A system, application and genomic evolution method applicable to the genomic evolution of Ralstonia
By fusing genes expressing cytosine deaminase and specific single-strand DNA-binding proteins in Rollstone, the problem of time-consuming and inefficient adaptive evolution of Rollstone is solved, efficient genomic evolution is achieved, and the robustness and biosynthesis efficiency of the strain are improved.
Patent Information
- Application Number
- CN202211513260.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-24
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2042-11-24
AI Technical Summary
The adaptive evolution of Rollstoneella in the prior art takes a long time and is inefficient, and the existing mutation methods have not been used in Rollstoneella, making it difficult to improve its robustness and biosynthesis efficiency.
The genes of rat or lamprey-derived cytosine deaminase and Rollstoneella-specific single-strand DNA-binding protein were fusion-expressed, and genomic evolution was achieved in Rollstoneella by recombinant expression plasmids, thereby improving the mutation rate.
It significantly improves the genomic mutation rate of Rollstoneella, enhances tolerance to organic reagents, oxidants and electrical microbial systems, improves biosynthesis efficiency and robustness, and is suitable for the directional evolution of industrial production.
Smart Images

Figure CN116144692B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering technology, and particularly to a system, application and genomic evolution method suitable for the genomic evolution of Ralstonia bacteria. Background Art
[0002] Ralstonia bacteria (Ralstonia) was first isolated in Germany in 1961 and is a Gram-negative bacterium suitable for microbial electrosynthesis systems (MES). Its current official name is Cupriavidus necator H16, but Ralstonia eutropha H16 is still the most commonly used name in the field. Ralstonia is a typical facultative chemoautotrophic microorganism that can utilize fructose, gluconate, various organic acids, and CO2 as carbon sources. Although the glycolysis pathway and pentose phosphate pathway are incomplete due to the absence of key enzymes, phosphofructokinase and 6-phosphogluconate dehydrogenase, Ralstonia can efficiently utilize fructose through the Entner-Doudoroff (ED) pathway. In addition, Ralstonia can also carry out autotrophic metabolism using CO2 and H2 through the Calvin (CBB) cycle and Ni-Fe hydrogenase, providing the possibility for its application in electrosynthesis systems. Moreover, in the case where carbon sources are abundant while other nutrient elements (such as nitrogen, phosphorus, and oxygen) are lacking, Ralstonia will temporarily store carbon sources and energy in the form of polyhydroxybutyrate (PHB).
[0003] Due to the limited knowledge of the metabolic regulatory network of Ralstonia, adaptive evolution is an effective tool for obtaining engineered strains with complex phenotypes. Especially in combination with the rapidly developing omics tools in recent years, adaptive evolution also provides an effective means for exploring phenotype-genotype relationships. There have been many studies using adaptive evolution to obtain engineered Ralstonia strains with different phenotypes, such as v6C6 that can efficiently utilize glycerol ([1] Gonzalez-Villanueva M, Galaiya H, Staniland P, et al. Adaptive laboratory evolution of Cupriavidus necator H16 for carbon co-utilization with glycerol[J]. International Journal of Molecular Sciences, 2019, 20(22): 5735), Ralstonia that is tolerant to high concentrations of isobutanol ([2] Experimental evolution and gene knockout studies reveal AcrA-mediated isobutanol tolerance in Ralstonia eutropha[J]. Journal of Bioscience and Bioengineering, 2016, 122(1): 64-9), etc.
[0004] However, due to the low spontaneous mutation rate of bacteria, there are problems such as long time consumption and low efficiency in adaptive evolution. Disrupting the intracellular mismatch repair mechanism or introducing new mutation mechanisms to increase the spontaneous mutation rate of bacteria is an effective way to solve this problem. For example, the commonly used deaminases currently include APOBEC derived from rats ([3] Komor A C, Kim Y B, Packer M S, et al. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage [J]. Nature, 2016, 533(7603): 420-4), and PmCDA derived from lampreys ([4] Nishida K, Arazoe T, Yachie N, et al. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems [J]. Science, 2016, 353(6305)). However, the two deaminases introduced in these two literatures achieve site-directed mutagenesis by fusing with Cas proteins.
[0005] Currently, some methods for increasing the mutation rate have been established in other bacteria such as Escherichia coli, such as GREACE ([5] Luan G, Cai Z, Li Y, et al. Genome replication engineering assisted continuous evolution (GREACE) to improve microbial tolerance for biofuels production [J]. Biotechnology for Biofuels, 2013, 6(1): 1-11), Helicase-AID ([6] Wang J, Zhao D, Li J, et al. Helicase-AID: A novel molecular device for base editing at random genomic loci [J]. Metabolic Engineering, 2021, 67: 396-402), etc. However, these methods have not been applied to Rothia bacteria yet. Summary of the Invention
[0006] In view of the above problems existing in the prior art, the present invention provides a system, an application and a genomic evolution method suitable for the genomic evolution of Cupriavidus necator, which can simply and efficiently improve the robustness and biosynthesis efficiency of Cupriavidus necator.
[0007] A system suitable for the genomic evolution of Cupriavidus necator H16 includes an expression vector for fusing and expressing a gene encoding cytosine deaminase and a gene encoding a specific single-stranded DNA-binding protein.
[0008] The gene encoding cytosine deaminase is: the cytosine deaminase encoding gene APOBEC derived from Rattus norvegicus or the cytosine deaminase encoding gene PmCDA derived from Lampetra japonica.
[0009] The gene encoding the specific single-stranded DNA-binding protein is derived from Cupriavidus necator, specifically any one of the following: (1) DNA helicase dnaB; (2) DNA primase dnaG; (3) single-stranded binding protein SSB; (4) single-stranded binding protein h16_A0402.
[0010] Among them, fusing and expressing two genes means that the coding sequences of the two genes are directly connected or connected through a linker sequence in the middle, and transcribed and translated into a fusion protein in which the two proteins are fused together. Preferably, when the two proteins are fused, they are connected by a linker peptide in the middle, which can reduce the influence between the two proteins directly. Correspondingly, a gene sequence encoding a linker peptide is added between the two genes. For example, the XTEN linker on the BE4 plasmid is used for connection.
[0011] Preferably, the nucleotide sequence of the PmCDA or APOBEC gene is codon-optimized according to Cupriavidus necator.
[0012] Preferably, the gene sequence of the cytosine deaminase encoding gene APOBEC is shown as SEQ ID No.1 (wild-type sequence) or SEQ ID No.2 (sequence codon-optimized according to Cupriavidus necator);
[0013] The gene sequence of the cytosine deaminase encoding gene PmCDA (sequence codon-optimized according to Cupriavidus necator) is shown as SEQ ID No.3;
[0014] The gene sequence of DNA helicase dnaB is shown as SEQ ID No.4;
[0015] The gene sequence of DNA primase dnaG is shown as SEQ ID No.5;
[0016] The gene sequence of the single-stranded DNA binding protein SSB is shown in SEQ ID No. 6;
[0017] The gene sequence of the single-stranded DNA binding protein h16_A0402 is shown in SEQ ID No. 7.
[0018] Preferably, the system is a recombinant expression plasmid, comprising a plasmid backbone, a gene encoding cytosine deaminase, and a gene encoding a specific single-stranded DNA binding protein, wherein the gene encoding cytosine deaminase and the gene encoding a specific single-stranded DNA binding protein are expressed in fusion.
[0019] The present invention also provides the application of the system in improving the robustness and biosynthesis efficiency of Rhodococcus strains.
[0020] The present invention also provides a transgenic Rhodococcus into which the system has been introduced.
[0021] The present invention also provides the application of the transgenic Rhodococcus as a chassis strain in screening for strains with high robustness and / or biosynthesis efficiency.
[0022] The present invention also provides a genomic evolution method applicable to Rhodococcus. According to the target, continuous screening and directed evolution are performed on the transgenic Rhodococcus to obtain strains with high robustness and / or biosynthesis efficiency. Preferably, the target is to improve the substrate consumption rate of the strain, expand the substrate spectrum, and enhance the tolerance to organic reagents, oxidants or electro-microbial systems. More preferably, the organic reagent is at least one of isopropanol, isobutanol and acid addition, and the oxidant is hydrogen peroxide.
[0023] Using the genomic evolution method established by the present invention to continuously evolve the Rhodococcus genome has the advantages of simplicity and high efficiency in operation; in terms of function, it can improve the substrate consumption rate, expand the substrate spectrum, and enhance the tolerance to growth environments such as organic reagents, oxidants and electro-microbial systems, which is helpful for subsequent synthetic biology transformation.
[0024] Therefore, using the genomic evolution method of the present invention can create diversity in the traits and functions of the cells. According to the requirements of industrial production, continuous screening and directed evolution can be performed on a certain trait (such as strain robustness and biosynthesis efficiency). BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 For pBBR-P ara -APOBECRe(a) and pBBR-P ara -PmCDARe(b) plasmid maps.
[0026] Figure 2 It is pBBR-P ara -Plasmid maps of APOBECRe and different single-stranded binding protein genes. Among them, a is APOBECRe-dnaB; b is APOBECRe-dnaG; c is APOBECRe-SSB; d is APOBECRe-A0402.
[0027] Figure 3 It is the detection result graph of the influence of different deaminases on the transformation efficiency (a) and growth rate (b) of Ralstonia bacteria.
[0028] Figure 4 It is the detection result graph of the growth curve (a) and relative mutation rate (b) of different genomic evolution systems in Ralstonia bacteria.
[0029] Figure 5 It is the detection result graph of the growth of genomic mutant strains of Ralstonia bacteria in media containing different concentrations of isopropanol and isobutanol.
[0030] Figure 6 It is the detection result graph of the growth of genomic mutant strains of Ralstonia bacteria in media containing different concentrations of formate.
[0031] Figure 7 It is the detection result graph of the effect of different genomic evolution tools on improving the H2O2 tolerance of Ralstonia bacteria.
[0032] Figure 8 It is the detection result graph of the effect of continuous evolution of H2O2 tolerance using APOBECRe-dnaB.
[0033] Figure 9 It is the detection result graph of the effect of continuous evolution of APOBECRe-dnaB in MES.
[0034] Figure 10 It is the detection result graph of the application of genomic evolution to improve the mBDO production of Ralstonia bacteria in the MES system. Among them, a is the growth situation; b is the mBDO production. Specific implementation methods
[0035] The plasmid pBBR1MCS-2 was purchased from Addgene. The Escherichia coli DH5a used for constructing the plasmid was purchased from Beijing Tsingke Biotechnology Co., Ltd. Ralstonia eutropha H16 was purchased from the China Center of Industrial Culture Collection (CICC). DNA polymerase, restriction endonucleases and T4 ligase were purchased from NEB Company. The plasmid extraction kit was purchased from AXYGEN Co., Ltd., and the PCR product nucleic acid purification kit was purchased from Thermo Scientific Company.
[0036] The culture medium for Escherichia coli is LB medium, and the formula is: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.
[0037] Ralstonia is cultured using MM medium, and the formula is: 9 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 1 g / L (NH4)2SO4, 80 mg / L MgSO4·7H2O, 1 mg / L CaSO4·2H2O, 0.56 mg / L NiSO4·7H2O, 0.4 mg / L ferric citrate, 200 mg / L NaHCO3, 1 mL / L trace elements (1.5 g / L NTA, 0.3 g / L H3BO3, 0.2 g / L CoCl2·6H2O, 0.1 g / L ZnSO4·7H2O, 0.03 g / L MnCl2·4H2O, 0.03 g / L Na2MoO4·2H2O, 0.02 g / L NiCl2·6H2O, and 0.01 g / L CuSO4·5H2O), with fructose at 10 mg / mL as the carbon source.
[0038] Table 1 Primer sequence list used in the present invention
[0039]
[0040]
[0041] Example 1: An evolutionary tool for increasing the genomic mutation rate and its application
[0042] 1. Genomic expression vector, and its preparation process is as follows:
[0043] (a) Amplify the APOBEC and PmCDA sequences:
[0044] The PCR reaction system is as follows: in a 50 μL reaction system, it contains 25 μL of Q5 DNA polymerase mix, 2.5 μL each of the upstream primer and the downstream primer, 1 μL of the template, and 19 μL of ddH2O. The PCR cycling program is pre-denaturation at 98 °C for 2 min; denaturation at 98 °C for 10 s, annealing at 55 °C for 10 s, extension at 72 °C for 4 min, for 31 cycles; extension at 72 °C for 2 min, and storage at 4 °C. The PCR cycling program for amplifying the specific DNA single-strand binding protein is pre-denaturation at 98 °C for 2 min; denaturation at 98 °C for 10 s, annealing at 55 °C for 10 s, extension at 72 °C at 2 kb / min, for 30 cycles; extension at 72 °C for 2 min, and storage at 4 °C. The fragment obtained by PCR is purified and recovered using a PCR product purification kit.
[0045] The primers for amplifying APOBEC (SEQ ID No.1) are pBBR-Para-APOBEC-F (the primers used in this invention are shown in Table 1) and pBBR-Para-APOBEC-R, and the template is xCas9(3.7)-BE4 (http: / / www.addgene.org / search / catalog / plasmids / ?q=108381).
[0046] The sequences of APOBECRe (SEQ ID No.2) and PmCDARe (SEQ ID No.3) are the sequences of APOBEC and PmCDA optimized by Rhodococcus codons, and are synthesized by Tsingke Biological (Nanjing).
[0047] The primers for amplifying APOBECRe are APOBECRe-F and APOBECRe-R.
[0048] The primers for amplifying PmCDARe are pBBR-Para-PmCDARe-F and pBBR-Para-PmCDARe-R.
[0049] (b) Using the genome of Rhodococcus as a template, amplify the gene sequence encoding the corresponding specific DNA single-strand binding protein:
[0050] The PCR reaction system is the same as above.
[0051] The primers for amplifying the DNA helicase dnaB (SEQ ID No.4) of Rhodococcus are dnaB-F and dnaB-R.
[0052] The primers for amplifying the DNA primase dnaG (SEQ ID No.5) of Rhodococcus are dnaG-F and dnaG-R.
[0053] The primers for amplifying the single-strand binding protein SSB (SEQ ID No.6) of Rhodococcus are ssb-F and ssb-R.
[0054] The primers for amplifying h16_A0402 (SEQ ID No.7) of Rhodococcus are A0402-F and A0402-R.
[0055] (c) Prepare the plasmid backbone suitable for Rhodococcus:
[0056] Using the existing plasmid pBBR1MCS-2-Para-rfp in the laboratory (an operon consisting of an arabinose promoter, red fluorescent protein rfp, and rrnB T1 terminator inserted at the XhoI and PspOMI sites of plasmid pBBR1MCS-2, with XhoI and BamHI sites at both ends of the rfp gene for replacing the gene to be expressed) as a template, double digest with XhoI and BamHI, and separate and purify the backbone fragment by gel electrophoresis, that is, the plasmid backbone (pBBR1MCS-2-Para) applied in this system in Ralstonia
[0057] (d) Ligate the plasmid backbone pBBR1MCS-2-Para with APOBEC, APOBECRe, and PmCDARe genes, and use Gibson recombination technology to ligate the above fragments to obtain the expression vector of the genomic evolution tool. The linker between APOBECRe and the single-stranded DNA binding protein gene uses the XTEN linker on plasmid BE4 (the XTEN linker sequence is: tctggtggttcttctggtggttctagcggcagcgagactcccgggacctcagagtccgccacacccgaaagttctggtggttcttctggtggttct)
[0058] Add the purified APOBEC, APOBECRe, PmCDARe (obtained in step a), specific DNA single-stranded binding proteins (obtained in step b, a total of 4 types), and plasmid backbone (obtained in step c) to the Gibson Assembly reaction system at a ratio of 0.03 pmol:0.03 pmol:0.03 pmol, add 15 μL of Gibson Assembly Mix, and add ddH2O to make the final reaction system 20 μL; incubate at 50 °C for 60 min. Heat shock transform E. coli DH5α competent cells; evenly coat on an LB solid medium containing 50 μg / mL kanamycin, and culture overnight at 37 °C in an inverted position; select positive clones, and extract the plasmid, which is the genomic evolution expression vector. The expression vector for Ralstonia is as Figure 1 as Figure 2 shown (due to the subsequent discovery of the high toxicity of PmCDARe to cells, the final evolution system used is APOBECRe fused with and expressing 4 types of DNA single-stranded binding proteins, namely APOBECRe-dnaB; APOBECRe-dnaG; APOBECRe-SSB; APOBECRe-A0402)
[0059] 2. Functional verification of the genomic evolution tool
[0060] The genomic evolution process is as follows: Extract the genomic evolution tool expression plasmid and transform Rhodococcus, culture and screen to obtain transformants;
[0061] a. Extract the expression plasmids (pBBR1MCS-2-Para-rfp) of the genomic evolution system and the control group from E. coli, and transform them into Rhodococcus respectively. Screen the transformed Rhodococcus on LB (LB+K+G) solid medium containing 50 μg / mL kanamycin and 10 μg / mL gentamicin;
[0062] b. Pick 3 single colonies from each solid medium and culture them in 3 mL of LB+K+G in a 24-well plate for 24 - 36 h as seed solutions. Transfer them to a 24-well plate containing 3 mL of LB+K+G+Ara (containing 2 mg / mL arabinose) at an inoculation amount of 2% (volume ratio concentration) and culture for 48 h, and repeat the transfer once to accumulate mutations;
[0063] c. Take 1 mL of the bacterial solution, centrifuge and concentrate it, and spread it all on an LB+K+G+Ara+Cm (containing 10 μg / mL chloramphenicol) plate. Dilute 1 μL by 1000 times and spread 100 μL on an LB+K+G+Ara plate;
[0064] d. The ratio of the number of colonies on the two plates corresponds to the genomic mutation rate of the engineered strain. Set the ratio of the control group (pBBR-Para-rfp) to 1 and calculate the relative mutation rates of other groups;
[0065] After repeating this experiment three times, statistical analysis of the data was performed. The final result is the average value of 9 groups of experiments (pick 3 single colonies each, and repeat three times here, a total of 9 groups were done for each).
[0066] As Figure 3 shown, PmCDARe has strong cytotoxicity to Rhodococcus, and it is almost impossible to obtain transformants. APOBECRe can obtain a considerable number of transformants and has little impact on growth during liquid culture. The cytotoxicity of PmCDA in bacteria is much greater than that of APOBEC. And APOBEC has a high transformation efficiency. This may be because APOBEC is not codon-optimized and has a low expression level in Rhodococcus, so it also grows faster in the early stage of liquid culture, but there is also an obvious growth inhibition phenomenon in the later stage of growth. In summary, APOBECRe was selected to construct the subsequent genomic evolution tool.
[0067] The experimental results of the mutation rate are as Figure 4As shown, except for APOBECRe-A0402, other APOBECRe systems have no obvious growth inhibitory effect on Rothia. The relative mutation rate of APOBECRe-dnaB is the highest, which is 33 times higher than that of the control; followed by APOBECRe-SSB, which is 11 times higher than that of the control.
[0068] The above results prove that this genomic evolution tool significantly increases the genomic mutation rate of Rothia.
[0069] Application Example 1: Tolerance Test of Genomic Mutation Strains to Isopropanol and Isobutanol
[0070] An evolution tool that increases the genomic mutation rate and accelerates the directed evolution of the Rothia genome, improving its tolerance to isopropanol and isobutanol.
[0071] Using Rothia to produce biofuels such as isopropanol and isobutanol is one of the current research hotspots. However, the tolerance problem is a major factor limiting its high yield. Previous studies have increased the tolerance of Rothia to isopropanol by expressing the chaperone protein GroESL. Adaptive evolution is a more convenient way and is expected to obtain strains with higher tolerance.
[0072] a. Take the bacterial liquid of each sample in 2.c (section 2.c of Example 1) above that has been continuously passaged for 2 generations and grown stably, and inoculate it into a 24-well plate containing LB+K+G+2mg / mL Ara with different concentrations of isopropanol (1%, 2%, and 3% (volume ratio concentration)) and isobutanol (1%, 1.5%, and 2% (volume ratio concentration)) at 2% (volume ratio concentration);
[0073] b. Measure the OD 600 value of the bacterial liquid at 9h, 24h, and 48h, and compare the growth of different strains in the medium containing different concentrations of isopropanol and isobutanol;
[0074] The experimental results are as Figure 5As shown in the figure, under 1% isopropanol stress, the genome mutant strains did not show obvious growth advantages, while the cytotoxicity of APOBECRe-A0402 was further amplified under isopropanol stress. Under 3% isopropanol stress, the genome mutant strains had obvious growth advantages. After 48 h, only the APOBECRe-dnaB and APOBECRe-SSB strains grew normally, and the remaining APOBECRe strains and the control strains hardly grew. The toxicity of isobutanol is greater than that of isopropanol, but APOBECRe-dnaB and APOBECRe-SSB also had growth advantages relative to other strains. This result is consistent with the result of the relative mutation rate measured by chloramphenicol resistance, indicating that the types and sites of mutations required for such tolerance phenotypes may be correlated, and APOBECRe-dnaB and APOBECRe-SSB may have certain generality in the evolution of such phenotypes.
[0075] Application Example 2: Tolerance test of genome mutant strains to formic acid
[0076] An evolutionary tool that increases the genome mutation rate and accelerates the directed evolution of the Rhodobacter genome, improving its tolerance to formic acid.
[0077] As a typical one-carbon compound, formic acid has strong reducibility and is therefore called liquid hydrogen. It can be used as an electron transfer medium in the MES system. At the same time, in the metabolic process of Rhodobacter, formic acid is also an important by-product. Rhodobacter itself has a formic acid utilization pathway and theoretically can use this compound that exists abundantly in industrial waste gas for growth. However, when Rhodobacter is cultured with sodium formate as the sole carbon source, the high concentration of sodium formate severely inhibits cell growth, which has become a major bottleneck in the utilization of formic acid. Genome evolution can improve the tolerance and utilization rate of Rhodobacter to formic acid and increase the substrate selection during the cultivation of Rhodobacter.
[0078] a. Screen and determine that 8 g / L is the most suitable addition concentration of HCOONa·2H2O;
[0079] b. The culture and OD detection methods are the same as above (Application Example 1);
[0080] Since when sodium formate is used as the sole carbon source (or CO2 is introduced) in MM, the OD is too low and the cell activity is poor, and subculture cannot be carried out. Moreover, sodium formate has high toxicity, so the tolerance of different APOBECRe strains to HCOONa·2H2O was tested in LB. The experimental results are as Figure 6 shown. At low concentrations, the APOBECRe strains had growth advantages at the initial stage; at high concentrations, the control strains could hardly grow, further highlighting the growth advantages of the APOBECRe strains.
[0081] Experiments have proven that using this genomic evolution tool has improved the formic acid tolerance of Rothia, providing the possibility of future growth using formic acid as the sole carbon source and synthesizing high-value-added compounds.
[0082] Application Example 3: Tolerance Test of Genomic Mutant Strains to Hydrogen Peroxide
[0083] A class of evolution tools that increase the genomic mutation rate and accelerate the directed evolution of the Rothia genome, improving its tolerance to hydrogen peroxide.
[0084] Regarding the compatibility issue between Rothia and the inorganic system in the MES system, the most prominent is the cytotoxicity of reactive oxygen species (ROS). ROS cannot be avoided during the electrolysis of water, and ROS has a relatively large toxic effect on Rothia. Some research reports have pointed out that the main component of ROS in MES is hydrogen peroxide (H2O2). Therefore, improving the tolerance of Rothia to H2O2 can, to a certain extent, solve the ROS cytotoxicity problem.
[0085] a. Transfer the APOBECRe-dnaB bacterial solution after two rounds of induced mutation accumulation in 2.c (section 2.c of Example 1) above at 2% (volume ratio concentration) to an LB+K+G+2mg / mL Ara medium containing 5 mM H2O2;
[0086] b. Transfer once every 36 - 48 h, and increase the H2O2 concentration by 2.5 mM each time until 35 mM;
[0087] c. Streak the finally evolved bacterial solution on an LB+K+G plate, pick single colonies and culture them in a 24-well plate of LB+K+G for 24 - 36 h;
[0088] d. Then transfer at 2% (volume ratio concentration) to LB+K+G media containing 0, 10, and 35 mM H2O2 respectively, and measure the OD 600 value every 12 h;
[0089] The results are as Figure 7 shown. The cytotoxicity of APOBECRe-A0402 was further amplified under H2O2 stress and could not grow at a concentration of 5 mM, while there were significant differences in H2O2 tolerance among strains of APOBECRe-dnaG. In comparison, APOBECRe-dnaB and APOBECRe-SSB still performed better. Therefore, the better APOBECRe-dnaB was selected for continuous evolution experiments.
[0090] Continuous evolution of APOBEC, APOBECRe-dnaB, and control strains was started from 5 mM H2O2. However, when the control and APOBEC strains were transferred to a medium containing 10 mM H2O2, they could no longer grow normally, while the APOBECRe-dnaB strain was continuously evolved up to 35 mM H2O2. The evolved bacterial solution was streaked to pick single colonies and tested at different H2O2 concentrations. The results are as Figure 8 shown. The evolved strain eAPOBECRe-dnaB could still grow normally at 35 mM H2O2, indicating that the trait could be stably inherited.
[0091] The experiment proved that through this genomic evolution tool, Rhodobacter could rapidly improve its tolerance to hydrogen peroxide.
[0092] Application Example 4: Continuous evolution test of genomic mutant strains in the MES system
[0093] An evolution tool that increases the genomic mutation rate and accelerates the directed evolution of the Rhodobacter genome, improving its robustness and growth rate in the electro-microbial system (MES).
[0094] a. When continuously evolving in MES, the seed solution of the APOBECRe-dnaB strain cultured in MM+K+G+F was inoculated into a gas pre-culture device and cultured until the logarithmic growth phase.
[0095] b. Inoculate into the MES device (MM+K+2 mg / mL Ara) at an initial OD of 0.3. Transfer when the OD grows to 0.7 - 0.9. Inoculate at an initial OD of 0.3 and repeat the above process.
[0096] c. After the growth rate significantly increased, reduce the initial inoculation OD.
[0097] d. Measure the OD 600 value every 12 h.
[0098] Select the APOBECRe-dnaB strain as the starting strain and conduct continuous evolution in MES. The results are as Figure 9 shown. By the 4th round of evolution, the growth rate significantly increased and the OD also increased, proving the effect of genomic evolution.
[0099] The experiment proved that using this genomic evolution tool, Rhodobacter could rapidly and directionally evolve in the MES system, improving its ability to adapt to the growth environment.
[0100] Application Example 5: Test of mBDO synthesis by genomic mutant strains in the MES system
[0101] An evolutionary tool that increases the genomic mutation rate and accelerates the directed evolution of the genome of Roseburia, improving its production of 2,3-butanediol (mBDO) in the MES system.
[0102] mBDO is an emerging energy compound with high added value and is widely used in fields such as aerospace, food, and medicine. It is an important platform compound widely used industrially. There are mainly two methods for mBDO production: chemical synthesis and biosynthesis. However, with the continuous development of biotechnology and fermentation processes, the method of synthesizing BDO by microbial fermentation has been continuously improved, and its production cost has been controlled, gradually replacing the traditional route of producing from petroleum.
[0103] The biosynthesis method of mBDO in Roseburia is as follows: (1) Pyruvate produced by glycolysis is decarboxylated by α-acetolactate synthase and converted into α-acetolactate; (2) α-Acetolactate decarboxylase can convert α-acetolactate into acetoin under anaerobic conditions. In the presence of oxygen, α-acetolactate can spontaneously decarboxylate to form acetylacetone. (3) Acetoin reductase reduces acetoin to mBDO.
[0104] a. Construct a plasmid pBBR-ParaRBS-AlsS-AlsD-BDH containing the mBDO synthesis pathway, where the genes AlsS, AlsD, and BDH are all from pRS426-BDO ([7] Lian, J.; Chao, R.; Zhao, H. Metabolic engineering of a Saccharomyces cerevisiae strain capable of simultaneously utilizing glucose and galactose to produce enantiopure (2R,3R)-butanedio1. Metabolic Engineering. 2014, 23, 92 - 99), and the gene sequences are shown in SEQ ID No. 8 - 10 respectively;
[0105] b. Take the Roseburia strain evolved in MES in the above (Application Example 4), culture it in antibiotic-free LB for 72 h to lose the plasmid, prepare competent cells, and electrotransform the mBDO synthesis pathway plasmid in the above (Application Example 5.a);
[0106] c. Inoculate the evolved strain synthesizing mBDO and the wild strain into a gas pre-culture device and culture them until the logarithmic growth phase;
[0107] d. Inoculate into the MES device (MM + K + 2 mg / mL Ara) at an initial OD of 0.3, transfer when the OD reaches 0.7 - 0.9, inoculate at an initial OD of 0.3 and repeat the above process;
[0108] e. Sample for 30 min every 24 h and measure the OD value with a microplate reader; 600 value;
[0109] f. After fermentation, use HPLC to detect the yield of mBDO. ([7]Lian, J.; Chao, R.; Zhao, H. Metabolic engineering of a Saccharomyces cerevisiae atrain capable ofsimultaneously utilizing glucose and galactose to produce enantiopure(2R,3R)-butanediol. Metabolic Engineering. 2014. 23. 92 - 99).
[0110] The results are as Figure 10 shown. The growth of the strain after genome evolution in the MES system is significantly better than that of the unevolved wild strain. The mBDO yield of the control group reached the highest value at 120 h, while the yield of the evolved strain continued to increase after 120 h, reaching 0.314 g / L, with a 70% increase in yield.
[0111] The experiment proves that through this genome evolution tool, Rhodobacter can quickly adapt to the MES system, improve its own robustness and biosynthesis efficiency, laying a foundation for the application of Rhodobacter in CO2 fixation and green biomanufacturing.
Claims
1. Application applicable to Ralstonia Cupriavidus necator Application of a system for the genome evolution of H16 in improving the robustness of Ralstonia strains and the synthesis efficiency of 2,3-butanediol The system is a recombinant expression plasmid, including a plasmid backbone, a gene encoding cytosine deaminase, and a gene encoding a specific single-stranded DNA-binding protein, wherein, The gene encoding cytosine deaminase and the gene encoding a specific single-stranded DNA-binding protein are fused and expressed; The gene encoding the cytosine deaminase is: the cytosine deaminase encoding gene derived from rats APOBEC ; The gene encoding the specific single-stranded DNA-binding protein is the DNA helicase dnaB derived from Ralstonia; Cytosine deaminase encoding gene APOBEC The gene sequence is shown in SEQ ID No.1 or SEQ ID No.2; The gene sequence of DNA helicase dnaB is shown in SEQ ID No.
4.
2. A genetically modified Rhodobacter sphaeroides, characterized in that, Transferred to a system applicable to the genomic evolution of Stenotrophomonas maltophilia Cupriavidus necator H16 The system is a recombinant expression plasmid, including a plasmid backbone, the gene encoding cytosine deaminase, and the gene encoding a specific single-stranded DNA-binding protein, wherein the gene encoding cytosine deaminase and the gene encoding a specific single-stranded DNA-binding protein are fused and expressed; The gene encoding the cytosine deaminase is: the cytosine deaminase encoding gene derived from rats APOBEC ; The gene encoding the specific single-stranded DNA-binding protein is the DNA helicase dnaB derived from Ralstonia; Cytosine deaminase-encoding gene APOBEC The gene sequence is shown in SEQ ID No.1 or SEQ ID No.2; The gene sequence of DNA helicase dnaB is shown in SEQ ID No.
4.
3. Use of the transgenic Ralstonia according to claim 2 as a chassis strain in screening for strains with high robustness and / or 2,3-butanediol synthesis efficiency.
4. A genomic evolution method applicable to Ralstonia, characterized in that, The transgenic Ralstonia according to claim 2 is continuously screened and directionally evolved according to the target to obtain a strain with high robustness and / or 2,3-butanediol synthesis efficiency.
5. The genomic evolution method applicable to Ralstonia according to claim 4, characterized in that, The target is to improve the substrate consumption rate of the strain, expand the substrate spectrum, and enhance the tolerance to organic reagents, oxidants or electro-microbial systems.
6. The genomic evolution method applicable to Ralstonia according to claim 5, characterized in that, The organic reagent is at least one of isopropanol, isobutanol and formic acid, and the oxidant is hydrogen peroxide.
Citation Information
Patent Citations
Base editing system and base editing method for increasing genome mutation rate
CN113621634A
Ralstonton recombinant strain for producing isobutanol by using fructose and carbon dioxide as well as construction method and application of Ralstonton recombinant strain
CN119530264A