharifying enzyme-producing strain plate, and place it in a 30℃ constant temperature and humidity incubator for 3 days.

[0094] 3. Comparison of transparent zone size and enzyme activity of strains before and after mutagenesis

[0095] The TS-5 strain induced by ARTP was diluted and spread on the saccharifying enzyme-producing strain culture medium plate, and then placed in a constant temperature and humidity incubator at 30°C for 3 days. At the same time, the original strain (TS-5 strain before mutation) was cultured at the same OD 600 Under the same conditions, it was spread on the same selective culture medium, and the above culture medium was placed in a constant temperature incubator at 30℃. After 2-3 days, iodine fumigation was used to observe the transparent circle produced and compare it with the original strain. At the same time, the best mutagenic strain was selected from the induced strains to compare with the enzyme activity and starch degradation activity of the original strain.

[0096] The results showed that the size of the transparent zone and the enzyme activity of the induced strain increased exponentially (the enzyme activity of the induced strain was about 4800U / mL), as shown in Figures 14-16.

[0097] Example 5

[0098] Whole genome sequencing analysis of strain TS-5 using third-generation sequencing technology

[0099] 1. Cultivation of strain TS-5

[0100] The TS-5 saccharifying enzyme strain preserved in the -80°C freezer was streaked using the three-zone streak method in a medium with starch as the sole carbon source, and cultured in a 30°C incubator for 2-3 days. After a single colony was obtained, a single colony was picked and cultured in a liquid fermentation medium with starch as the sole carbon source, and cultured in a shaker at 30°C for 72 hours until the OD 600 The concentration was 0.6-0.8, and the mixture was centrifuged at 4000 rpm for 10 min in a high-speed refrigerated centrifuge. The upper culture medium was discarded and the lower bacterial cells were collected.

[0101] 2. Whole genome sequencing

[0102] The saccharifying enzyme-producing strain TS-5, whose quality met the sample submission standards, was placed in a -80℃ ultra-low temperature storage box and sent to Novogene Biotechnology Co., Ltd., which then extracted DNA and conducted whole genome sequencing on the saccharifying enzyme-producing strain TS-5.

[0103] 3. Assembly

[0104] The sequences were assembled using the China Microbial Bioscience Data Center cloud tool (version 2.04), sequence splicing software, double-end sequencing short sequence assembly software, etc., and finally merged using the international information system.

[0105] 4. Genome sequence assembly

[0106] Readfq (version 10) was used to filter the raw data of the saccharifying enzyme-producing strain TS-5.

[0107] 5. Genome composition analysis

[0108] 5.1 Coding gene prediction

[0109] Multiple databases and software such as NCBI were used to predict the coding genes of the genome of the saccharifying enzyme producing strain TS-5.

[0110] 5.2. Repeat sequence prediction

[0111] According to the distribution of repeated sequences, they can be divided into interspersed repeat sequences and tandem repeat sequences; they can also be divided into small satellite DNA and microsatellite DNA. The interspersed repeat sequences and tandem repeat sequences of the saccharifying enzyme producing strain TS-5 were predicted by annotation (Version open-4.0.5) software and TRF (TandemRepeaTS Finder, Version 4.07b).

[0112] 5.3 Non-coding RNA prediction

[0113] Non-coding RNA (ncRNA) is a general term for genes that cannot be translated into proteins. tRNA was predicted using tRNAscan-SE software; the software (Version 1.2) made accurate predictions; and finally, the program (Version 1.1rc4) was used to predict the sequence of the saccharifying enzyme-producing strain and determine the final sRNA.

[0114] 5.4. Gene Islands

[0115] Genomics Islands (GIs) can reflect the functions of microorganisms in adapting to the environment. The IslandPath-DIOMB software (Version 0.2) was used to predict the GIs of the saccharifying enzyme-producing strain TS-5.

[0116] 6. Gene function annotation analysis

[0117] 6.1 GO annotation

[0118] GO stands for Gene Ontology, a classification system that systematically describes gene functions at the global level; it includes three contents: 1) cellular components, 2) molecular functions, and 3) biological processes. Blast2GO was used to obtain the GO annotation prediction information of the saccharifying enzyme-producing strain TS-5.

[0119] 6.2 COG Annotation

[0120] COG, which stands for Cluster of Adjacent Proteins in Chinese, is a protein database created by NCBI (based on the complete genomes of bacteria, eukaryotes, etc.). The function of a protein sequence that has been annotated to COG can be predicted and classified.

[0121] 6.3 Nr Annotation

[0122] The Nr (Non-Redundant Protein Database) database can clearly find the number of genes according to the species annotated to the genes. The amino acid information encoded by the gene of the saccharifying enzyme-producing strain TS-5 was compared with the database using blastp to obtain the annotation information.

[0123] 6.4 KEGG Annotation

[0124] KEGG (Kyoto Encyclopedia of Genes and Genomes) is a database that can systematically and comprehensively analyze the metabolic pathways and functions of gene products in cells. The information obtained from KEGG helps to systematically understand the functions of microorganisms. It includes: metabolic pathways, gene sequences and genomes, etc. The KEGG database is used to compare with the saccharifying enzyme-producing strain TS-5 to obtain the annotation results corresponding to the strain's genes.

[0125] 7. Other Analysis

[0126] Further prediction and annotation of the genome sequence of the saccharifying enzyme producing strain TS-5 included TCDB (Transporter Classification Database), Swiss-Prot database annotation, CAZy (Carbohydrate-Active enZYmes Database) annotation, secretory protein prediction, secretion system protein and T3SS effector protein prediction, secondary metabolism gene cluster prediction analysis, etc.

[0127] 7.1、TCDB database annotation

[0128] TCDB, which is called Transporter Classification Database in Chinese, also includes a classification system (TC system) for ion channels.

[0129] 7.2 Pfam database annotation

[0130] Proteins composed of one or more functional regions are usually called domains. Different domains are combined to form different proteins, so the analysis of domains is about the analysis of protein functions. The database consists of two parts: Pfam-A and Pfam-B. Pfam.xfarm (http: / / pfam.xfam.org / ) was used to compare the gene sequence of the saccharifying enzyme-producing strain TS-5 with the database to obtain the annotation results.

[0131] 7.3 Swiss-Prot database annotation

[0132] Swiss-Prot can analyze a protein's function, its domain structure, post-translational modifications, mutations, etc. It is a database that analyzes selected protein sequences and can provide high-quality annotation results.

[0133] 7.4. Carbohydrate-Active Enzymes (CAZy) Database Annotation

[0134] CAZy (Carbohydrate-Active enZYmes Database) includes a database of enzymes that catalyze carbohydrate degradation, modification, and biosynthesis. In order to ensure the accuracy of its annotation results, usually only one optimal annotation is retained. It mainly includes the following categories: glycoside hydrolases, glycosyltransferases, polysaccharide lyases, carbohydrate esterases, and oxidoreductases. The gene sequence of the saccharifying enzyme strain TS-5 was compared with the database using blastp to obtain the final result.

[0135] 7.5. Secreted Protein Prediction

[0136] Proteins that are secreted outside the cell to exert their effects are called secretory proteins. The SignalP (Version 4.1) tool was used to predict the saccharifying enzyme-producing strain TS-5 to detect whether it has a signal peptide and a transmembrane structure.

[0137] 7.6 Prediction of secretion system proteins and T3SS effector proteins

[0138] The secretion system TNSS (type N secretion systems, currently there are 7 types identified, type I-type VII) can affect various important physiological activities in cells, such as immune response and cell death. The results were annotated through the protein sequence function database and the related proteins of the TNSS system were extracted. The EffectiveT3 software (Version 1.0.1) was used to predict the T3SS effector protein of the saccharifying enzyme producing strain TS-5.

[0139] 7.7. Analysis of secondary metabolism gene clusters

[0140] The genes of enzymes synthesized by microorganisms involved in secondary metabolic pathways are on chromosomes. The antiSMASH program (version 2.0.2) is usually used to predict the genome of saccharifying enzyme-producing strain TS-5.

[0141] 7.8 Whole genome map

[0142] The assembled genome sequence of the sequencing sample of the saccharifying enzyme-producing strain TS-5 was combined with the prediction results of each coding gene, and the sample genome was displayed using Circos software.

[0143] 7.9 Metabolic pathway analysis of TS-5 strain

[0144] Metabolism is an important requirement for the growth and development of microorganisms such as bacteria and fungi. A detailed understanding of metabolic pathways can help understand the needs of microorganisms at different stages and their metabolites. For TS-5, which has the potential to become an industrial strain, understanding its metabolic pathways and the products of each metabolic pathway will help to better apply TS-5. This study obtained TS-5 from KEGG to participate in the metabolic pathways of starch, etc., and analyzed and understood the genes of the related enzymes involved, which is of great significance for industrial production.

[0145] 8. Discover the potential genes for TS-5 to degrade starch, cellulose and hemicellulose

[0146] In the process of using saccharifying enzymes to degrade starch and cellulose, most saccharosidase genes play an important role. Based on the results of gene sequencing and annotation of gene functions, we consulted the genes related to starch degradation that have been reported, compared the nucleic acid sequences, and mined potential genes, and sorted and analyzed the genes. As shown in Table 1.

[0147] Table 1 Basic information of genes for starch, cellulose and hemicellulose degradation of TS-5 strain

[0148]

[0149]

[0150]

[0151] The whole genome sequencing of the saccharifying enzyme-producing strain TS-5 of the genus Paenibacillus was performed. Through various gene predictions and functional annotations of various databases, it was found that the strain had significantly more genes related to transcription, translation, catalytic activity, etc., which confirmed that the strain had good expression in terms of genetic characteristics. The results are shown in Figure 17.

[0152] By comparing the nucleic acid sequence of strain TS-5 with various databases, it was found that it was relatively enriched in genes of various proteolytic enzymes, as shown in Figure 18, further confirming that the ability of the bacterium in enzyme secretion is relatively strong, or it can be used for industrial production of saccharifying enzymes.

[0153] After comparative analysis at NCBI, it was found that strain TS-5 had many genes for enzymes involved in the degradation of starch, cellulose, and hemicellulose, and their metabolic processes were cross-correlated with each other. Details are shown in Figure 19.

[0154] The experimental methods used in the examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the examples are all commercially available unless otherwise specified.

[0155] It should be understood that those skilled in the art can make improvements or changes based on the above description, and all these improvements and changes should fall within the scope of protection of the appended claims of the present invention.

Claims

1. A high-yield saccharifying enzyme-producing bacillus, characterized in that: It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration with the deposit number CGMCC No.25236.

2. Use of the Paenibacillus according to claim 1 in producing saccharifying enzymes.

3. Use of the Paenibacillus according to claim 1 in liquor fermentation.

4. The fermentation method of Paenibacillus according to claim 1, characterized in that: The following steps are involved: The Paenibacillus is inoculated into a fermentation liquid culture medium, and cultured in a shaking incubator at 30° C. for 12 to 72 hours to obtain a fermentation liquid of the Paenibacillus.

5. A fermentation broth obtained according to the method of claim 4.

6. A microbial agent for producing saccharifying enzyme, characterized in that: The method comprises the Paenibacillus according to claim 1 and / or the fermentation broth according to claim 5, and an acceptable auxiliary material or carrier.

Images