Anti-melanoma active polypeptide KW13, medicine and application
By developing the anti-melanoma active peptide KW13 and its drug, the problem of large toxic side effects of existing drugs has been solved, and the toxicity has been reduced while inhibiting melanoma proliferation, providing a safer treatment option.
Patent Information
- Application Number
- CN202310279688.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-22
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2043-03-22
AI Technical Summary
Existing melanoma treatment drugs have significant toxic side effects, especially immune responses, which put a heavy burden on patients and have limited therapeutic effects. There is an urgent need to develop drugs with better efficacy and fewer toxic side effects.
Provided are an anti-melanoma active polypeptide KW13 and a drug thereof, comprising a polypeptide with a specific amino acid sequence or its derivatives and salt forms thereof, combined with pharmaceutically acceptable excipients, prepared into an injection or containing a drug carrier, for preparing a drug for inhibiting melanoma proliferation.
The active peptide KW13 has no adverse reactions in animal models, has good safety and anti-tumor activity, can inhibit melanoma proliferation, and is less toxic than traditional drugs such as paclitaxel, providing a safer treatment option.
Smart Images

Figure CN116120401B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical technology, and specifically relates to a small molecule active polypeptide KW13 and its application in anti-melanoma treatment, as well as a medicine containing the active polypeptide. Background Art
[0002] Melanoma, commonly referred to as malignant melanoma, is a highly malignant tumor that originates from melanocytes. It is extremely invasive and often occurs on the skin, but can also be found in internal organs, mucous membranes, the uvea, and other parts of the eye. Melanoma is caused by various factors. Exposure to natural or artificial ultraviolet light is the main environmental risk factor, while individual factors include genetic susceptibility, multiple melanocytic nevi, and lighter skin color. Worldwide, the incidence of melanoma has shown an increasing trend year by year. As the most deadly skin cancer, melanoma is a major challenge facing global public health and cancer control. Research on drugs to prevent and treat melanoma is of great social need and significance.
[0003] Surgical resection is an effective treatment for patients with early-stage melanoma, but for patients with advanced disease, especially those with metastasis, surgical resection has limited effectiveness and requires additional treatment. In recent years, in addition to traditional chemotherapy and radiotherapy, immunotherapy and targeted therapy have been increasingly used in clinical practice. According to the "Melanoma Diagnosis and Treatment Guidelines (2022 Edition)" issued by the National Health Commission, commonly used systemic chemotherapy drugs for melanoma in clinical practice, namely traditional cytotoxic drugs, include dacarbazine, temozolomide, fotemustine, paclitaxel, albumin-paclitaxel, cisplatin, and carboplatin. The efficacy of single-agent or traditional combination therapy in melanoma is 10% to 15%; currently, the main melanoma targeted drugs on the market in China include: BRAF inhibitors (vemurafenib, dabrafenib), MEK inhibitors (trametinib), and KIT inhibitors (imatinib, nilotinib); domestically approved melanoma immunotherapy drugs mainly include PD-1 monoclonal antibodies (pembrolizumab, toripalimab). However, in clinical treatment, existing drugs often have significant toxic side effects, especially the potential for immune responses, which can place a heavy burden on patients. Therefore, drug treatment for melanoma still faces enormous challenges, and there is an urgent need to develop drugs with better efficacy and fewer toxic side effects. Summary of the Invention
[0004] The present invention aims to provide an anti-melanoma active polypeptide KW13, a drug and its application. The active polypeptide provided by the present invention has good in vivo anti-tumor activity and no adverse reactions, providing a good prospect for anti-melanoma treatment.
[0005] The present invention provides an anti-melanoma active polypeptide KW13, comprising the active polypeptide described in any one of (1) to (3):
[0006] (1) an active polypeptide with an amino acid sequence as shown in SEQ ID NO: 1;
[0007] (2) an active polypeptide derived from (1) having anti-melanoma activity after one or more amino acids are substituted, deleted or added in the amino acid sequence of the active polypeptide defined in (1), or after one or more amino acid residues are chemically modified;
[0008] (3) A salt form of the active polypeptide described in item (1) and / or item (2).
[0009] The present invention also provides a nucleic acid molecule encoding the anti-melanoma active polypeptide KW13 described in the above technical solution, and the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 2 or SEQ ID NO: 3.
[0010] The present invention also provides the use of the anti-melanoma active polypeptide KW13 described in the above technical solution or the nucleic acid molecule described in the above technical solution in the preparation of an anti-melanoma drug.
[0011] The present invention also provides the use of the anti-melanoma active polypeptide KW13 described in the above technical solution or the nucleic acid molecule described in the above technical solution in the preparation of a drug for inhibiting melanoma proliferation.
[0012] The present invention also provides an anti-melanoma drug, the active ingredient of which includes the anti-melanoma active polypeptide KW13 described in the above technical solution.
[0013] In the present invention, the anti-melanoma drug further comprises a pharmaceutically acceptable excipient.
[0014] Preferably, the excipients include one or more of solubilizers, cosolvents, suspending agents, emulsifiers, antibacterial agents, antioxidants, osmotic pressure regulators, pH regulators and fillers.
[0015] The present invention also provides a pharmaceutical composition comprising a preparation capable of killing tumor cells and / or a drug carrier capable of dispersing and transferring drugs into the body to exert biological functions and the anti-melanoma active polypeptide KW13 described in the above technical solution.
[0016] In the present invention, the preparation capable of killing tumor cells includes chemical drugs and / or biological drugs capable of killing tumor cells; the biological drugs include targeted drugs or nano drugs; the chemical drugs include radioactive drugs, photodynamic therapy drugs or nano drugs.
[0017] In the present invention, the drug carrier that disperses the drug and transfers it into the body to exert biological functions includes any one of nanomaterials, liposomes, polyethylene glycol-modified compounds or oily compounds, or a mixture of multiple oily compounds.
[0018] The present invention provides an anti-melanoma active polypeptide, KW13. This polypeptide exhibits low cytotoxicity, exhibits no adverse reactions in animal models, and possesses excellent safety. This polypeptide can be used as a standalone biotherapeutic for melanoma and is also expected to be used in combination with other treatment modalities to inhibit melanoma. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0020] Figure 1 The HPLC spectrum of the active polypeptide KW13 provided by the present invention;
[0021] Figure 2 This is the MS spectrum of the active polypeptide KW13 provided by the present invention;
[0022] Figure 3 This is a graph showing the cell viability of human immortalized epidermal cells Hacat after being treated with different concentrations of the active polypeptide KW13 provided by the present invention for 48 hours;
[0023] Figure 4 This is the HE staining result of the main organ sections of the mouse intraperitoneal injection 14-day (sub) acute toxicity test (maximum dose single administration) provided by the present invention, scale 200μm;
[0024] Figure 5 This is the HE staining result of the main organ sections of the mouse intraperitoneal injection 14-day (sub) acute toxicity test (multiple doses) provided by the present invention, with a scale of 200 μm;
[0025] Figure 6 These are graphs showing the anti-melanoma activity results of the active polypeptide KW13 at different concentrations provided by the present invention in mice; wherein, A is a representative luminescence image of the in vivo imaging of each group of mice; B is a graph showing the luminescence intensity of the in vivo imaging of each group of mice; and C is a graph showing the melanoma inhibition rate of each dose group treated with the KW13 active polypeptide. DETAILED DESCRIPTION
[0026] The present invention provides an anti-melanoma active polypeptide KW13, comprising the active polypeptide described in any one of (1) to (3):
[0027] (1) an active polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 (KKPVTQIVSAEAW);
[0028] (2) an active polypeptide derived from (1) having anti-melanoma activity after one or more amino acids are substituted, deleted or added in the amino acid sequence of the active polypeptide defined in (1), or after one or more amino acid residues are chemically modified;
[0029] (3) A salt form of the active polypeptide described in item (1) and / or item (2).
[0030] In the present invention, the molecular weight of the active polypeptide with the amino acid sequence shown in SEQ ID NO: 1 is 1456.68 Daltons. The present invention does not particularly limit the method for preparing the active polypeptide; methods for preparing active polypeptides well known in the art can be used. In an embodiment of the present invention, the active polypeptide KW13 is preferably prepared by chemical synthesis. The chemical synthesis method of the present invention preferably uses an automatic active polypeptide synthesizer to synthesize the entire sequence, which is then desalted and purified by HPLC reverse phase column chromatography to determine that its purity is greater than 98%.
[0031] In the present invention, the site of chemical modification is preferably a side chain group, α-carbon atom, terminal amino group, or carboxyl group of an amino acid residue. The types of chemical modification described in the present invention preferably include covalent attachment of one or more modifiers. In the present invention, the modifier preferably includes human serum albumin, a fatty acid, a glycosyl group, a homologous IgG, polyethylene glycol, or a fluorescent labeling group. The present invention does not particularly limit the method of chemical modification, and chemical modification methods well known in the art may be employed.
[0032] In the present invention, the salt form of the active polypeptide preferably includes hydrochloride, phosphate or acetate. The present invention has no particular limitation on the preparation method of the salt form of the active polypeptide, and any method for preparing the salt form of the active polypeptide known in the art can be used.
[0033] The present invention also provides a nucleic acid molecule encoding the anti-melanoma active polypeptide KW13 described in the above technical solution, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 2 (AAGAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGG) or SEQ ID NO: 3 (AAAAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGG).
[0034] The present invention does not particularly limit the polypeptide encoding method of the nucleic acid molecule, and methods well known in the art, such as recombinant expression methods, can be used. In the present invention, the recombinant expression method preferably includes: constructing the nucleic acid molecule sequence into a vector by genetic recombination methods to form a recombinant DNA expression vector, and then expressing, extracting, and purifying the polypeptide molecule in prokaryotic or eukaryotic cells.
[0035] The present invention also provides the use of the anti-melanoma active polypeptide KW13 described in the above technical solution or the nucleic acid molecule described in the above technical solution in the preparation of an anti-melanoma drug. In the present invention, the dosage form of the drug is preferably an injection.
[0036] The present invention also provides the use of the anti-melanoma active polypeptide KW13 described in the above technical solution or the nucleic acid molecule described in the above technical solution in the preparation of a drug for inhibiting melanoma proliferation. In a mouse melanoma model, administration of the active polypeptide KW13 inhibited melanoma proliferation in the mice. This demonstrates that the active polypeptide KW13 described in the present invention has the ability to inhibit melanoma proliferation, providing new insights into the preparation of anti-melanoma drugs.
[0037] The present invention also provides an anti-melanoma drug, the active ingredient of which includes the anti-melanoma active polypeptide KW13 described in the above technical solution.
[0038] In the present invention, the anti-melanoma drug preferably further comprises a pharmaceutically acceptable excipient. In the present invention, the excipient preferably comprises one or more of a solubilizer, a cosolvent, a suspending agent, an emulsifier, an antibacterial agent, an antioxidant, an osmotic pressure regulator, a pH regulator, and a filler.
[0039] The present invention also provides a pharmaceutical composition comprising a preparation capable of killing tumor cells and / or a drug carrier capable of dispersing and transferring drugs into the body to exert biological functions and the anti-melanoma active polypeptide KW13 described in the above technical solution.
[0040] In the present invention, the tumor cell-killing agent includes chemical drugs and / or biological drugs capable of killing tumor cells; the biological drug includes a targeted drug or a nanodrug; and the chemical drug includes a radiopharmaceutical, a photodynamic therapy drug, or a nanodrug. In the present invention, the agent more preferably includes any one of an antimetabolite, an anti-angiogenic drug, an alkylating agent, a natural anti-tumor drug, an anti-tumor antibiotic, a targeted drug such as vemurafenib, a monoclonal antibody drug such as pembrolizumab, or a hormone drug.
[0041] In the present invention, the drug carrier that disperses the drug and transfers it into the body to exert biological functions preferably includes any one of nanomaterials, liposomes, polyethylene glycol-modified compounds or oily compounds, or a mixture of multiple oily compounds.
[0042] To further illustrate the present invention, the anti-melanoma active polypeptide KW13, the drug and its application provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0043] Example 1
[0044] Synthesis method of active peptide KW13
[0045] An anti-melanoma active peptide KW13 was synthesized by solid-phase synthesis, the sequence of which is shown in SEQ ID NO. 1. The specific steps are as follows:
[0046] 1. Resin swelling
[0047] Pour 5 g of Fmoc-Trp(Boc)-Wang Resin into the reaction column, add 50 mL of DCM to swell, and soak for 5 minutes.
[0048] 2. Deprotection
[0049] The DCM in the reaction column was drained, and a decapping solution (20% by volume piperidine in DMF solution) was added to remove Fmoc. The column was agitated with nitrogen for 30 min, drained, washed with DMF 5 times, and drained.
[0050] 3. Condensation reaction
[0051] The condensation was carried out using a TBTU / DIEA activator combination. TBTU and the linker amino acid Fmoc-Ala-oh were weighed and calculated as 3 times the feed amount, dissolved in 50 mL of DMF and added to the reaction column. DIEA (1.55 mL) was added, nitrogen was aerated, and the reaction was carried out for 30 min.
[0052] 4. Testing and washing
[0053] Use a sampling tube to collect a small amount of resin from the reaction column and pour it into a small test tube. Rinse once with DMF. Discard the DMF and add 3 drops each of Solution A, Solution B, and Solution C (Solution A: ninhydrin alcohol solution, Solution B: 20% ethanol and 80% phenol mixed solution, Solution C: redistilled pyridine). Heat at 120°C for 3 minutes. Remove and observe the color of the solution and resin. If the solution is yellow and the resin is colorless or light yellow, the condensation reaction is complete. Stop the reaction in the reaction column, drain, and rinse three times with DMF.
[0054] 5. Reinvestment
[0055] If the resin color is detected to be other colors, such as green, it means that the reaction is not complete. Drain and wash it three times, weigh the same amount of the current reaction and put it into the reaction column to react again until the reaction is complete.
[0056] 6. Continue condensation
[0057] Repeat steps 2-5 above to attach subsequent amino acids, Glu, Ala, ..., to Lys. Calculate and weigh the subsequent amino acids using the above algorithm, while maintaining the same amount of activator TBTU / DIEA.
[0058] 7. Contraction
[0059] After the last amino acid connection is completed, repeat step 2, then wash with DCM 3 times, wash with methanol 3 times, drain, pour out the resin, dry it under a drying lamp and place it in a 500 mL beaker.
[0060] 8. Cutting
[0061] Add 100 mL of cutting solution (TFA / thioanisole / phenol / EDT / water = 86:5:4:3:2, volume ratio) to the beaker, place the beaker on a magnetic stirrer, place a magnet in the beaker, stir and react for 2 hours, then filter with a sand core funnel, rinse the resin in the sand core with TFA twice, pour the cutting solution into 600 mL of methyl ether, at this time the polypeptide precipitates to form a polypeptide methyl ether suspension, repeat the centrifugation-discard the supernatant-add methyl ether washing process, repeat 3 times and bake with a drying lamp to remove the residual methyl ether. The obtained solid is the crude target polypeptide.
[0062] 9. Purification and preparation
[0063] A small amount of crude peptide was collected using a capillary tube and added to 0.2 mL of a solution (acetonitrile:purified water = 1:2, volume ratio). The solution was thoroughly dissolved by ultrasonication. Analyze the sample on an analytical HPLC instrument and record the retention time of the sample on the analytical column. Based on the measured retention time, an appropriate purification gradient was set and the gradient was equilibrated on a preparative HPLC instrument. Approximately 6 g of crude peptide was fully dissolved. After filtration, the sample solution was pumped onto a preparative HPLC column for gradient elution. The purified peptide liquid was collected according to the retention time. The purified peptide liquid was then concentrated and freeze-dried to obtain a lyophilized peptide powder.
[0064] The small molecule active polypeptide KW13 synthesized by the present invention was analyzed by high performance liquid chromatography (HPLC) and the purity was above 98% ( Figure 1 ), and the structure was identified by MS ( Figure 2 ).
[0065] Example 2
[0066] Cytotoxic effect of active peptide KW13 on human immortalized epidermal cells Hacat
[0067] Collect the human immortalized epidermal cell suspension Hacat in the logarithmic growth phase and adjust the cell density to 2×10 5 / mL, and seeded into 96-well plates at a volume of 2mL / well. The cells were allowed to adhere overnight at 37°C and 5% CO2. After the cells adhered, the control group was cultured normally without drug treatment. The KW13-treated group was cultured with DMEM medium containing different concentrations of KW13 (100μM, 200μM and 400μM), and the paclitaxel (PTX)-treated group was cultured with DMEM medium containing 30nM paclitaxel. After 48h of cell culture, the cells were cultured using a kit (Progema, Luminescent Cell Viability Assay) to determine the number of viable cells, the specific operation is as follows: (1) The buffer and substrate in the kit are balanced to room temperature and mixed in proportion to prepare (2) After digestion, the cells were collected in a centrifuge tube, centrifuged at 350×g for 10 min, the supernatant was discarded, and the suspension was resuspended in DMEM medium to adjust the volume to 2×10 5 / mL; (3) Take a 96-well plate with opaque walls and add 100 μL of cell suspension to each well. Set up 3 replicates for each sample. Prepare a control well containing only culture medium without cells to measure the background luminescence value; (4) After the plate is equilibrated to room temperature, add 100 μL of (5) Oscillate the plate on an orbital shaker for 2 minutes to mix the contents. Incubate at room temperature for 10 minutes to allow the light signal to stabilize. Detect luminescence using a microplate reader. Cell viability (%) = (luminescence value of the well with a given concentration - background luminescence value) / (luminescence value of the control well - background luminescence value) × 100%.
[0068] The results of this example are shown in Figure 3 The cell viability of the paclitaxel (30nM) group was 38.4%, while that of the KW13 peptide groups treated with 100μM, 200μM, and 400μM doses was 89.9%, 81.9%, and 70.2%, respectively. At a concentration of 400μM, the KW13 peptide inhibited the proliferation of human immortalized epidermal Hacat cells by no more than 30%. Compared to paclitaxel (PTX), the KW13 peptide exhibited less toxicity to normal cells.
[0069] Example 3
[0070] 14-day (sub)acute toxicity study in mice by intraperitoneal injection - single administration at the maximum dose
[0071] Healthy C57BL / 6 mice (half male and half female, 5-6 weeks old) were selected and divided into a solvent control group and a KW13-treated group, with 10 mice in each group. A 5 mg / mL KW13 solution was prepared in sterile saline. The KW13-treated group received a single intraperitoneal injection of the active peptide KW13 solution at the maximum administered volume (1.5 mL) and the highest concentration (5 mg / mL), giving a dose of 375 mg / kg. The solvent control group received a single intraperitoneal injection of saline at the maximum administered volume (1.5 mL). Following administration, the mice were observed for 14 consecutive days. Specific observational parameters included general indicators (appearance, behavior, response to stimuli, secretions, excretions, etc.), mortality (time of death, pre-mortal reactions, etc.), and weight changes (weighed multiple times before dosing and during observation). All deaths, symptoms, and symptom onset, severity, and duration were recorded in detail. Surviving mice were weighed, sacrificed, and blood samples were collected and dissected. Blood samples were used for plasma recalcification assays. After blood collection, the mice were immediately dissected, and any changes in volume, color, texture, etc. of any tissue or organ were recorded in detail and subjected to histopathological examination.
[0072] The plasma recalcification test is a method for determining defects in the intrinsic coagulation system. The specific steps are as follows: the blood sample is anticoagulated with sodium citrate, centrifuged at 3500 rpm for 15 minutes at 4°C, and the plasma (supernatant) is removed for later use. 40 μL of mouse plasma is thoroughly mixed with 20 μL of HEPES buffer (10 mM Hepes, 150 mM NaCl, pH 7.4), incubated at 37°C for 10 minutes, and 40 μL of 37°C preheated CaCl2 solution (prepared in HEPES buffer) is added. The mixture is immediately mixed and the OD value is measured using a microplate reader. 650 Dynamics of place.
[0073] (Sub) acute toxicity experiment is an important part of toxicological research and can preliminarily evaluate the safety of drugs. The results of this embodiment are shown in Table 1 and Figure 4 During the 14-day observation period, there was no death in the mice, and their activities and diet were normal, and there was no abnormal weight gain. The results of the plasma recalcification test (Table 1) showed that there was no significant difference in the plasma recalcification time of the mice in the treatment group compared with the control group (P>0.05), indicating that the active polypeptide KW13 had no significant effect on endogenous coagulation function. After gross dissection of the surviving mice, no abnormalities in the heart, liver, spleen, lung, kidney, gastrointestinal tract, thymus and other visceral organs were found with the naked eye; after HE staining of the sections, no lesions in the heart, liver, spleen, lung, kidney, gastrointestinal tract, thymus and other visceral organs were found under microscopic examination ( Figure 4 The above results show that the active peptide KW13 has no toxic effects on mice at the maximum dosage, indicating that KW13 has good safety.
[0074] Table 1 Statistics of plasma recalcification time in acute toxicity test of intraperitoneal injection in mice
[0075]
[0076] Paclitaxel is a commonly used tumor chemotherapy drug in clinical practice. According to relevant data, in the acute toxicity test of a single intraperitoneal administration in mice for 24 hours, the median lethal dose (LD50) of paclitaxel was 50 ) was 128 mg / kg. In this example, in a 14-day (sub)acute toxicity study in mice, a single intraperitoneal injection of the peptide KW13 at the maximum dose of 375 mg / kg did not cause mortality in mice. In contrast, the acute toxicity of the active peptide KW13 is less than that of paclitaxel.
[0077] Example 4
[0078] 14-day (sub)acute toxicity study in mice by intraperitoneal injection - multiple doses
[0079] Healthy C57BL / 6 mice (female, 5-6 weeks old) were selected and divided into a solvent control group and a KW13-treated group, with 10 mice in each group. A 5 mg / mL active peptide KW13 solution was prepared using sterile saline as the solvent. The KW13-treated group received an intraperitoneal injection of the active peptide KW13 solution at a dose of 100 mg / kg; the solvent control group received an intraperitoneal injection of an equal volume of saline. The drug was administered once daily for 14 days, and the mice were continuously observed during the administration period. Specific observation indicators included general indicators (mouse appearance, behavior, response to stimuli, secretions, excretions, etc.), mouse mortality (time of death, pre-mortem reactions, etc.), and mouse weight changes (weighed multiple times before administration and during the observation period); all deaths, symptoms, and the time, severity, and duration of symptom onset were recorded in detail. At the same time, surviving mice were weighed, sacrificed, and blood was collected and dissected. Blood samples were used for plasma recalcification tests. After blood collection, the mice were immediately dissected, and any changes in volume, color, texture, etc. of any tissue or organ were recorded in detail and subjected to histopathological examination.
[0080] The results of this example are shown in Table 2 and Figure 5 During the 14-day administration period, there were no deaths in mice, and their activities and diets were normal, with no abnormal weight gain. The results of the plasma recalcification test (Table 2) showed that there was no significant difference in the plasma recalcification time of mice in the treatment group compared with the control group (P>0.05), indicating that the active polypeptide KW13 had no significant effect on endogenous coagulation function. After gross dissection of the surviving mice, no abnormalities in the heart, liver, spleen, lung, kidney, gastrointestinal tract, thymus and other visceral organs were found with the naked eye; after HE staining of the sections, no lesions in the heart, liver, spleen, lung, kidney, gastrointestinal tract, thymus and other visceral organs were found under microscopic examination ( Figure 5 The above results show that at a dose level of 100mg / kg / day, the active peptide KW13 did not cause toxicity to mice after continuous administration for 14 days, indicating that the active peptide KW13 has good safety.
[0081] Table 2 Statistics of plasma recalcification time in the dose-toxicity test of anti-melanoma activity in mice
[0082]
[0083] Example 5
[0084] In vivo anti-melanoma activity test in mice
[0085] Healthy C57BL / 6 mice (female, 5-6 weeks) were selected and divided into normal control group, melanoma model, positive drug control group, and active peptide KW13 treatment group (25 mg / kg, 50 mg / kg, 100 mg / kg), with 10 mice in each group. B16F10#2 cells (the basic construction process is: the luciferase gene (luc) is constructed into a plasmid by conventional molecular cloning, lentiviral transfection of B16F10 cells, and then stable cells are selected by resistance screening, and cell in vitro bioluminescence detection is performed) are genetically modified mouse melanoma cells carrying the luciferase gene. Except for the normal control, the mice in the other groups were intraperitoneally injected with 1×10 6 B16F10#2 cells were used to construct a mouse melanoma model. The positive drug control group was intraperitoneally injected with 30 mg / kg paclitaxel once every 2 days. The active peptide KW13 treatment group was intraperitoneally injected with peptide KW13 once a day. After 14 days of administration, the mice were fully anesthetized and intraperitoneally injected with 150 mg / kg of D-luciferin sodium salt solution (15 mg / mL). After 10 to 15 minutes, the luminescence signal was stabilized for in vivo imaging to detect the growth of melanoma in each group of mice. The luminescent area was automatically quantified using the ROI button of the software, and the luminescence intensity of the melanoma of each mouse was counted to calculate the melanoma inhibition rate. Calculation formula: Tumor inhibition rate (%) = (1-average luminescence intensity of mice in the treatment group / average luminescence intensity of mice in the melanoma model group) × 100%.
[0086] The results of this example are shown in Figure 6 .
[0087] Based on dosing settings and drug toxicity data from relevant literature, the paclitaxel dose in this example was set at 30 mg / kg, administered once every two days. At this dose, paclitaxel exhibited significant anti-melanoma activity, with a melanoma inhibition rate of 32.7% compared to the model group, demonstrating the successful establishment of the melanoma model in this example. The active peptide KW13 exhibited significant anti-melanoma activity (p < 0.05) at doses of 25 mg / kg / day, 50 mg / kg / day, and 100 mg / kg / day, with melanoma inhibition rates of 18.9%, 56.8%, and 72.2%, respectively.
[0088] Paclitaxel, a traditional chemotherapy drug, is prone to toxic side effects at clinically effective doses, such as bone marrow suppression, alopecia, neurotoxicity, and gastrointestinal reactions. A small number of patients also experience allergic reactions and cardiotoxic effects, such as increased heart rate, myocardial ischemia, and atrioventricular block, when taking paclitaxel. These effects can be life-threatening. The results of Example 4 show that after 14 days of continuous administration of the active peptide KW13 at a dose level of 100 mg / kg / day, no toxic effects were detected in mice. This indicates that at this dose, the therapeutically active dose in this example, the peptide KW13 exhibits minimal toxicity and a relatively good safety profile.
[0089] In summary, the peptide KW13 has good anti-melanoma activity, less acute toxicity than paclitaxel, and higher safety than paclitaxel at therapeutic doses.
[0090] In all the above examples, data were processed using Graphpad Prism 8 software, and the data were expressed as mean ± SD. The statistical analysis method was t-test (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
[0091] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. An anti-melanoma active polypeptide KW13, characterized in that: for: (1) An active polypeptide having an amino acid sequence as shown in SEQ ID NO: 1; or (2) a salt form of the active polypeptide described in item (1).
2. The nucleic acid molecule encoding the anti-melanoma active polypeptide KW13 according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 2 or SEQ ID NO:
3.
3. Use of the anti-melanoma active polypeptide KW13 according to claim 1 or the nucleic acid molecule according to claim 2 in the preparation of an anti-melanoma drug.
4. Use of the anti-melanoma active polypeptide KW13 according to claim 1 or the nucleic acid molecule according to claim 2 in the preparation of a drug for inhibiting melanoma proliferation.
5. An anti-melanoma drug, characterized in that: The active ingredient of the anti-melanoma drug includes the anti-melanoma active polypeptide KW13 according to claim 1.
6. The anti-melanoma drug according to claim 5, characterized in that The anti-melanoma drug further comprises pharmaceutically acceptable excipients.
7. The drug according to claim 6, characterized in that The auxiliary materials include one or more of solubilizers, cosolvents, suspending agents, emulsifiers, antibacterial agents, antioxidants, osmotic pressure regulators, pH regulators and fillers.
8. A pharmaceutical composition, characterized in that The invention comprises a preparation capable of killing tumor cells and / or a drug carrier capable of dispersing and transferring drugs into the body to exert biological functions and the anti-melanoma active polypeptide KW13 according to claim 1.
9. The pharmaceutical composition according to claim 8, characterized in that The preparation capable of killing tumor cells includes chemical drugs and / or biological drugs capable of killing tumor cells; the biological drugs include targeted drugs or nano drugs; the chemical drugs include radioactive drugs, photodynamic therapy drugs or nano drugs.
10. The pharmaceutical composition according to claim 8, characterized in that The drug carrier for dispersing the drug and transferring it into the body to exert biological functions includes any one of nanomaterials, liposomes, polyethylene glycol-modified compounds or oily compounds, or a mixture of multiple oily compounds.
Citation Information
Patent Citations
Anti-tumor polypeptide and application thereof
CN110483647A
Melanocyte modulating peptides
CN114245800A