Pasteurella multocida arcA gene and its application

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to an arcA gene of Pasteurella multocida and its application. The arcA gene of the Pasteurella multocida is numbered A0R64_00400, and the sequence of A0R64_00400 is shown in SEQ ID NO: 1. The present invention screened and obtained the arcA gene homolog of Pasteurella multocida for the first time, and found that its coding sequence has a high homology with ArcA of other bacteria, and constructed a strain by homologous recombination mediated by suicide plasmid, and confirmed that the deletion strain is highly attenuated on a duck model, confirming that A0R64_00400 is the arcA gene of Pasteurella multocida and also a virulence gene. The arcA and gatA double gene mutant strain constructed by the present invention is highly attenuated on ducks and has a certain level of colonization in vivo, and does not affect the production performance of ducks, and has the potential of attenuated live vaccine.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Pasteurella multocida arcA gene and an application thereof. Background Art

[0002] Pasteurella multocida is an important livestock and poultry pathogen belonging to the family Pasteurellaceae and the genus Pasteurella multocida. It has a wide host spectrum and can cause contact infectious diseases in a variety of animals such as ducks, chickens, cattle, and pigs. It manifests as fowl cholera in poultry. According to its lipopolysaccharide (LPS) outer core oligosaccharide gene cluster, it can be divided into 8 LPS types (L1-L8), and the L1 type is mostly the one that causes fowl cholera. At present, the commercial vaccine for preventing this disease is mainly an oil-emulsion inactivated vaccine, but it has defects such as large immune dose, obvious side effects, and weak cross-protection. Genetically engineered attenuated live vaccines have the advantages of clear genetic background, oral or nasal administration, induction of balanced immune response, and strong cross-protection, and are an ideal vaccine form.

[0003] Screening for appropriate virulence genes is a prerequisite for constructing genetically engineered live attenuated vaccines. After invading the body, bacteria will encounter a variety of extreme environments, such as oxidative stress, iron deficiency, hypoxia, and low acidity. Adapting to these changes is very important for bacterial survival. Studies have found that regulatory factors related to bacterial adaptation to extreme environments are often closely related to bacterial virulence. Studies based on Gram-negative bacteria such as Escherichia coli and Haemophilus influenzae have confirmed that the global regulatory factor ArcA (Aerobic respiratory control) plays an important role in the adaptation of aerobic and anaerobic environments and their conversion in a variety of bacteria, and has a certain influence on virulence in some bacteria; however, this gene and its function are still unknown in Pasteurella multocida. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a Pasteurella multocida arcA gene and its application.

[0005] The object of the present invention is achieved by the following technical solution: the arcA gene of Pasteurella multocida, the gene number of the arcA gene of Pasteurella multocida is A0R64_00400, and the sequence of A0R64_00400 is as follows:

[0006] ATGGGAACGCCACAAATTTTAATTGTTGAAGACGAAGCAATCACCAGAAATACCTTAAAAAGTATTTTTGAGGCGGAGGGTTATGAAGTATTTGAGGCGGCAGACGGCGCACAGATGCACCGTATTCTGTCTAATAAAGTGATTAATCTTGTCATTATGGATATCAACTTACCCGGT AAGAATGGACTCATGCTCGCCCGCGAACTACGAGAAACGACCAATACCGCATTAATGTTTTTAACTGGTCGCGATAATGAAGTGGATAAAATTCTTGGTCTAGAAATCGGTGCGGATGATTACATCACAAAACCATTCAATCCAAGAGAATTAACCATTCGTGCACGAAATTTATTAC AACGCACGATGCAAGAAAATAGTAAAGATAGCCATCATCCTATTGAGCAATATCGCTTTAATGGCTGGACACTAGACTTAAATAGCCGCACGTTAATTAATCCAGAAGGGGAAGAATAAACTTCCACGCAGTGAATTCCGTGCGATGTTACATTTCTGTGAAAACCCGGGCAAAAT TCAAACCCGTGAAGAATTATTGAAGAAAATGACGGGACGTGAATTAAAGCCACAAGATCGGACAGTAGATGTCACTATTCGTCGTATTCGTAAACATTTTGAAGATCATCCAGAAACCCCAGAGATTATCGCCACGATCCATGGTGAAGGTTATCGTTTCTGTGGTGAATTAGAATAA

[0007] The present invention screened the arcA gene homolog of Pasteurella multocida by the Blast method, and found that its coding sequence had high homology with ArcA of other bacteria. Then, the arcA gene deletion strain of Pasteurella multocida L1 strain was constructed by suicide plasmid-mediated homologous recombination method, and the deletion strain was confirmed to be highly attenuated in a duck model, indicating that arcA is the virulence gene of Pasteurella multocida.

[0008] The present invention also provides an application of the arcA gene for attenuating Pasteurella multocida.

[0009] Furthermore, the application method includes: constructing a Pasteurella multocida lacking the arcA gene by suicide plasmid-mediated homologous recombination.

[0010] Furthermore, the application method specifically includes:

[0011] S1, construction of suicide plasmid lacking arcA gene;

[0012] S2, transferring the suicide plasmid constructed in step S1 into competent Escherichia coli, and then performing conjugation transfer with Pasteurella multocida to screen positive colonies;

[0013] S3. Pasteurella multocida lacking the arcA gene was obtained by PCR screening.

[0014] Furthermore, in step S1, the method for constructing a suicide plasmid lacking the arcA gene comprises:

[0015] 1) According to the sequence information of Pasteurella multocida and plasmid, primers were designed to amplify the upstream and downstream homology arms of arcA, and the kanamycin resistance gene fragment between the homology arms, and the resistance gene fragment and the upstream and downstream homology arm fragments of the arcA gene had a 15±2 bp repetitive sequence, respectively;

[0016] 2) The arcA upstream and downstream homology arms were amplified using the whole genome of Pasteurella multocida as a template, and the kanamycin resistance gene was amplified using the plasmid as a template;

[0017] 3) using primers and a high-fidelity enzyme to perform PCR amplification on the product obtained by step 2) to obtain a fusion fragment;

[0018] 4) After the plasmid is digested with enzymes, it is ligated with the fusion fragment and transformed into competent E. coli cells. PCR identification is performed to obtain a suicide plasmid with a positive deletion of the arcA gene.

[0019] Furthermore, the primers involved in the suicide plasmid-mediated homologous recombination method are shown in SEQ ID NO: 2-SEQ ID NO: 13.

[0020] The deletion of two or more virulence genes can significantly reduce the probability of mutant strains returning to strong virulence, ensure the safety of vaccine strains, and is an effective strategy for constructing genetically engineered attenuated live vaccines. Previous studies have confirmed that the L1 type Pasteurella multocida LPS outer core oligosaccharide is a virulence factor of Pasteurella multocida, and the deletion of its synthesis-related glycosyltransferase hptE or gatA can reduce the virulence of bacteria in chickens; however, since the relevant mutant strains are constructed by a single cross-insertion method, the strains are converted into wild-type revertants in vivo. The present invention constructs a stable gatA mutant strain by suicide plasmid-mediated homologous recombination, and confirms that it is highly attenuated in ducks.

[0021] The invention constructs an arcA and gatA double gene mutant (ΔgatAΔarcA) on the wild strain PM0818 of Pasteurella multocida, detects its virulence and immune protection potential in ducks, and confirms that the mutant has high safety and provides good immune protection efficacy against strong strains of Pasteurella multocida.

[0022] The method comprises: constructing a Pasteurella multocida lacking arcA gene and gatA gene by suicide plasmid-mediated homologous recombination method.

[0023] Furthermore, when constructing a suicide plasmid lacking the arcA gene and the gatA gene by the suicide plasmid-mediated homologous recombination method, primers need to be designed to amplify the upstream and downstream homologous arms of the arcA gene and the gatA gene, respectively, and to amplify the kanamycin resistance gene and the erythromycin resistance gene fragments between the homologous arms; the primers involved are shown in SEQ ID NO: 14-SEQ ID NO: 35.

[0024] The present invention also provides the Pasteurella multocida lacking the arcA gene or the Pasteurella multocida lacking the arcA gene and the gatA gene.

[0025] The present invention also provides a use of the above-mentioned Pasteurella multocida lacking arcA gene or the above-mentioned Pasteurella multocida lacking arcA gene and gatA gene as a live attenuated vaccine for poultry.

[0026] The principle involved in the present invention is that screening suitable virulence genes and constructing stable Pasteurella multocida gene-deficient strains are the key to developing genetically engineered attenuated live vaccines. Based on the existing advanced gene mutation technology, the present invention is based on the wild strain PM0818 of duck-derived Pasteurella multocida, and takes the suicide plasmid-mediated homologous recombination method as the technical basis. First, a homologous arm fragment with a resistance gene is constructed, and then the fusion fragment is connected to the suicide plasmid pRE112. The recombinant plasmid is introduced into Pasteurella multocida by conjugation transfer, and the gene to be deleted is replaced with a resistance gene by homologous recombination of the fragment, thereby constructing a gene-deficient vaccine strain. The present invention screened the arcA gene of Pasteurella multocida for the first time, and confirmed that the gene is a virulence gene by constructing a mutant strain. In order to ensure the safety of the mutant strain as an attenuated vaccine strain, the present invention also lacks the LPS outer core oligosaccharide glycosyltransferase gene gatA, and completes the construction of the double gene mutant strain ΔgatAΔarcA. Through the immune protection test on ducks, it was confirmed that the gene-deficient strain of Pasteurella multocida ΔgatAΔarcA has high safety and can be used to prevent infection of Pasteurella multocida in ducks. The present invention provides a new strategy for the development of attenuated live vaccines for Pasteurella multocida or other bacteria, and lays a theoretical foundation for the further development of attenuated live vaccines based on regulatory factors and lipopolysaccharide.

[0027] The beneficial effects of the present invention are:

[0028] 1. The present invention screened and obtained the arcA gene homolog of Pasteurella multocida for the first time, and found that its coding sequence had high homology with ArcA of other bacteria. The strain was constructed by suicide plasmid-mediated homologous recombination method, and the deletion strain was confirmed to be highly attenuated in a duck model, confirming that A0R64_00400 is the arcA gene of Pasteurella multocida.

[0029] 2. The arcA and gatA double gene mutant strain constructed by the present invention is highly attenuated in ducks and has a certain level of in vivo colonization, and has the potential of attenuated live vaccine. Oral immunization of the mutant strain does not affect the production performance of the duck flock, and can provide immune protection against a lethal dose of Pasteurella multocida. The present invention provides a new strategy for the development of attenuated live vaccines for Pasteurella multocida or other bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Amino acid sequence alignment of ArcA homologs of Pasteurella multocida and other bacteria;

[0031] Figure 2 Lane 1 is the amplification product of the arcA gene upstream homology arm; Lane 2 is the amplification product of the resistance gene; Lane 3 is the amplification product of the arcA gene downstream homology arm;

[0032] Figure 3 is the fusion of fragments; Lane M is the DL4500 DNA marker, and Lane 1 is the fusion fragment;

[0033] Figure 4 For identification of arcA gene deletion strains; Lane M is DL15000 marker, Lanes 1 and 2 are for amplification of kanamycin resistance gene, Lanes 3 and 4 are for amplification of arcA gene, Lanes 5 and 6 are for amplification of upstream homologous arms of arcA gene and part of kanamycin resistance gene, Lanes 7 and 8 are for amplification of downstream homologous arms of arcA gene and part of kanamycin resistance gene;

[0034] Figure 5 The lane 1 is the amplification product of the upstream homology arm of the gatA gene, the lane 2 is the amplification product of the downstream homology arm of the gatA gene, and the lane 3 is the amplification product of the kanamycin resistance gene.

[0035] Figure 6 is the fusion of fragments; Lane M is the DL4500 DNA marker, and Lane 1 is the fusion fragment;

[0036] Figure 7 PCR identification of ΔgatAΔarcA mutants and complemented strains of Pasteurella multocida; Lane M is DL2000 DNA marker, Lanes 1, 2, 3, and 4 are amplified products of gatA gene; Lanes 5 and 6 are amplified products of arcA gene; Lanes 7, 8, and 9 are amplified products of upstream homologous arms of gatA gene and part of kanamycin resistance gene; Lanes 10, 11, and 12 are amplified products of downstream homologous arms of gatA gene and part of kanamycin resistance gene; Lanes 13 and 14 are amplified products of upstream homologous arms of arcA gene and part of erythromycin resistance gene; Lanes 15 and 16 are amplified products of downstream homologous arms of arcA gene and part of erythromycin resistance gene; Lanes 17 and 18 are amplified products of kanamycin resistance gene; Lanes 19 and 20 are amplified products of erythromycin resistance gene;

[0037] Figure 8 To monitor the body temperature of ducks;

[0038] Fig. 9 To monitor the weight of ducks;

[0039] Fig.10 To evaluate the immune protection of the ΔgatAΔarcA vaccine strain and detect the bacterial clearance effect. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings, but the protection scope of the present invention is not limited to the following.

[0041] Example 1 Screening and homology analysis of arcA gene of Pasteurella multocida

[0042] The arcA gene sequences of known Escherichia coli (E. coli MG1655), Salmonella Typhimurium UK-1, and Haemophilus influenzae (H. influenzae 65290_NP_Hi3) were compared with the genome of Pasteurella multocida strain PM0818 (P. multocida strain DY120818, genome accession number LUCZ01000000) using the Blast tool on the NCBI website, and a highly homologous gene A0R64_00400 with a full length of 711 bp was screened out. Its coding sequence has 88%, 88% and 79.24% similarity with ArcA protein sequences in E.coli MG1655 (gene number: D8B36_RS19230), Salmonella Typhimurium UK-1 (gene number: STMUK_4585) and H.influenzae 65290_NP_Hi3 (gene number: FA898_RS00885), respectively. Therefore, A0R64_00400 is the arcA gene of Pasteurella multocida.

[0043] Example 2 Construction of arcA deletion strain of Pasteurella multocida

[0044] 2.1 Primer design

[0045] According to the PM0818 (P.multocida strain DY120818, genome accession number LUCZ01000000) genome sequence and plasmid pCZ4 sequence published by NCBI, two pairs of primers arcA-up-F / R and arcA-down-F / R were designed to amplify the upstream and downstream homology arms of arcA, respectively, and arcA-kan-F / R was used to amplify the kanamycin resistance gene fragment between the homology arms. The resistance gene fragment and the upstream and downstream homology arm fragments of the arcA gene have a repeat sequence of about 15 bp. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the specific primer names and sequences are shown in Table 1 below.

[0046] Table 1 Primers for constructing ΔarcA mutant strains

[0047]

[0048] 2.2 Amplification and fusion of the upstream and downstream homologous arms of the arcA gene and the kanamycin resistance gene

[0049] The arcA upstream and downstream homology arms were amplified using the PM0818 whole genome as a template, and the kanamycin resistance gene was amplified using plasmid pCZ4 as a template. Amplification system and procedure: template DNA (bacterial genome) 1 μL, 2× PrimeSTARMax (Takara Biotech Co., Ltd.) 30 μL, upstream primer 2 μL, upstream primer 2 μL, ddH 2 O 25μL. Amplification conditions: 98℃ denaturation for 2min followed by cycling, cycle parameters: 98℃ 10s, 55℃ 15s, 72℃ 10s. After 30 cycles, 72℃ extension for 5min. The amplified PCR products were analyzed by 1% agarose gel electrophoresis. Figure 2 The sizes of the three amplified fragments were consistent with the expected sizes.

[0050] The amplified fragments were analyzed by agarose gel electrophoresis and then purified and recovered by a kit. The concentration of the purified and recovered arcA gene upstream and downstream homologous arms and kanamycin resistance gene fragments was measured by Nanodrop 2000, and they were fused at a ratio of 1:1:1 according to the length and concentration of the fragments. PCR amplification was performed using 2 μL of the fusion fragment as a template, and then PCR amplification was performed using primers arcA-up-F / arcA-down-R and LA Taq enzyme. The amplification conditions were: denaturation at 94°C for 5 minutes before entering the cycle, and the cycle parameters were 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute. After 30 cycles, extension was performed at 72°C for 5 minutes. The results are as follows: Figure 3 The amplified fragments were analyzed by agarose gel electrophoresis and recovered using a kit.

[0051] 2.3 Ligation of fusion fragment and suicide plasmid pRE112

[0052] 1) Enzyme digestion of suicide plasmid pRE112: + ) plate to revive E. coli DH5αλpir containing suicide plasmid pRE112, and take a single colony in 200 mL LB (Cm + ) The cells were cultured in liquid medium at 37°C in a shaker for 12 h, and the plasmids were extracted using a plasmid extraction kit. The concentration was determined by Nanodrop 2000 and then digested with enzymes.

[0053] 2) Ligation of plasmid and fragment: The enzyme digestion system was placed in a 37°C metal bath for 3 h and then recovered using a DNA purification recovery kit. The concentration was determined by Nanodrop 2000. After the concentration and size of the plasmid and fragment were determined, they were placed in a 16°C metal bath for 18 h according to the proportion. The ligation system was 8 μL of enzyme digestion product + fusion fragment, 1 μL of T4 ligase, and 1 μL of T4 buffer.

[0054] 2.4 Preparation of competent E. coli

[0055] In LB (Cm + ) plates and resuscitated E. coli DH5α and DH5αλpir and picked a single colony to inoculate in 5 mL LB (Cm + ) The liquid medium was cultured at 37°C in a shaking incubator for 12 h, then inoculated into 100 mL LB liquid medium at a ratio of 1:100 and cultured at 37°C in a shaking incubator until OD 600 =0.6~0.8; dispense the bacterial solution into 50mL centrifuge tubes and place in an ice bath for 10min; centrifuge at 4℃, 5000r / min for 10min, and discard the supernatant; add 20mL CaCl 2 Resuspend the cells in 0.1 mol / L solution and place on ice for 10 min; centrifuge at 5000 rpm for 10 min at 4°C and discard the supernatant; add 800 μL CaCl 2 Resuspend the cells in 0.1 mol / L solution and let stand at 4°C overnight. The next day, add 15% sterile glycerol, mix well and dispense into 100 μL tubes, and store at -80°C.

[0056] 2.5 Transformation and identification of ligation systems

[0057] Take out DH5αλpir competent cells from -80℃ refrigerator, add 10μL ligation product and ice bath for 20min; heat shock in 42℃ metal bath for 90s, ice bath for 2min; add 200μL LB liquid culture medium, culture in 37℃ constant temperature shaker for 2-3h; take 100μL bacterial solution and spread on LB (Cm + , Kan: 50 μg / mL) plates and cultured in a 37°C constant temperature incubator for 24 hours; the colonies on the resistance plates were expanded and cultured and then PCR amplified and identified using the amplification primers arcA-up-F and arcA-down-R.

[0058] After agarose gel electrophoresis analysis, the plasmid of the positive colony was extracted with a plasmid extraction kit, and the primers arcA-up-F and arcA-down-R were used for amplification. The amplified product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The correctly sequenced plasmid was transformed into E. coli SM10λpir competent cells, and the cultured colonies were then amplified by PCR identification, and the identification primers were arcA-up-F and arcA-down-R. The colonies with positive identification results were expanded and named pRE112-arcA-kan.

[0059] 2.6 Conjugative transfer and identification of arcA gene deletion strains

[0060] 1) Conjugation transfer: Resuscitate the recipient bacteria PM0818 and the donor bacteria pRE112-arcA-kan, pick a single colony and culture it in 5 mL BHI or LB (DAP: 50 μg / mL) liquid medium at 37°C with shaking for 12 h, then expand the culture to BHI or LB (DAP: 50 μg / mL) liquid medium at a ratio of 1:100 and culture it in 37°C with shaking until OD 600 = 0.6-0.8. Mix the recipient bacteria and donor bacteria in proportion to a total volume of 5 mL. Add 5 mL of MgSO 4 (0.1 mol / L) was added to a sterilized 50 mL centrifuge tube and filtered with a sterile syringe and a sterile filter (containing a filter membrane). The filtered filter membrane was attached to a TSA (DAP: 50 μg / mL) plate and cultured at 37 °C for 12 h. Then, 10 mL of MgSO 4 After washing the filter membrane (0.1 mol / L), 100 μL of bacterial solution was aspirated and spread on a BHI (Kan: 50 μg / mL) plate and cultured at 37°C for 24 h.

[0061] 2) Identification of arcA gene-deficient strains: Pick a single colony from the above plate and expand it for PCR amplification and identification. The identification primers are arcA-F / R, arcA-up-kan-F / R, arcA-down-F / R and kan-F / R. The identification results are as follows: Figure 4 .

[0062] Example 3 Construction of Pasteurella multocida gatA deletion strain and gatA, arcA double-deficient strain

[0063] 3.1 Primer design

[0064] According to the genome sequences of PM0818 and plasmid pCZ4 published by NCBI, a pair of primers gatA-up-F / R and gatA-down-F / R were designed to amplify the upstream and downstream homology arms of gatA, a pair of primers arcA-up-F / R and arcA-down-F / R were designed to amplify the upstream and downstream homology arms of arcA, and another pair of primers gatA-kan-F / R and arcA-erm-F / R were designed to amplify the inserted kanamycin and erythromycin resistance genes. The upstream and downstream homology arm fragments of the resistance gene and the target gene are respectively about 15bp repeat sequences, which are used for Overlap-PCR to fuse the upstream gene, resistance fragment and downstream fragment. The resistance gene primers are kan-F / R and erm-F / R. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are shown in Table 2:

[0065] Table 2. Primers required for constructing ΔgatAΔarcA mutants

[0066]

[0067]

[0068] 3.2 Amplification and fusion of upstream and downstream homology arms of gatA and arcA genes and kanamycin and erythromycin resistance genes

[0069] 1) Pick a single colony of PM0818 and culture it in 5 mL LB liquid medium overnight (37°C 180 rpm / min), and use the bacterial genome extraction kit of Tiangen Biochemical Technology Co., Ltd. to extract the genome according to the operating steps in the instruction manual.

[0070] 2) Amplification of upstream and downstream homology arms, kan, and erm resistance gene fragments: PCR amplification was performed in a 60 μL system, and the reaction system was as follows: template DNA (bacterial genome) 1 μL, 2× PrimeSTARMax (Takara Biotech Co., Ltd.) 30 μL, upstream primer 2 μL, upstream primer 2 μL, ddH 2 O 25μL. Amplification conditions: 98℃ denaturation for 2min followed by cycling, cycle parameters: 98℃ 10s, 55℃ 15s, 72℃ 10s. After 30 cycles, 72℃ extension for 5min. The amplified PCR products were analyzed by 1% agarose gel electrophoresis. The upstream homology arm of gatA was about 500bp (lane 1), the downstream homology arm of gatA was about 500bp (lane 2), and the kanamycin resistance gene was about 800bp (lane 3), which was consistent with the expected size. The results are as follows Figure 5 shown.

[0071] 3) Fusion of the upstream and downstream homologous arms with the kan and erm resistance gene fragments, respectively: The upstream and downstream homologous arms were mixed with the kan and erm resistance fragments in a molar ratio of 1:1:1, 2 μL was taken as a template, and then PCR amplification was performed using primers gatA-up-F / gatA-down-R and LATaq enzyme. The 3' end of the obtained fusion fragment was attached with an "A" base. The amplification conditions were: denaturation at 94°C for 5 minutes and then entering the cycle. The cycle parameters were 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute. After 30 cycles, extension was performed at 72°C for 5 minutes. The fusion fragment was approximately 1800 bp (lane 1), which was consistent with the expected size. The results are as follows: Figure 6 shown.

[0072] 3.3 Construction of pRE112-ΔgatA and pRE112-ΔarcA suicide plasmids

[0073] 1) Enzyme digestion of suicide plasmid pRE112: pRE112 plasmid was digested with AhdI enzyme to remove the sticky ends with "T" base, and the plasmid was recovered.

[0074] 2) Ligation: Use T4 DNA ligase to connect the digested pRE112 plasmid and the fusion fragment at 16°C overnight. Transfer the ligation product into SM10λpir and amplify the primers gatA-up-F, gatA-down-R, arcA-up-F, arcA-down-R to obtain the positive recombinant suicide plasmids pRE112-gatA and pRE112-arcA. After the plasmids were extracted, they were sent to Shanghai Biotech Co., Ltd. for sequencing and identification.

[0075] 3.4 Construction and identification of ΔgatA and ΔgatAΔarcA mutants

[0076] 1) Construction process: The correctness of the sequence was verified by sequencing, and the plasmid with the correct sequence was named pRE112-gatA. The recombinant plasmid in the donor bacterium SM10λpir was then introduced into the recipient bacterium PM0818 by conjugation transfer. Finally, the correct gatA gene deletion strain was identified through kanamycin resistance screening and PCR amplification.

[0077] The recombinant plasmid pRE112-arcA-erm in the donor bacterium SM10λpir was introduced into the recipient bacterium PM0818ΔgatA through conjugation transfer, and the correct gatA and arcA double gene deletion strain was identified through kanamycin and erythromycin resistance screening and PCR amplification.

[0078] 2) PCR identification: For the identification of gatA gene-deficient strains, use the amplification primers of the kanamycin resistance gene to identify the kanamycin resistance gene fragment, and use the amplification primers from the upstream or downstream homologous arms of the gatA gene to the kanamycin resistance gene to verify that the resistance gene fragment successfully replaces the target gene. Figure 7 As shown, no gatA gene fragment was amplified in PM0818ΔgatA (lane 2), but the kanamycin resistance gene band (lane 18), upstream or downstream homologous arms and part of the kanamycin resistance gene fragment (lanes 8 and 11) were amplified, indicating that the gatA gene was successfully deleted. The same method was used to identify the gatA and arcA double gene deletion strains (lanes 6, 19, 14, 16).

[0079] Experimental Example 1 Virulence of vaccine strains (median lethal dose, LD 50 ) determination

[0080] Sichuan ducks were used as animal models to determine the LD of PM0818, PM0818ΔarcA, PM0818ΔgatA and PM0818ΔgatAΔarcA in seven-day-old ducks by oral and intramuscular injection. 50 , through LD 50Results The virulence of the gene-deficient strain and the wild-type strain was compared, and the results are shown in Tables 3 and 4. After intramuscular infection, the LD of PM0818ΔarcA 50 About 10 higher than PM0818 4 times, LD between PM0818ΔgatA and PM0818ΔgatAΔarcA 50 About 10 higher than PM0818 7 times. The LD of PM0818ΔarcA, PM0818ΔgatA and PM0818ΔgatAΔarcA after oral infection 50 They are about 10 times taller than wild plants. 3 times.

[0081] In summary, after the deletion of gatA and arcA genes, the virulence of PM0818 to ducks was reduced by at least 10 3 times, indicating that gatA and arcA are both virulence genes of Pasteurella multocida. Therefore, the vaccine strain constructed by the present invention can be used for immune protection evaluation.

[0082] Table 3 LD of duck challenged by intramuscular injection 50 Determination of

[0083]

[0084]

[0085] Table 4 LD of ducks challenged by oral route 50 Determination of

[0086]

[0087] Experimental Example 2 Safety Testing of Pasteurella multocida Vaccine Strain

[0088] 10 mg / kg was injected intramuscularly 5 CFU, 10 6 CFU, 10 7 CFU and 10 8 Seven-day-old ducks were immunized with CFU of PM0818ΔgatAΔarcA, and their body temperature and weight were measured for 14 consecutive days. An environmental control group was also set up to record the health status of the ducks.

[0089] (1) Changes in duck body temperature

[0090] Temperature monitoring results Figure 8 As shown, PM0818ΔgatAΔarcA was infected with 5 The body temperature of the CFU group was relatively stable. 6 The body temperature of the CFU group increased slightly only on the 8th day. 7The body temperature of the CFU group increased from 6 to 8 days, and the duck joints were slightly swollen. 8 The body temperature of the CFU group was always higher than that of the environmental control group, and the ducks' foot joints were severely swollen and listless during the monitoring process.

[0091] (2) Changes in duck weight

[0092] Body weight monitoring showed that the body weight of ducks immunized with different doses of PM0818ΔgatAΔarcA was similar to that of the environmental control group at each time point, with the body weight increasing from 0.4 kg to 0.6 kg. Fig. 9 The results of temperature and weight monitoring showed that the double gene deletion strain had no effect on the weight gain of ducks at each immunization dose, but 7 , 10 8 The immunization dose of CFU caused the ducklings to have a long-term fever. 6 CFU only causes short-term fever, 10 5 CFU did not induce fever. Therefore, PM0818ΔgatAΔarcA was expressed in the muscle, 10 6 Doses of CFU and below are safer.

[0093] Experimental Example 3 Determination of the immune protection effect of the ΔgatAΔarcA vaccine strain

[0094] 1) Determination of immune protection efficacy: 140 one-day-old ducks purchased from the hatchery were randomly divided into two groups, the immunization group and the control group. The immunization group was divided into oral immunization and intramuscular immunization, with 40 ducks in each group. The control group was divided into a PBS control group and an environmental control group, with 40 ducks in the PBS control group and 20 ducks in the environmental control group. The ducks were allowed to adapt to the environment for one week. 6 Ducklings were inoculated with CFU of ΔgatAΔarcA intramuscularly, and the same dose and route were used for booster immunization 14 days later. 8 The CFU dose was immunized orally, and a PBS control group was set up at the same time. After 14 days, the same dose and route were used for booster immunization. Two weeks after the second immunization, 100 times the LD 50 The PM0818 was challenged with the poison, and the mortality of ducklings in each group after the challenge was recorded. The specific situation is as follows Fig.10 As shown in B. Oral or intramuscular booster immunization of PM0818ΔgatAΔarcA can eliminate PM0818 in ducks and provide 50% and 65% immune protection, respectively. This indicates that the attenuated strain ΔgatAΔarcA we constructed can be used to prevent avian Pasteurella multocida infection.

[0095] 2) Bacteria clearance effect detection: According to the immunization procedure in 1), 12 hours after the virus attack, randomly select ducklings in each group and kill them by air injection, and collect heart blood, liver, spleen, and lungs in turn. Put the above tissues into a disposable sterile sampling bag, add an appropriate amount of PBS to grind, dilute the grinding solution 10 times and 100 times, and then drop it on the plate, and place the plate in a 37°C incubator for overnight incubation. The next day, count the number of colonies on the plate, calculate the number of bacteria per gram of tissue, and process the data using GraphPadPrism5 software. The results are as follows: Fig.10 As shown in A, compared with the PBS control group, the bacterial clearance effect of the two ΔgatAΔarcA immunization groups was significant, which is consistent with the results of the immune protection test.

[0096] In summary, the immune protection experiment of ducklings confirmed that the ΔgatAΔarcA constructed by the present invention can be used to prevent infection with avian Pasteurella multocida. It also confirmed that the deletion of virulence factor-related genes is an ideal strategy for constructing a Pasteurella multocida vaccine strain, which also laid the foundation for the development of a new Pasteurella vaccine.

[0097] The above is only a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the form disclosed herein, and should not be regarded as excluding other embodiments, but can be used in various other combinations, modifications and environments, and can be modified within the scope of the concept described herein through the above teachings or the technology or knowledge of the relevant field. The changes and modifications made by those skilled in the art shall not deviate from the spirit and scope of the present invention, and shall be within the scope of protection of the claims attached to the present invention.

Claims

1. Deficiency of Pasteurella multocida arcA The use of a gene in preparing an attenuated strain of Pasteurella multocida is characterized in that: The Pasteurella multocida arcA The sequence of the gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The method of application includes: constructing a deletion by suicide plasmid-mediated homologous recombination arcA Gene of Pasteurella multocida.

3. The use according to claim 2, characterized in that: The application method specifically includes: S1. Missing build arcA Gene suicide plasmid; S2, transferring the suicide plasmid constructed in step S1 into competent Escherichia coli, and then performing conjugation transfer with Pasteurella multocida to screen positive colonies; S3, deletions detected by PCR screening arcA Gene of Pasteurella multocida.

4. The use according to claim 3, characterized in that: In step S1, the construction is missing arcA Gene suicide plasmid methods include: 1) According to the sequence information of Pasteurella multocida and plasmid, primers were designed to amplify arcA The upstream and downstream homology arms of the gene, as well as the kanamycin resistance gene fragment between the homology arms, the resistance gene fragment and arcA The upstream and downstream homology arm fragments of the gene each have 15 ± 2 bp of repeated sequences; 2) Amplification using the whole genome of Pasteurella multocida as template arcA The upstream and downstream homology arms of the gene were used to amplify the kanamycin resistance gene using the plasmid as a template; 3) The product obtained by step 2) is amplified by PCR using primers and a high-fidelity enzyme to obtain a fusion fragment; 4) After the plasmid is digested, it is connected with the fusion fragment and transformed into E. coli competent cells. PCR identification is performed to obtain positive deletions arcA Suicide plasmids of genes.

5. The use according to claim 4, characterized in that: The primers involved in the suicide plasmid-mediated homologous recombination method are shown in SEQ ID NO: 2-SEQ ID NO:

13.

6. The deletion obtained by the application of any one of claims 2 to 5 arcA Gene of Pasteurella multocida.

7. The deletion according to claim 6 arcA Application of the gene of Pasteurella multocida in the preparation of live attenuated Pasteurella multocida vaccine for poultry.

Images