A method for visual detection of Helicobacter pylori

Abstract

The present invention discloses a method for detecting Helicobacter pylori pathogens based on visualization, isothermal, and signal-on of trident neck ring structure DNA and CRISPR / Cas12a system, and belongs to the field of nucleic acid detection technology. The present invention uses Helicobacter pylori pathogens as a template, and after extraction and recombinase polymerase amplification, the nucleic acid is incubated with the CRISPR / Cas12a system and trident neck ring structure DNA as a reporter probe, and finally reacts with hemin and a color developer, and is detected with the naked eye or by ultraviolet visible absorption spectrum. It realizes simple, rapid, sensitive, specific and accurate detection of Helicobacter pylori, does not require complicated operation steps and instruments and equipment, and has very good application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and in particular relates to a method for visual isothermal detection of Helicobacter pylori pathogens based on a CRISPR / Cas12a system. Background Art

[0002] The analysis of the concentration of specific sequences of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) has far-reaching significance in many fields such as early diagnosis of pathogen infection, environmental testing, food inspection, epidemiological research, public health, etc. Compared with antibody testing and antigen testing, nucleic acid testing has the advantages of high sensitivity, strong specificity, and early detection of pathogen infection. Nucleic acid testing provides medical test evidence for the diagnosis of infection with the new coronavirus SARS-CoV-2, which wins the best treatment time for infected people and greatly reduces the mortality rate of the population.

[0003] Helicobacter pylori (Hp) is a spiral, multiflagellated, slightly anaerobic, Gram-negative, helical bacterium that is the main cause of gastroduodenal diseases such as peptic ulcers, gastritis, and gastric cancer in humans. H.pylori can be widely colonized in the human stomach and has the ability to survive for a long time. In many countries, H.pylori infection is one of the most common and persistent bacterial infections. Sensitive, rapid, simple, and accurate detection of Hp is of great significance for the diagnosis, prognosis, treatment monitoring, epidemiological research, and on-site instant testing of Hp infection.

[0004] In recent years, the CRISPR (cluster regularly interspace short palindromic repeats) system has developed rapidly. The CRISPR system is not only widely used in gene editing, but the incidental cleavage activity of the Cas protein family (CRISPR-associated proteins) has also made it stand out in the analysis of nucleic acids of pathogenic microorganisms. Among them, DETECTR is a nucleic acid detection method based on Cas12a. After the target DNA sequence binds to CRISPR / Cas, Cas12a is activated, and the fluorescent reporter probe DNA is cut to restore the fluorescence of the reporter probe (JP Broughton, XD Eng, GX Yu, CLFasching, V. Servellita, J. Singh, X. Miao, JAS Treithorst, A. Granados, A. Sotomayor-Gonzalez, K. Zorn, A. Gopez, E. Hsu, W. Gu, S. Miller, CY Pan, H. Guevara, D. A. Wadford, J. S Chen, CY Chiu, CRISPR-Cas12-based detection of SARS-CoV-2, Nat. Biotechnol. 38 (2020) 870-874; J. S Chen, E. Ma, LB Harrington, M. Da Costa, X. R Tian, ​​J. M Paleofsky, J. A Doudna, CRISPR-Cas12a target binding unleashes in discriminate single-stranded DNase activity, Science 360 ​​(2018) 436-439.). The molecular diagnostic technology combining CRISPR with nucleic acid isothermal amplification technology not only has aM-level sensitivity, but also shows very high single-base specificity, and the total detection time is greatly shortened compared with the traditional fluorescent quantitative PCR method (VS Javalkote, N. Kancharla, B. Bhadra, M. Shukla, B. Soni, A. Sapre, M. Goodin, A. Bandyopadhyay, S. Dasgupta, CRISPR-based assays for rapid detection of SARS-CoV-2, Methods 203 (2020) 594-603.).However, the use of fluorescent reporter probe materials is expensive and requires instruments to detect fluorescent signals. The lateral flow test paper technology combined with it not only fails to provide quantitative detection results but also has low sensitivity.

[0005] In order to improve the sensitivity and convenience of pathogen nucleic acid detection, a trident-necked ring structure DNA, or Y-shaped bulge DNA, was assembled based on the G-quadruplex sequence as an assembly unit, and used as a reporter probe to detect nucleic acids using the CRISPR / Cas12a system. There are currently no reports on the realization of visual isothermal detection of pathogens. Summary of the invention

[0006] The object of the present invention is to provide a signal-on type visual isothermal detection method for sensitive, simple and accurate detection of protozoan nucleic acid based on the CRISPR / Cas12a system, which is particularly suitable for visual isothermal detection of Helicobacter pylori disease.

[0007] To achieve the purpose of the present invention, Helicobacter pylori is used as a pathogen template, and a G-quadruplex sequence is used as an assembly unit to assemble a trident neck ring structure DNA (or Y-shaped bulge DNA) assembly, which is used as a reporter probe to perform visual detection of the pathogen using the naked eye based on the CRISPR / Cas12a system.

[0008] After nucleic acid extraction and recombinase polymerase amplification (RPA), the Helicobacter pylori sample is incubated with the CRISPR / Cas12a reaction system and the three-pronged neck ring structure DNA reporter probe, and finally detected with the naked eye or by UV-visible absorption spectroscopy in the presence of hemin, H2O2, and a color developer. After the CRISPR / Cas12a reaction system binds to the target DNA sequence, Cas12a is activated, cutting the circular DNA region of the three-pronged neck ring structure DNA reporter probe, causing the DNA assembly to dissociate and release the G-quadruplex sequence, which then binds to Hemin to exert its peroxidase-like activity and catalyze the oxidation of the substrate (i.e., the color developer) to develop color.

[0009] The specific technical solutions are as follows:

[0010] I. Sample processing and isothermal nucleic acid amplification

[0011] The collected Helicobacter pylori samples were treated with a rapid nucleic acid release agent, or treated with DNA extraction methods such as DNA extraction kit method, water boiling method, Chelex-100 method, phenol chloroform method, etc. to release and extract the whole genome DNA. Then, the Helicobacter pylori genomic DNA was used as a template, and the specific conserved sequence of the Helicobacter pylori UreB gene obtained by bioinformatics comparison was:

[0012] 5'-TGTCAATACCACCAGCAGTTACGATCAAACCTTCACCGGCTAAGGCTTCAGTAGCAG GACCCACGCTAAGATTGTTTTTAACGCCATCTTGCATGTCTTTGTTACCGCCTTTACCAAT GCCAGCGATTTTGCCATCTTTAATACCAATATCCGCTTTATAAATACCGGTGTAATCCACG ATTAAAGCG-3' was used as the target DNA sequence (tDNA), and recombinase polymerase amplification (RPA) upstream primer and downstream primer, ddH2O, recombinase, single-stranded DNA binding protein, strand displacement DNA polymerase, and buffer solution were added to the reaction system, and the reaction was incubated at 37°C for 10 to 60 minutes to obtain the RPA amplification product of Helicobacter pylori DNA.

[0013] II. Design and assembly of the trident-necked DNA reporter probe

[0014] The present invention is based on the CRISPR / Cas12a system, and designs and assembles a trifurcated neck-loop structure DNA reporter probe with a G-quadruplex sequence as an assembly unit. The basic principles of design include: (1) the DNA assembly is composed of three single-stranded DNAs, one of which (sequence a) is a single-stranded DNA sequence that can form a G-quadruplex: GGGTAGGGCGGGTTGGG; (2) the other two single-stranded DNAs (sequence b and sequence c) each contain a DNA sequence complementary to sequence a, sequence b is 15-30 bases long and has the following DNA sequence: 5'-CCCAACCCX...X-3', X represents any base, and sequence c is 13-23 bases long and has the following DNA sequence: 5'-X...XGCCCTACCC-3', X represents any base; (3) a sequence of sequence b is complementary to a sequence of sequence c, and sequence b is a sequence containing circular DNA, one of which is not complementary to any of the other two sequences; (4) in the presence of about 40 to 100 mM Na + solution or other aqueous solutions with similar ionic strength at 25°C, it can self-assemble to form a stable three-pronged neck ring secondary structure.

[0015] A preferred group of single-stranded DNA sequences of the present invention are: sequence a: 5'-GGGTAGGGCGGGTTGGG-3', sequence b: 5'-CCCAACCCATTCAAGAGCATCGACT-3', sequence c: 5'-AGTCGATGTGCCCTACCC-3'.

[0016] Heat the a, b, and c chains to 95°C respectively and add them to the hybridization buffer (50 mM Mg 2+ Equimolar a, b, and c chains were added to 10 mM Tris-HCl, heated at 95°C for 5 min, and then slowly cooled to 37°C to obtain a three-fork neck ring structure DNA assembly reporter probe.

[0017] III. crRNA sequence design

[0018] For the conserved sequence tDNA of the UreB gene of Helicobacter pylori obtained by bioinformatics screening, the recognition sequence of CRISPR RNA (crRNA) was selected by PAM sequence (TTTN): AAAGACATGCAAGATGGCGT, and then the recognition sequence of CRISPR RNA (crRNA) was designed according to the principle of complementary base pairing and the structural characteristics of crRNA.

[0019] crRNA sequence: UAAUUUCUACUAAGUGUAGAUACGCCAUCUUGCAUGUCUUU.

[0020] IV. Helicobacter pylori sample testing

[0021] The trident-necked ring structure DNA assembly, RPA product of Helicobacter pylori sample, Cas12a protein, crRNA, ddH2O, K + Add buffer and NeBuffer2.1 buffer to Eppendorf tube or 96-well microplate and mix well. React in a constant temperature water bath at 25-37℃ for 30-60min. Add hemin solution and incubate for 5-12min, then add H2O2 solution and color developer solution 2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS) or 3,3',5,5'-tetramethylbenzidine (TMB). After reacting for 5-12 minutes, add stop solution and measure the absorbance at 405nm or 450nm, or observe the color depth of the solution with naked eyes.

[0022] The detection method of the present invention is a signal-on type visual isothermal detection method, which utilizes the complementary hybridization of the DNA sequence and the G-quadruplex sequence in the DNA assembly to first protect the G-quadruplex sequence. After the CRISPR / Cas12a reaction system is combined with the tDNA sequence in the RPA amplification product, Cas12a is activated, and the side chain cuts the circular DNA region of the trifork neck ring structure DNA reporter probe, so that the DNA assembly dissociates and releases the G-quadruplex sequence, and the G-quadruplex sequence is combined with Hemin to exert its peroxidase-like activity, catalyzing the substrate (i.e., developer) oxidation color development. The color development has a positively correlated linear relationship with tDNA within a certain concentration range, and thus can reflect the level of tDNA, i.e., Helicobacter pylori.

[0023] The invention has the advantages of realizing simple, rapid, sensitive, specific and accurate detection of Helicobacter pylori, being applicable to the detection of any target substances such as nucleic acid sequences, pathogens, proteins and the like, not requiring complicated operation steps and instruments and equipment, and having very good application prospects.

[0024] The three single-stranded DNAs of the trident neck ring structure DNA assembly or the Y-shaped bulge structure DNA assembly are shown in the sequence list as SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 (A) is the simulated secondary structure of the three-pronged neck-ring structure DNA assembly of the present invention, and (B) is the gel electrophoresis diagram of the three-pronged neck-ring structure DNA assembly (abc) of the present invention.

[0026] Figure 2 This is a schematic diagram of the process and principle of visual detection of Helicobacter pylori based on the trident-necked ring structure DNA assembly and CRISPR / Cas12a system of the present invention.

[0027] Figure 3 The absorbance of Helicobacter pylori was detected by using ABTS as a colorimetric agent. 405nm -Concentration' linear relationship curve and color development solution photo.

[0028] Figure 4 In order to detect 3.72×10 3 cfu mL -1 Helicobacter pylori and 3.72×10 3 cfu mL -1 Escherichia coli's absorbance 405nm ' and photograph of the chromogenic solution. DETAILED DESCRIPTION

[0029] To better illustrate the present invention, the preparation of a DNA reporter probe with a trident neck ring structure and the detection of Helicobacter pylori are given as follows:

[0030] Example 1

[0031] I. Preparation of Trident-Neck-Ring Structure DNA Reporter Probe

[0032] Heat the a, b, and c chains to 95°C respectively and add them to 40 μL hybridization buffer (containing 50 mM Mg 2+ 20 μL of 100 μM a, b, and c chains were added to 10 mM Tris-HCl (10 mM Tris-HCl) to make the final concentrations 20 μM, and then heated at 95°C for 5 min. -1 The mixture was gradually cooled to 37°C at a rate of , to obtain a three-pronged neck ring structure DNA reporter probe.

[0033] The sequence of the a chain is a G quadruplex sequence: GGGTAGGGCGGGTTGGG;

[0034] The sequence of strand b is the sequence containing circular DNA: CCCAACCCATTCAAGAGCATCGACT;

[0035] The c-chain sequence is: AGTCGATGTGCCCTACCC.

[0036] II. Helicobacter pylori sample testing

[0037] (1) Sample processing and RPA amplification

[0038] The collected Helicobacter pylori samples were treated with a rapid nucleic acid release agent (provided by Changzhou Anpu Future Biotechnology Co., Ltd.), the whole genome DNA was released and extracted, and then the extracted Helicobacter pylori genomic DNA was used as a template for RPA amplification. The specific steps and conditions for RPA amplification are: add 5μL of extracted nucleic acid template, 29.4μL ABuffer (provided by Changzhou Anpu Future Biotechnology Co., Ltd.), 10μM upstream primer 2μL, 10μM downstream primer 2μL, 5μL nucleic acid template, 9.1μL ddH2O, 2.5μL B Buffer (provided by Changzhou Anpu Future Biotechnology Co., Ltd.) to the Eppendorf tube, incubate at 37°C for 30min, and amplify the RPA product.

[0039] (2) CRISPR / Cas12a reaction and three-pronged ring structure DNA reporter probe responsiveness detection

[0040] Add 4.5 μL 0.7 μM Cas12a, 3.5 μL 1 μM crRNA, 5 μL 20 μM trident neck ring structure DNA, 78 μL 20 mM K + Buffer, 2μL 10×NEBuffer2.1 buffer, and finally add 2μL of the above RPA product and mix well. At the same time, add the same reaction reagent to the negative control microwell, and finally add 2μL ddH2O. Incubate at 37℃ for 50min. Then add 2μL 50μM hemin solution and incubate at 37℃ for 10min. Finally, add 100μL 0.75mM ABTS, incubate for 10min, then add 50μL stop solution, use an enzyme reader to measure the absorbance value at 405nm, or observe with the naked eye to compare the color depth of the solution.

[0041] The above is only an embodiment of the present invention, and the scope of the present invention cannot be limited by this. Therefore, equivalent changes made to the scope of the present invention are still covered by the method for naked-eye visualization detection of Helicobacter pylori based on trident-necked ring structure DNA and CRISPR / Cas12a system claimed in the present invention.

Claims

1. A DNA assembly having a trident neck ring structure or a DNA assembly having a Y-shaped bulge structure, characterized in that: It is assembled from three single-stranded DNAs, and the sequences of the three single-stranded DNAs are shown in the deoxyribonucleic acid sequences of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 in the sequence list.

2. A method for visual detection of pathogens for non-diagnostic treatment, characterized in that: The trident neck ring structure DNA assembly or the Y-shaped bulge structure DNA assembly according to claim 1 is used as a reporter probe for generating signals, and a peroxidase substrate is used as an indicator to detect pathogens; the pathogens are selected from Helicobacter pylori.

3. The method for visual detection of pathogens for non-diagnostic treatment according to claim 2, characterized in that: The peroxidase substrate is selected from 2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS), 3,3',5,5'-tetramethylbenzidine (TMB), 3-amino-9-ethylcarbazole, 4-aminoantipyrine or luminol.

4. The method for visual detection of pathogens for non-diagnostic treatment according to claim 2, characterized in that: This is achieved by the following method: a trident neck ring structure DNA assembly or a Y-shaped bulge structure DNA assembly, an RPA product of a pathogen sample, a Cas12a protein, crRNA, ddH2O, K + Add buffer and NeBuffer2.1 buffer to Eppendorf tubes or 96-well microplates, mix well, and react; add heme solution for incubation, and finally add H2O2 solution and indicator for reaction. After the reaction, add stop solution, measure the absorbance, or observe the color depth of the solution with the naked eye.

Images