BMP-2 recombinant protein, coding gene and prokaryotic expression method thereof

By using the solubilizing tag sumo for mutation in the E. coli expression system, soluble expression of BMP-2 was achieved. Combined with Ni affinity chromatography and enzyme digestion purification, the problems of high cost, long cycle and difficult purification of eukaryotic expression systems were solved, and efficient and safe purification of BMP-2 was realized.

CN116143898BActive Publication Date: 2026-03-24YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-30
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

In existing technologies, the acquisition of BMP-2 protein mainly relies on eukaryotic expression systems, which are characterized by high cost, long cycle, difficult purification, and potential risk of viral infection. Furthermore, yeast and insect expression systems have issues with protein glycosylation and viral infection.

Method used

Using the E. coli expression system, the expression of BMP-2 was transformed into soluble expression by adding the solubilizing tag sumo and mutating it. Combined with Ni affinity chromatography column and enzyme digestion purification, prokaryotic expression and efficient purification of BMP-2 were achieved.

Benefits of technology

The efficient soluble expression of BMP-2 was achieved in the E. coli system, which simplified the protein isolation and purification process, shortened the purification cycle, improved purification efficiency and safety, and reduced costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116143898B_ABST
    Figure CN116143898B_ABST
Patent Text Reader

Abstract

The application provides a bone morphogenetic protein BMP-2 recombinant protein, and the amino acid sequence of the BMP-2 recombinant protein is shown as SEQ ID No. 1. The coding gene, the expression plasmid, the prokaryotic expression vector and the prokaryotic expression method are also disclosed. The prokaryotic expression system is adopted, and a solubilization tag is creatively introduced, so that the inclusion body expression is converted into soluble expression. The BMP-2 is expressed in the form of inclusion body in the prokaryotic system, the protein is converted into soluble expression by adding the solubilization tag, the difficulty of protein separation and purification is reduced, the purification cycle is shortened, and the purification efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a bone morphogenetic protein BMP-2 recombinant protein, a coding gene and a prokaryotic expression method thereof, and belongs to the technical field of biotechnology. BACKGROUND

[0002] Bone morphogenetic protein (BMP) is a highly conserved functional protein with similar structure, belonging to the transforming growth factor beta (TGF-β) family. In the mid-1960s, Urist discovered that bone morphogenetic protein can induce ectopic bone formation. BMP can stimulate DNA synthesis and cell replication, thereby promoting mesenchymal cells to differentiate into osteoblasts. It is also the main factor for inducing bone and cartilage formation in vivo, and is expressed during limb growth, endochondral ossification, early fracture, cartilage repair, and plays an important role in embryonic development and regeneration of the skeleton. The gain or loss of bone morphogenetic protein function usually leads to obvious defects or serious diseases. For example: congenital kidney and urinary tract abnormalities, chronic kidney disease, osteoarthritis, progressive fibrous dysplasia, osteogenesis imperfecta, pulmonary arterial hypertension, hereditary hemorrhagic telangiectasia, etc.

[0003] Bone morphogenetic protein 2 (BMP-2) is one of the most widely studied and most active BMPs for inducing osteogenesis. In 1988, natural BMP-2 was first purified and isolated, which is an alkaline degradation glycoprotein with a molecular weight of about 30 kD. The molecular weight of its degradation products is 30, 18 and 16 kD, respectively. The 30 kD molecule exists in a dimeric form and is the main form of natural BMP-2. BMP-2 mainly plays a role in recruiting and differentiating undifferentiated mesenchymal cells and bone cells. In the early stage of bone formation, BMP-2 not only recruits undifferentiated mesenchymal cells to the bone formation center and differentiates them into bone cells, but also reversely differentiates fibroblasts, myoblasts and bone marrow basal cells into bone cells. In the later stage of bone formation, BMP-2 also acts as an osteoclast differentiation factor to directly or indirectly stimulate osteoclast differentiation with other supporting osteoclast differentiation factors, and participates in bone remodeling.

[0004] Currently, BMP-2 protein is primarily obtained using eukaryotic expression systems, including mammalian cell expression systems, yeast expression systems, and insect expression systems. Mammalian cell expression systems have high-cost culture media, long culture cycles, low expression levels, complex structures, and require advanced operational techniques, necessitating sterile cell chambers and high costs, and can sometimes lead to viral infections. Yeast expression systems result in low expression levels of the cloned gene, long fermentation times, and sometimes protein glycosylation of the fusion protein can alter its molecular weight, thereby changing some important biological functions. Furthermore, the high polysaccharide concentration in the culture supernatant is detrimental to purification. The main drawback of insect expression systems is that exogenous protein expression is regulated by a very late-stage viral promoter, at which point viral infection leads to cell death. Summary of the Invention

[0005] The purpose of this invention is to provide a recombinant BMP-2 protein and its encoding gene that can be used for prokaryotic expression, which has a solubilizing tag to convert inclusion body expression into soluble expression.

[0006] The technical solution adopted in this invention is as follows:

[0007] A recombinant bone morphogenetic protein BMP-2, characterized by its amino acid sequence as shown in SEQ ID No. 1.

[0008] The present invention also discloses the encoding gene of the above-mentioned bone morphogenetic protein BMP-2 recombinant protein, characterized in that its DNA sequence is shown in SEQ ID No. 2.

[0009] The present invention also discloses the expression plasmid of the above-mentioned bone morphogenetic protein BMP-2 recombinant protein.

[0010] Preferably, the plasmid vector is pET15b.

[0011] The present invention also discloses a prokaryotic expression host for the above-mentioned bone morphogenetic protein BMP-2 recombinant protein, which is obtained by converting the expression plasmid described in claim 3 or 4 into a prokaryotic expression host.

[0012] Preferably, the prokaryotic expression host is E. coli BL21(DE3).

[0013] This invention also discloses a prokaryotic expression method for bone morphogenetic protein BMP-2, the steps of which include:

[0014] (1) Construct the expression plasmids described above;

[0015] (2) The expression plasmid was transformed into E. coli BL21(DE3) competent cells, and positive clones were screened out;

[0016] (3) Culture the positive clones of the strain and collect the bacterial cells;

[0017] (4) The bacterial cells were broken up and purified by Ni affinity chromatography.

[0018] (5) The purified protein was digested with SUMO enzyme at 4°C overnight;

[0019] (6) The protein after enzyme digestion is reverse-coated onto a Ni affinity chromatography column, and the purified protein is collected, which is bone morphogenetic protein BMP-2.

[0020] The present invention also discloses a mutated solubilizing tag sumo, the amino acid sequence of which is shown in SEQ ID No. 9.

[0021] The DNA sequence of the gene encoding the soluble tag *sumo* is shown in SEQ ID No. 10. This invention mutates the *sumo* tag at the following sites: F73Y, T85A, I97L. Bone morphogenetic protein BMP-2 binds to the mutated *sumo* tag, changing from inclusion body expression to soluble expression, thus enabling BMP-2 expression in a prokaryotic expression system. Among various expression systems, the *E. coli* expression system was the first to be used for research and is currently the most mature expression system. The *E. coli* expression system has become the most commonly used system for producing recombinant proteins due to its advantages such as rapid cell proliferation, high yield, and relatively simple IPTG-induced expression. The *E. coli* expression system has many advantages: clear genetic background, rapid proliferation, low cost, strong resistance to contamination, high expression levels, relatively simple separation and purification of expression products, good stability, a complete range of commercially available vectors and strains, and wide applicability. BMP-2 is expressed as inclusion bodies in prokaryotic systems. This invention converts the protein into soluble expression by adding a solubilizing tag, which reduces the difficulty of protein isolation and purification, shortens the purification cycle, and improves purification efficiency. Attached Figure Description

[0022] Figure 1 Plasmid map of bone morphogenetic protein 2 encoding gene sequence constructed into expression vector pET-15b.

[0023] Figure 2 SDS-PAGE images of BMP-2 expressed by two gene sequences; Lane 1: Protein Marker; Lane 2: BMP-2 lysis supernatant with his and sumo tags; Lane 3: BMP-2 lysis pellet with his and sumo tags; Lane 4: Protein Marker; Lane 5: BMP-2 lysis supernatant with his and mutant sumo tags; Lane 6: BMP-2 lysis pellet with his and mutant sumo tags.

[0024] Figure 3 SDS-PAGE images of bone morphogenetic protein 2 expression and affinity purification; from left to right: protein marker, whole cell lysate, lysate, supernatant, flow-through, 25 mM imidazole elution buffer, 250 mM imidazole elution buffer.

[0025] Figure 4 Bone morphogenetic protein 2 enzyme digestion and reverse SDS-PAGE images; from left to right: sample before enzyme digestion, sample after enzyme digestion, protein marker, flow-through buffer, 10 mM imidazole elution buffer, 30 mM imidazole elution buffer, 50 mM imidazole elution buffer, 100 mM imidazole elution buffer, 250 mM imidazole elution buffer.

[0026] Figure 5 : Molecular sieve spectrum of bone morphogenetic protein 2; the peaks are the peaks of the target protein.

[0027] Figure 6 SDS-PAGE image of bone morphogenetic protein 2 molecular sieve; from left to right: protein marker and target protein band.

[0028] Figure 7 : A schematic diagram of the process of this invention. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and not for limiting the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or conditions provided by the manufacturer. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available.

[0030] Example 1: Construction of a recombinant expression vector for bone morphogenetic protein 2

[0031] The gene sequences of bone morphogenetic protein 2 (HIS and SUMO tags) were constructed into the expression vector pET15b (Amp resistance, see...). Figure 1 ).

[0032] 1. Primer design is as follows:

[0033] Primer 1: CATCATCATCATCATCACGGGTCGGACTCAGAAGTCAAT (SEQ ID No. 3)

[0034] Primer 2: GTGATGATGATGATGATGGCT (SEQ ID No. 4)

[0035] Primer 3: CGCGAACAGATTGGAGGTCAAGCGAAACACAAACAGCGT (SEQID No. 5)

[0036] Primer 4: ACCTCCAATCTGTTCGCGGTG (SEQ ID No. 6)

[0037] Primer 5: GAAGGCTGCGGCTGCCGTTAACTAGCATAACCCCTTGGG (SEQID No. 7)

[0038] Primer 6: ACGGCAGCCGCAGCCTTCAAC (SEQ ID No. 8)

[0039] 2. DNA amplification

[0040] The PCR system consisted of 50 μL, including 25 μL of 2×Hieff Canace® Plus PCR Master Mix (With Dye), 0.2 μM of forward and reverse primers, 50 ng of plasmid, and ddH2O to a final volume of 50 μL. Specifically: primers 1 and 4 used the sumo plasmid as their template; primers 2 and 5 used the pET15b vector as their template; and primers 3 and 6 used the BMP-2 plasmid as their template. The PCR program was as follows: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 20 s, 72℃ for 2 min (30 s / kb), 25 cycles; 72℃ for 5 min; 4℃ hold. Nucleic acid gel electrophoresis was performed at a concentration of 1.5%, an electrophoresis pressure of 150 V, and a run time of 30 min. Gel recovery was performed using an Omega gel recovery kit.

[0041] 3. Homologous recombination:

[0042] Use 2 μL of homologous recombinase (2x cloneExpress mix) to add 2 μL of the product to be recovered from the ligation gel, mix well, and then recombine at 50°C for 5 min.

[0043] 4. Transformation

[0044] Add 4 μL of the recombinant product to 100 μL of DH5α competent cells, place on ice for 30 min, heat shock at 42°C for 90 s, place on ice for 15 min, add 200 μL of LB, activate at 37°C for 1 h, and finally take 100 μL to plate.

[0045] 5. Sequencing

[0046] The plate colonies were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and correctly sequenced positive clones were obtained. The plasmid map is shown below.Figure 1 As shown.

[0047] Example 2: Expression of bone morphogenetic protein 2

[0048] The host bacterium used for protein expression was E. coli BL21(DE3).

[0049] 1. Transform recombinant plasmids containing his and sumo tags (wild-type and mutant) into E. coli BL21(DE3) competent cells, plate them on plates with Amp resistance, and incubate overnight at 37°C.

[0050] 2. Pick a single colony and transfer it to 4 mL LB (Amp 100g / mL), incubate overnight at 37°C, then transfer it to 1 L LB (Amp 100g / mL), incubate until the OD value is between 0.8 and 1.0, add 0.1 mM IPTG, and incubate at 16°C for 18 h.

[0051] 3. Collect the culture medium into a wide-mouth bottle and centrifuge at 6000 rpm for 15 min.

[0052] 4. Discard the supernatant, collect the precipitate in a sealed bag, and store at -80℃.

[0053] Example 3: Isolation and purification of bone morphogenetic protein 2.

[0054] 1. Separation

[0055] a. Remove the bacterial cells from the -80°C freezer, add lysis buffer (20 mM Tris, 250 mM NaCl, 0.05% Triton X-100, 10% glycerol, 0.1 mg / ml lysozyme, pH 7.5), and stir to dissolve.

[0056] b. Add PMSF to the bacterial culture to a final concentration of 2 mM, and sonicate to break the bacteria. The sonication conditions are: sonicate for 3 seconds, pause for 3 seconds, sonicate for 10 minutes each time, and sonicate for a total of 3 times.

[0057] c. Collect the ultrasonically processed bacterial solution into a centrifuge tube and centrifuge at 10,000 rpm for 40 min.

[0058] The supernatant and precipitate after the two bacteria were broken down are as follows: Figure 2 As shown, BMP-2 containing the wild-type sumo tag is mainly found in the lysed precipitate, while BMP-2 containing the mutant sumo tag is mainly found in the lysed supernatant in a soluble form, indicating that the mutant sumo tag has a better solubilizing effect than the wild-type sumo tag.

[0059] 2. Purification

[0060] a. Affinity purification

[0061] 1) Column balancing: The packing is balanced with 5 column volumes of lysis buffer.

[0062] 2) Sample loading: Filter the supernatant from centrifugation through a 0.45 μm filter membrane, then pass the supernatant through an NI affinity chromatography column at a flow rate of 5 mL / min, and collect the flow-through.

[0063] 3) Washing: Wash with 10 column volumes of lysis buffer.

[0064] 4) Elution: The target protein was eluted using a gradient of 10 column volumes of elution buffer 1 (20 mM Tris, 300 mM NaCl, 0.02% Triton X-100, 25 mM imidazole, 10% glycerol, pH 8.0) and 10 column volumes of elution buffer 2 (20 mM Tris, 300 mM NaCl, 0.02% Triton X-100, 250 mM imidazole, 10% glycerol, pH 8.0).

[0065] SDS-PAGE results of BMP-2 containing the mutant sumo tag are as follows Figure 3 As shown: the target protein in elution buffer 2 is relatively pure.

[0066] b. Enzyme digestion reverse binding

[0067] 1) Add the affinity-purified protein to the SUMO enzyme and digest it overnight at 4°C.

[0068] 2) Pass the enzyme-digested protein through an NI affinity chromatography column again.

[0069] SDS-PAGE results of BMP-2 containing the mutant sumo tag are as follows Figure 4 As shown: Enzyme digestion was complete overnight at 4℃, and the flow-through solution contained the target protein.

[0070] c. Molecular sieve purification

[0071] 1) Column equilibration: Equilibrate the molecular sieve with 5 column volumes of PBS.

[0072] 2) Sample loading: Concentrate the sample to 2 ml and load it through the sample loading loop.

[0073] 3) Elution buffer collection: Collect the sample into a centrifuge tube.

[0074] 4) Concentration determination: The target protein is concentrated by centrifugation at 4000 rpm. It is taken out and gently shaken every 20 minutes. BSA is used as the standard protein to determine the concentration of the target protein.

[0075] Molecular sieve profile of BMP-2 containing the mutant sumo tag, as shown below Figure 5 As shown: the target peak is a standard symmetrical peak.

[0076] SDS-PAGE of BMP-2 containing the mutant sumo tag, such as Figure 6 As shown: the bone morphogenetic protein 2 protein band is relatively pure.

[0077] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant bone morphogenetic protein BMP-2, characterized in that... Its amino acid sequence is shown in SEQ ID No.

1.

2. The gene encoding the recombinant bone morphogenetic protein BMP-2 as described in claim 1, characterized in that... Its DNA sequence is shown in SEQ ID No.

2.

3. The expression plasmid of the recombinant bone morphogenetic protein BMP-2 as described in claim 1.

4. The expression plasmid for the recombinant bone morphogenetic protein BMP-2 according to claim 3, characterized in that: The plasmid vector is Pet15b.

5. The prokaryotic expression host of the recombinant bone morphogenetic protein BMP-2 as described in claim 1 is obtained by transforming the expression plasmid as described in claim 3 or 4 into the prokaryotic expression host.

6. The prokaryotic expression host of the recombinant bone morphogenetic protein BMP-2 according to claim 5, characterized in that: The prokaryotic expression host is E. coli BL21(DE3).

7. A prokaryotic expression method for bone morphogenetic protein BMP-2, characterized in that... The steps include: (1) Construct the expression plasmid as described in claim 3 or 4; (2) The expression plasmid was transformed into E. coli BL21(DE3) competent cells, and positive clones were screened out; (3) Culture the strains with positive clones and collect the bacterial cells; (4) The bacterial cells were broken up and purified by Ni affinity chromatography. (5) Add SUMO enzyme to the purified protein and digest it overnight at 4°C; (6) Pass the enzyme-digested protein through a Ni affinity chromatography column again and collect the purified protein, which is bone morphogenetic protein BMP-2.

8. A mutated solubilizing tag, sumo, characterized in that... Its amino acid sequence is shown in SEQ ID No.

9.

9. The gene encoding the solubilizing tag sumo as described in claim 8.

10. The gene encoding the solubilizing tag sumo according to claim 9, characterized in that... Its DNA sequence is shown in SEQ ID No. 10.

Citation Information

Patent Citations

  • Method for preparing maturation peptide of morphogenesis protein - 2 of human bones

    CN101003802A

  • Preparation method for antimicrobial peptide-lysozyme fusion protein and application thereof

    CN105061603A