Gene ItGRF2 for transgenic tobacco cultivation and method for transgenic tobacco cultivation

Abstract

The invention provides a gene for transgenic tobacco cultivation and a transgenic tobacco cultivation method, and relates to the technical field of plant transgenic technology. The gene ItGRF2 sequence for transgenic tobacco cultivation is shown in SEQ ID NO.1; the tobacco cultivation method comprises the following steps: 1) constructing an expression vector carrying the gene ItGRF2, and transferring it into Agrobacterium; 2) cutting young tobacco leaves into pieces, and soaking them in bacterial liquid; 3) transferring the leaf pieces treated in 2) to an MS culture medium containing acetosyringone, and dark-treating them for 1 to 3 days; 4) transferring the treated leaf pieces to an MS culture medium containing cephalosporin, and inducing budding; 5) when the buds in 4) grow to 0.8 to 1.2 cm, transferring them to an MS culture medium containing cephalosporin for subculture for 40 to 50 days to obtain complete plants; the tobacco cultivation using the gene ItGRF2 does not rely on hormone induction, and the cultivation conditions are simple, the cycle is short, and the efficiency is high.

Description

Technical Field

[0001] The invention relates to the technical field of plant transgenic technology, and in particular to a gene used for transgenic tobacco cultivation and a transgenic tobacco cultivation method. Background Art

[0002] Common tobacco (Nicotiana tabacum) is an important economic crop and a model plant for studying plant genetics, cell biology and molecular biology. At the same time, tobacco is also one of the earliest plants for tissue culture. The MS basic medium developed based on tobacco (Murashige and Skoog, 1962) has been widely used in tissue culture of hundreds of plants.

[0003] Leaf disc method is a classic tobacco genetic transformation method. This method usually cuts tobacco leaves into small pieces and places them on an induction medium for cultivation. This medium usually adds plant hormones and antibiotics, such as 6-BA and NAA. The role of hormones is to form plants after inducing callus, and the role of antibiotics is to screen out non-transformants. The entire transformation process takes 80-120 days under ideal conditions (Smith RH2012. Plant tissue culture Techniques and experiments. Third edition. Harcourt BJ, Publishers. Academic press, inc, San Diego). Callus seedlings and antibiotic screening will reduce the positive rate and extend the tissue culture time. In order to obtain transgenic tobacco more efficiently, many scholars are committed to the research of tobacco genetic transformation and have made some progress (Zhao Pengyu et al., a transgenic method, recombinant expression vector and application to improve tobacco disease resistance, invention patent, CN113980998A; Liu Yihua et al., a tobacco Agrobacterium genetic transformation method, invention patent, CN114107376A). However, the existing methods for genetic transformation of tobacco all rely on the induction of plant hormones, which takes a long time to transform. The selection of callus seedlings will reduce the positive rate and prolong the tissue culture time. There is still room for improvement in the tobacco genetic transformation process. Summary of the invention

[0004] The purpose of the present invention is to provide a gene ItGRF2 for transgenic tobacco cultivation. The cultivation of transgenic tobacco using the gene ItGRF2 does not rely on hormone induction, and the cultivation conditions are simple, the cycle is short and the efficiency is high.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a gene ItGRF2 for cultivating transgenic tobacco, and the gene sequence is shown as SEQ ID NO.1.

[0007] The present invention also provides an expression vector of the gene ItGRF2, comprising an initial expression vector and the gene ItGRF2.

[0008] The present invention also provides a recombinant expression strain of the gene ItGRF2, and the recombinant expression strain is obtained by transforming the expression vector of the gene ItGRF2 into Agrobacterium.

[0009] The present invention also provides a method for using the gene to cultivate transgenic tobacco, comprising the following steps:

[0010] 1) constructing an expression vector carrying the ItGRF2 gene and transferring it into Agrobacterium to obtain a recombinant expression strain;

[0011] 2) Cutting young tobacco leaves into pieces and soaking them in the bacterial solution of the recombinant expression strain;

[0012] 3) moving the leaf pieces treated in step 2) to MS medium containing acetosyringone and treating in the dark for 1 to 3 days;

[0013] 4) Transfer the dark-treated leaf pieces to MS medium containing cephalosporin to induce budding;

[0014] 5) When the buds in step 4) grow to 0.8-1.2 cm, the buds are cut off and transferred to MS medium containing cephalosporin for subculture for 40-50 days to obtain complete plants.

[0015] Preferably, the OD of the bacterial solution of the recombinant expression strain in step 2) is 600 0.4-0.6; in step 2), the leaves are cut into 0.5-1 cm 2 leaf blocks; in step 2), the ratio of leaf blocks to bacterial solution of the recombinant expression strain is 1 to 3: 2 to 6 mL; in step 2), the soaking time of the leaf blocks is 5 to 15 min.

[0016] Preferably, the concentration of acetosyringone in the MS culture medium in step 3) is 15-25 mg / L.

[0017] Preferably, the concentration of cephalosporin in the MS medium in step 4) is 180-220 mg / L.

[0018] Preferably, the germination induction temperature in step 4) is 24-26° C., the illumination time is 14-18 h / d, and the illumination intensity is 2000-3000 Lux.

[0019] Preferably, in step 4), the MS culture medium further contains sucrose and Phytagel, and the pH of the culture medium is 5.8-6.0.

[0020] Preferably, the concentration of cephalosporin in the MS culture medium in step 5) is 80-120 mg / L.

[0021] The technical effects and advantages of the present invention include: a gene ItGRF2 for transgenic tobacco cultivation and a method for transgenic tobacco cultivation, wherein the method comprises infecting tobacco leaves with Agrobacterium carrying a plant expression vector of the ItGRF2 gene, dark-treating the leaves on an MS culture medium containing acetosyringone, and then transferring the leaves to an MS culture medium containing cephalosporin to induce budding, and obtaining complete plants through subculture; no hormones need to be added during the cultivation process, and transgenic tobacco plants can be verified through plant morphology, antibiotic screening and PCR detection; the present invention can induce tobacco to become seedlings in one step to obtain transgenic plants, the plant regeneration rate reaches 80.0%, the positive plants reach 90%, and the transformation period is short, generally about 45 days; the method of the present invention has strong operability and good repeatability. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The PCR test results of the experimental example (from left to right are DNA Marker, 1-5 independent transformed tobacco plants, ItGRF2 plasmid positive control and non-transformed tobacco plant control, Marker is a DNA ladder marker, the length from top to bottom is 2000bp, 1000bp, 750bp, 500bp, 200bp, 100bp);

[0023] Figure 2 This is a physical picture of comparative example 1, in which tobacco leaves cannot induce callus or budding after 20 days of development on a hormone-free medium;

[0024] Figure 3 This is a photo of callus formation on tobacco leaves of Comparative Example 1 after 30 days of development on a culture medium containing 2 mg / L 6-BA and 0.1 mg / L NAA;

[0025] Figure 4 This is a photo of Example 1 showing the induction of budding in tobacco leaves after 20 days of development on hormone-free medium induced by Agrobacterium carrying CaMV35S::ItGRF2. DETAILED DESCRIPTION

[0026] The present invention provides a gene ItGRF2 for transgenic tobacco cultivation, wherein the gene sequence is:

[0027]

[0028] The present invention also provides an expression vector of the gene ItGRF2, comprising an initial expression vector and the gene ItGRF2, wherein the initial expression vector is preferably a pCAMBIA1301 vector.

[0029] The present invention also provides a recombinant expression strain of the gene ItGRF2, which is obtained by transforming the expression vector of the gene ItGRF2 into Agrobacterium. The expression vector of the gene ItGRF2 preferably uses pCAMBIA1301 as the initial expression vector, and constructs a CaMV35S::ItGRF2 plant expression vector by a gene recombination method. CaMV35S is a hygromycin resistance gene, which is a gene on the initial expression vector.

[0030] The present invention also provides a method for using the gene to cultivate transgenic tobacco, comprising the following steps:

[0031] 1) constructing an expression vector carrying the ItGRF2 gene and transferring it into Agrobacterium to obtain a recombinant expression strain;

[0032] 2) Cut young tobacco leaves into pieces and soak them in the bacterial solution of the recombinant expression strain;

[0033] 3) moving the leaf pieces treated in step 2) to MS medium containing acetosyringone and treating in the dark for 1 to 3 days;

[0034] 4) Transfer the dark-treated leaf pieces to MS medium containing cephalosporin to induce budding;

[0035] 5) When the buds in step 4) grow to 0.8-1.2 cm, the buds are cut off and transferred to MS medium containing cephalosporin for subculture for 40-50 days to obtain complete plants.

[0036] In the method for cultivating transgenic tobacco of the present invention, step 1) constructs an expression vector carrying the gene ItGRF2, and transfers it into Agrobacterium to obtain a recombinant expression strain; preferably, a transgenic engineering Agrobacterium GV3101 carrying the CaMV35S::ItGRF2 plant expression vector is constructed; preferably, the recombinant Agrobacterium GV3101 is cultured overnight in an LB liquid culture medium containing 20 mg / L rifampicin and 50 mg / L kanamycin; preferably, the formula of the LB liquid culture medium is 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride, and the pH of the LB liquid culture medium is preferably 7 to 7.2, and more preferably 7.1; preferably, after overnight culture, the OD of the bacterial solution of the recombinant expression strain is 600 The ratio is preferably adjusted to 0.4 to 0.6, more preferably 0.45 to 0.55, and even more preferably 0.5.

[0037] In the method for cultivating transgenic tobacco of the present invention, step 2) cuts the young tobacco leaves into pieces and soaks them in the bacterial solution of the recombinant expression strain; the young tobacco leaves are preferably 3 to 4 young leaves at the top of the sterile tobacco seedlings; the size of the cut leaves is preferably 0.5 to 1 cm 2 , more preferably 0.6 to 0.9 cm 2 , and further preferably 0.7 to 0.8 cm 2 ; The ratio of leaf blocks to the bacterial solution of the recombinant expression strain in the soaking treatment is preferably 1 to 3: 2 to 6 mL, more preferably 2: 2 to 6 mL, and further preferably 2: 3 to 5 mL; the soaking time of the leaf blocks is preferably 5 to 15 min, more preferably 8 to 12 min, and further preferably 9 to 11 min.

[0038] In the method for cultivating transgenic tobacco of the present invention, step 3) the leaf pieces treated in step 2) are moved to MS medium containing acetosyringone and dark-treated for 1 to 3 days; the concentration of the acetosyringone is preferably 15 to 25 mg / L, more preferably 16 to 24 mg / L, and even more preferably 18 to 22 mg / L; and the dark-treatment time is more preferably 2 days.

[0039] In the method for cultivating transgenic tobacco of the present invention, step 4) transfers the leaf block after dark treatment to MS medium containing cephalosporin to induce budding; the concentration of the cephalosporin is preferably 180-220 mg / L, more preferably 185-215 mg / L, and further preferably 190-210 mg / L; the budding induction temperature is preferably 24-26°C, and further preferably 25°C; the budding induction light time is preferably 14-18 h / d, and further preferably 15-17 h / d, and further preferably 16 h / d; the budding induction light intensity is preferably 2000-3000 Lux, and further preferably 2200-2800 Lux. ux, and further preferably 2400-2600Lux; the time for inducing budding is preferably 10-18d, further preferably 12-16d, and further preferably 13-15d; the MS medium for inducing budding preferably also includes sucrose and Phytagel, the concentration of the sucrose is preferably 25-35g / L, further preferably 26-34g / L, and further preferably 28-32g / L, the concentration of the Phytagel is preferably 2-6g / L, further preferably 3-5g / L, and further preferably 4g / L, and the pH of the medium for inducing culture is preferably 5.8-6.0, and further preferably 5.9.

[0040] In the method for cultivating transgenic tobacco of the present invention, in step 5), when the buds in step 4) grow to 0.8-1.2 cm, the buds are cut off and transferred to MS medium containing cephalosporin for subculture for 40-50 days to obtain complete plants; more preferably, the buds are cut off when they grow to 0.9-1.1 cm, and more preferably, the buds are cut off when they grow to 1.0 cm; the concentration of cephalosporin is preferably 80-120 mg / L, more preferably 90-110 mg / L, and more preferably 95-105 mg / L; the time of subculture is 40-50 days, more preferably 42-48 days, and more preferably 44-46 days.

[0041] In the method for cultivating transgenic tobacco of the present invention, the MS basic medium formula is preferably a medium designed by Murashige and Skoog for plant cell culture in 1962, and further preferably, 1.65g of ammonium nitrate, 1.9g of potassium nitrate, 0.44g of calcium chloride, 0.37g of magnesium sulfate, 0.17g of potassium dihydrogen phosphate, 0.83mg of potassium iodide, 5.2mg of boric acid, 22.3mg of magnesium sulfate, 3.6mg of zinc sulfate, 0.25mg of sodium molybdate, 0.025mg of copper sulfate, 0.025mg of cobalt chloride, 27.8mg of iron sulfate, 100mg of inositol, 2mg of glycine, 0.1mg of thiamine hydrochloride, 0.5mg of pyridoxine hydrochloride, 0.5mg of nicotinic acid, 30g of sucrose and 7g of agar are added to each 1L of water to prepare the medium.

[0042] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0043] Example 1

[0044] Experimental Materials and Methods

[0045] (1) Test materials: leaves of common tobacco: Nicotiana tabacum; Agrobacterium GV3101: Agrobacterium tumefaciens.

[0046] The MS basic medium formula is a medium designed by Murashige and Skoog for plant cell culture in 1962. For every 1L of medium, add 1.65g ammonium nitrate, 1.9g potassium nitrate, 0.44g calcium chloride, 0.37g magnesium sulfate, 0.17g potassium dihydrogen phosphate, 0.83mg potassium iodide, 5.2mg boric acid, 22.3mg magnesium sulfate, 3.6mg zinc sulfate, 0.25mg sodium molybdate, 0.025mg copper sulfate, 0.025mg cobalt chloride, 27.8mg iron sulfate, 100mg inositol, 2mg glycine, 0.1mg thiamine hydrochloride, 0.5mg pyridoxine hydrochloride, 0.5mg niacin, 30g sucrose and 7g agar.

[0047] (2) Test method:

[0048] Based on the pCAMBIA1301 vector, a CaMV35S::ItGRF2 plant expression vector was constructed by gene recombination, and a transgenic Agrobacterium GV3101 carrying the CaMV35S::ItGRF2 plant expression vector was constructed. The recombinant Agrobacterium GV3101 was cultured overnight in LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, pH 7.1) containing 20 mg / L rifampicin and 50 mg / L kanamycin, and the OD of the recombinant Agrobacterium culture solution was 0.1477 W / m. 600 Adjust to 0.5.

[0049] The material comes from the subcultured common tobacco Nicotiana tabacum tissue culture seedlings. The four tender leaves at the top of the sterile tobacco seedlings were selected and cut into 0.5 cm thick pieces using scissors in an ultra-clean workbench. 2 The leaf pieces were soaked in the recombinant Agrobacterium culture solution for 10 min. The ratio of leaf pieces to Agrobacterium culture solution was preferably 2:4 mL.

[0050] The leaf pieces after soaking treatment were transferred to MS medium with 20 mg / mL acetosyringone concentration and dark-treated for 2 days; the leaf pieces after dark-treated were transferred to MS medium with 200 mg / mL cephalosporin concentration to induce budding. The MS medium also included 30 g / L sucrose and 4 g / L Phytagel, with a pH of 5.0; the induction culture temperature was 25°C, the light duration was 16 h / d, the light intensity was 2500 Lux, and the induction culture time was 14 days.

[0051] When the buds were induced to grow to 1 cm, they were cut off and transferred to MS medium containing 100 mg / L cephalosporin for subculture for 45 days to obtain complete plants. Each group was repeated with 10 leaf pieces, for a total of 3 replicates.

[0052] Comparative Example 1

[0053] Leaves infected with Agrobacterium not carrying ItGRF2 were used as controls and cultured under the same conditions.

[0054] Experimental example

[0055] Transformed plants were selected by plant phenotype and PCR detection. The bud differentiation rate was counted 20 days after the leaf pieces were inoculated on the induction culture medium, and the ItGFR2 gene specific primers were used at the same time:

[0056] primer-F:CTGGATCTTACGCCCCGAAT(SEQ ID No.2)

[0057] primer-R: CCTGGCCGGTGAAATCAAGA (SEQ ID No. 3);

[0058] PCR detection was performed, the product length was 600bp, and the positive rate was counted.

[0059] The PCR amplification system is shown in Table 1:

[0060] Table 1 2×Taq Master Mix amplification system

[0061]

[0062] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles; extension at 72°C for 5 min.

[0063] Results and analysis:

[0064] Effects of different transformation methods on leaf induction and transformation rate

[0065] The study found that at the 14th day of investigation, the tobacco leaf blocks had already differentiated into buds and quickly formed regenerated plants. The specific results are shown in Table 2: Compared with the comparative example 1 in which the leaves were infected with Agrobacterium without the ItGRF2 gene on the hormone-free medium, the bud differentiation rate and positive rate of the leaves infected with Agrobacterium carrying the ItGRF2 gene in Example 1 on the hormone-free medium were significantly improved, with the bud differentiation rate reaching 80% and the positive rate being 100% (see Table 2). The comparative example 1 could not form adventitious buds and regenerated plants through the leaves, and eventually turned yellow and died (such as Figure 2 shown).

[0066] Table 2 Effects of different transformation methods on bud differentiation rate and positive rate

[0067]

[0068]

[0069] *Note: Bud differentiation rate = number of leaves that differentiated into buds / total number of leaves * 100%; positive rate = number of positive plants / number of plants * 100%.

[0070] From the above examples, it can be seen that the present invention uses common tobacco as material and leaves as explants. After infection with Agrobacterium carrying the CaMV35S::ItGRF2 plant expression vector, transgenic plants can be obtained on a culture medium without the need to add hormones. The operation is simple, time-saving, efficient and reproducible.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A gene ItGRF2 for transgenic tobacco cultivation, characterized in that: The gene sequence is shown in SEQ ID NO.

1.

2. The expression vector of the gene ItGRF2 according to claim 1, characterized in that: Includes the initial expression vector and gene ItGRF2.

3. The recombinant expression strain of the gene ItGRF2 according to claim 1, characterized in that: The recombinant expression strain is obtained by transforming the expression vector of the gene ItGRF2 into Agrobacterium.

4. A method for cultivating transgenic tobacco using the gene of claim 1, characterized in that: The following steps are involved: 1) constructing an expression vector carrying the ItGRF2 gene and transferring it into Agrobacterium to obtain a recombinant expression strain; 2) Cutting young tobacco leaves into pieces and soaking them in the bacterial solution of the recombinant expression strain; 3) moving the leaf pieces treated in step 2) to MS medium containing acetosyringone and treating in the dark for 1 to 3 days; 4) Transfer the dark-treated leaf pieces to MS medium containing cephalosporin to induce budding; 5) When the buds in step 4) grow to 0.8-1.2 cm, the buds are cut off and transferred to MS medium containing cephalosporin for subculture for 40-50 days to obtain complete plants.

5. The method for cultivating transgenic tobacco according to claim 4, characterized in that: OD of the bacterial solution of the recombinant expression strain in step 2) 600 0.4-0.6; in step 2), the leaves are cut into 0.5-1 cm 2 leaf blocks; in step 2), the ratio of leaf blocks to bacterial solution of the recombinant expression strain is 1 to 3: 2 to 6 mL; in step 2), the soaking time of the leaf blocks is 5 to 15 min.

6. The method for cultivating transgenic tobacco according to claim 4, characterized in that: In the step 3), the concentration of acetosyringone in the MS culture medium is 15-25 mg / L.

7. The method for cultivating transgenic tobacco according to claim 4, characterized in that: In the step 4), the concentration of cephalosporin in the MS culture medium is 180-220 mg / L.

8. The method for cultivating transgenic tobacco according to claim 7, characterized in that: The temperature for inducing germination in step 4) is 24-26° C., the illumination time is 14-18 h / d, and the illumination intensity is 2000-3000 Lux.

9. The method for cultivating transgenic tobacco according to claim 8, characterized in that: In the step 4), the MS culture medium also contains sucrose and Phytagel, and the pH of the culture medium is 5.8-6.

0.

10. The method for cultivating transgenic tobacco according to claim 4, characterized in that: In the step 5), the concentration of cephalosporin in the MS culture medium is 80-120 mg / L.

Images